ID: 1152502569

View in Genome Browser
Species Human (GRCh38)
Location 17:80722430-80722452
Sequence GTTTTTAAGGGGAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 1, 2: 9, 3: 90, 4: 466}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152502557_1152502569 27 Left 1152502557 17:80722380-80722402 CCTGGGAGAAGATGTGGAATAAG 0: 1
1: 0
2: 1
3: 31
4: 226
Right 1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG 0: 1
1: 1
2: 9
3: 90
4: 466
1152502560_1152502569 -10 Left 1152502560 17:80722417-80722439 CCCCTGACGATAAGTTTTTAAGG 0: 1
1: 0
2: 0
3: 1
4: 71
Right 1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG 0: 1
1: 1
2: 9
3: 90
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152502569 Original CRISPR GTTTTTAAGGGGAGGGTGGA AGG Intronic
900198812 1:1393082-1393104 CTTTTCCTGGGGAGGGTGGAGGG - Intronic
900568508 1:3347098-3347120 GTCTTTCCGGGGAGGGTGGAGGG + Intronic
901078752 1:6571818-6571840 TTTTTTGGGGGGAGGATGGAGGG - Intronic
901263443 1:7890961-7890983 GTTTTGTGGGGGGGGGTGGAGGG - Intergenic
901310661 1:8267209-8267231 TTTTTTAAGATGGGGGTGGATGG + Intergenic
901366247 1:8751460-8751482 GAATTTAAGAGAAGGGTGGAAGG + Intronic
901631500 1:10650337-10650359 GTTTAAAAGGGGATGGGGGAGGG - Intronic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
901929547 1:12588228-12588250 GTTGTTGTGGGGAGGCTGGAAGG - Intronic
902982676 1:20137231-20137253 CTTGGTAGGGGGAGGGTGGAGGG + Intergenic
904295103 1:29515166-29515188 GATTTAAAAGGGAGGGAGGATGG + Intergenic
904314324 1:29650554-29650576 TTTTTTGGGGGGTGGGTGGATGG + Intergenic
904362563 1:29986270-29986292 GTTTTTAAGGGGACCATAGAGGG - Intergenic
905941658 1:41867923-41867945 TTTTGGAAGGGGAGGGGGGAGGG - Intronic
905959371 1:42030910-42030932 GTTTTAAAAGGGAGGGTCGAAGG + Intronic
906135344 1:43495837-43495859 GTTTTTGAGGAGAAGGTGAATGG - Intergenic
906234087 1:44193236-44193258 ATTTTTTTGGGGGGGGTGGATGG + Intergenic
906420897 1:45666039-45666061 GTTTTTGAGGGGTGGGGGAAAGG - Intronic
907888284 1:58614244-58614266 GTTTTTAAGGAGATCCTGGAGGG - Intergenic
908645241 1:66271381-66271403 ACTTTCAAGGGGAGGGTGGGTGG - Intronic
908920809 1:69189240-69189262 GTGGTGAAGGGGAGGGGGGAAGG - Intergenic
909030423 1:70533162-70533184 TACCTTAAGGGGAGGGTGGATGG + Intergenic
909115021 1:71522714-71522736 GTGTGTAAGGGGGGGGTAGAGGG - Intronic
910235842 1:85035716-85035738 ATTTTTTAGGGGAGAGAGGATGG - Intronic
910263009 1:85309603-85309625 GCTTTGGAGGGGAGGGTGCAAGG - Intergenic
910405951 1:86890464-86890486 GTTATTAAGTAGAGGGTAGAAGG - Intronic
910810051 1:91226799-91226821 GTTTTTAAGGGTAATTTGGAGGG - Intergenic
911338661 1:96611245-96611267 GTTTTCAAGGTCAGGGTGAATGG + Intergenic
912490337 1:110059299-110059321 GTGTTTACTGGGAGGGTGGGAGG + Intronic
913049656 1:115106143-115106165 GTGTTTAATGGGATGCTGGAAGG + Intergenic
913118386 1:115717445-115717467 GTTTTTAAGAGGATCATGGAAGG - Intronic
913440927 1:118896795-118896817 GTTCTTAAGGGAAGAGGGGATGG + Intronic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914258181 1:145977376-145977398 GTTTTAAAGGAGAGGAAGGAAGG - Intronic
914334084 1:146699423-146699445 GATTGGAAGAGGAGGGTGGAAGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG + Exonic
915463473 1:156082672-156082694 TTTTTTAAGGGGAGGGTGCGGGG + Intronic
915657009 1:157369029-157369051 GTTTTTAAGGATATCGTGGAGGG + Intergenic
915671982 1:157497286-157497308 GTTTTTAAGGATATAGTGGAGGG - Intergenic
916382793 1:164231620-164231642 GCTGGTAAGGGGAGGGTGGTGGG + Intergenic
916433902 1:164759210-164759232 TTTTTGCAGGTGAGGGTGGAAGG + Intronic
916592474 1:166205832-166205854 GTTTTTAAGTTGGGGGTTGAGGG + Intergenic
916998245 1:170325469-170325491 GTTTTTAAGGCTAGACTGGACGG - Intergenic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
917216378 1:172682372-172682394 GTTTTCAATGGGGGGGTTGATGG + Intergenic
917834182 1:178927831-178927853 GTTTTTGGGGGGGGGGTGGTTGG + Intergenic
918004605 1:180530014-180530036 GGTGTTAAGGGGAGGGTGTCAGG + Intergenic
918052096 1:180982764-180982786 GTTTTTAAGTAGAGGGGAGAAGG + Intronic
918130106 1:181619880-181619902 GTTTTATTGGGGAGGGGGGAAGG + Intronic
918979482 1:191537118-191537140 GCTTTTAAGGGGATCATGGAGGG - Intergenic
920552577 1:206875834-206875856 GTTTTTTGGGGGAGGGGGGAGGG - Intergenic
920784450 1:209027429-209027451 TTTTTGAAGGGGAAGGTGGGGGG + Intergenic
920959533 1:210652133-210652155 GTATTAAATGGGTGGGTGGATGG + Intronic
921655932 1:217737451-217737473 ATCTTTAAGGGAAGGGAGGAGGG + Intronic
922247550 1:223815448-223815470 ATTTTGTAGGGGTGGGTGGAAGG - Intronic
922298944 1:224278581-224278603 GTTTTTAACGGGTGGGTAGGGGG - Intronic
922421373 1:225463018-225463040 ATTTTTAAGGGGATCATGGAGGG - Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924592096 1:245413797-245413819 GTCCTGAAGGGGAGAGTGGAGGG + Intronic
924715370 1:246567844-246567866 TTTTTTAAGGGGAGAGGGGGAGG - Intronic
924796289 1:247294818-247294840 GTTTTTAAAGGCAGGGCGGCTGG + Intergenic
1064104744 10:12491484-12491506 GTTGTGAGGGGGTGGGTGGATGG + Intronic
1066129565 10:32379400-32379422 GTTTTTAAGGGGGGCGGGGGAGG - Intergenic
1066319677 10:34289186-34289208 TTTTTTGAGGGGAGGGTGTTGGG + Intronic
1068725729 10:60300504-60300526 GTATTTAAATGGAGGGTGGGCGG + Intronic
1069028253 10:63567796-63567818 GTTTTTGGGGGGTGGGAGGAAGG + Intronic
1069565571 10:69461365-69461387 GTATTTCACTGGAGGGTGGAAGG + Intronic
1069594038 10:69659076-69659098 GGTGTTGAGGTGAGGGTGGATGG + Intergenic
1070105909 10:73431109-73431131 GTTGCTAAGGGCTGGGTGGAAGG + Intronic
1070716726 10:78727850-78727872 GTTTGGAGGGGGAGGGTGGGTGG - Intergenic
1071361598 10:84851737-84851759 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1073205071 10:101764739-101764761 TTTTTTGAGGGGCGGGGGGATGG - Intergenic
1073464798 10:103688316-103688338 TTTTTGAATGGGTGGGTGGATGG - Intronic
1074394937 10:113089737-113089759 GTTTACAAGGAGAGGGTGGAGGG + Intronic
1074398492 10:113120632-113120654 GTTTTCAAGGGGACGTAGGAGGG + Intronic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1079352550 11:19704013-19704035 GTTTTTTTTGGGGGGGTGGAAGG + Intronic
1080449440 11:32366340-32366362 GTTTTTAATGAGAGGCTGGGTGG + Intergenic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1081185074 11:40032475-40032497 GTTTTTAAGGATAGTTTGGAGGG + Intergenic
1081295039 11:41375453-41375475 GTTTTTAAGGGTAAGGTATAAGG + Intronic
1081374179 11:42339688-42339710 GTTTTTAAGGGCAGGATGGGGGG - Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1083209832 11:61176386-61176408 GTTTTGAAGGGAAGGGAGGAGGG - Intergenic
1083459452 11:62801047-62801069 TTTTTGAAGGGGTGGGTAGAGGG - Intronic
1083574901 11:63783370-63783392 CTTTTGAAGGGGAGCCTGGAAGG - Intergenic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1086453500 11:86939772-86939794 TTTTTAAAGGGGTGGGTGGGGGG + Intronic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1088588012 11:111377072-111377094 TTTTTAAAGGGGATGCTGGAGGG - Intronic
1088597215 11:111449534-111449556 CATTTGAATGGGAGGGTGGAGGG - Intronic
1088747953 11:112820330-112820352 GTTTTTTATGGGAGGCAGGATGG - Intergenic
1089089665 11:115860442-115860464 GTTTTAAAAGGGATGGAGGAAGG + Intergenic
1089165471 11:116472794-116472816 GGTTTTCAGGGGAGGAGGGAGGG - Intergenic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1089813028 11:121147384-121147406 GATTGTAAGGGAAGGGTGGGAGG + Intronic
1089893470 11:121904317-121904339 GCACTTAAGGGGTGGGTGGAAGG - Intergenic
1090127345 11:124101026-124101048 TTTTTTGAGGGGGGTGTGGAAGG + Intergenic
1092214675 12:6672638-6672660 GTTTTTGGGAGGAGGGAGGAAGG - Intronic
1092501720 12:9053968-9053990 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1093195779 12:16128125-16128147 GTTCATAAGGTGAGTGTGGAGGG + Intergenic
1094413587 12:30193732-30193754 ATTTTTAAGGGCAGGGTGGCAGG + Intergenic
1094417294 12:30230871-30230893 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1094564185 12:31584830-31584852 TTTTTTTCGGGGAGGGTGGGTGG - Intronic
1095768321 12:45921835-45921857 ATTTTGTGGGGGAGGGTGGAGGG + Exonic
1095775607 12:46006257-46006279 GTTTTTAAGGGAAGAGTGACTGG - Intergenic
1096122839 12:49099500-49099522 GTATTTAGGGGGAGGTAGGAGGG + Intronic
1096713071 12:53471988-53472010 GTTTTCAAGGGGTTGGTGGGGGG + Intronic
1096844980 12:54401491-54401513 GTGGTTTAGAGGAGGGTGGAAGG + Intronic
1097136096 12:56857072-56857094 GTTTTTAAGGAGAGTTTGGTGGG + Intergenic
1097247601 12:57615115-57615137 GTTTTTAGGGGGAGGCTGGTTGG + Intronic
1098091594 12:66907852-66907874 TTATTTGAGGGGAGGGTGGCTGG + Intergenic
1098124915 12:67280871-67280893 GTTCTTAAGGGGAGGGGAGGTGG + Intronic
1098915199 12:76250072-76250094 GGTTTTAGGGGGATGGGGGAGGG + Intergenic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1099861625 12:88230425-88230447 GTTTTTAAGGGTAATGCGGATGG - Intergenic
1100351559 12:93788609-93788631 GATTTTAAAGGGAGGGTGTGAGG + Intronic
1100854884 12:98749886-98749908 TATTTTAGGGGTAGGGTGGATGG + Intronic
1101119248 12:101562115-101562137 GTTTTTCAGGTGAGGCTGGAGGG - Intergenic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1103101404 12:118179448-118179470 GATATTATGGGGAGGGAGGAGGG + Intronic
1103179593 12:118898450-118898472 ATGTTTAAGTGGAGTGTGGAAGG + Intergenic
1104463999 12:128975858-128975880 TGTTTTAAGAGGTGGGTGGAAGG + Intronic
1105294355 13:19075159-19075181 GTCTTTAAAGAGAGGTTGGAGGG + Intergenic
1106026924 13:25964319-25964341 GTTTTTGAGGAGAGGGGTGAGGG - Intronic
1106779906 13:33048759-33048781 GCTTTTAAATGGTGGGTGGAAGG - Intronic
1108058382 13:46507982-46508004 GGGTTTAAGGGGAGGGTAGGTGG - Intergenic
1109866918 13:68276586-68276608 ATTTTTAGGGGCAGGGAGGAAGG + Intergenic
1110156118 13:72318935-72318957 GTTATAAAGGCGAGGGTAGAGGG - Intergenic
1110556533 13:76866023-76866045 GCTGGGAAGGGGAGGGTGGAGGG - Intergenic
1110832551 13:80047782-80047804 TTTTTTAAGAGGAGGTAGGATGG + Intergenic
1111102107 13:83601837-83601859 GTTTTTAAGGGGATCATGGTGGG - Intergenic
1112105162 13:96232022-96232044 GTTCTGAAGGGGAGTGTGGTAGG + Intronic
1112327045 13:98448597-98448619 TTTTTCAGGGGCAGGGTGGAGGG - Exonic
1112427332 13:99315040-99315062 GGTTAAAAGGGGAGGGAGGAAGG - Intronic
1113456966 13:110456194-110456216 GTTTACAAGGGGAAGGTGGTGGG + Intronic
1114829236 14:26119307-26119329 GTTATTGTGGGGTGGGTGGAGGG - Intergenic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1115435281 14:33364997-33365019 TTTTTTTGGGGGAGGGGGGAGGG + Intronic
1115995636 14:39193012-39193034 TTTTTTAAGTTGTGGGTGGAGGG + Intergenic
1117516313 14:56505298-56505320 GTCTTTCAGGGGCTGGTGGAGGG + Intronic
1117745880 14:58869140-58869162 ATTTTTAAGGGGATGGTCGCTGG - Intergenic
1118762873 14:68891146-68891168 GTCTAGAAGGGGAGGGTGAAAGG - Intronic
1119298320 14:73551255-73551277 GTTTTTAAAGGGATCATGGAGGG - Intronic
1119302616 14:73583442-73583464 GTTTTTAAAGGGATCATGGAGGG - Intergenic
1120779088 14:88469722-88469744 ATCTTTAACAGGAGGGTGGAAGG - Exonic
1120857170 14:89222790-89222812 TTTTTTAAAGGAAGGGTAGAGGG - Intronic
1121056290 14:90856829-90856851 GTTTTTCAGGGGCTGGTGGGAGG - Exonic
1122048250 14:99038500-99038522 ATAGTTAAGGGGAGGGTGGCTGG - Intergenic
1122114811 14:99522356-99522378 GGTGTGGAGGGGAGGGTGGAGGG - Intronic
1123949989 15:25262072-25262094 TTTTTTTTGGGGGGGGTGGAGGG - Intergenic
1124126369 15:26941304-26941326 GTTTTTTGGCGGGGGGTGGAGGG + Intronic
1124198014 15:27650221-27650243 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1124583709 15:30986011-30986033 ATTTTTCAGAGGATGGTGGAAGG + Intronic
1125133097 15:36307517-36307539 GTTTTCAATGGGAAGGTTGAGGG + Intergenic
1125196424 15:37052521-37052543 ATTTTTAAAGGGTGGGTGAAAGG + Intronic
1126396197 15:48220408-48220430 GTTTTTTAGGGCTGGGTGAAGGG - Intronic
1127292603 15:57583564-57583586 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1130247844 15:82269575-82269597 TTTTTTTGGTGGAGGGTGGAGGG + Intronic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1131695398 15:94871819-94871841 GTTTTGAAGGGTAGGGAGAAAGG - Intergenic
1133095624 16:3443286-3443308 GTTTTTAAGGGGGGGTTCGGAGG - Intronic
1133577485 16:7107636-7107658 GTTGTTTTGGGGAGGGTGGAAGG - Intronic
1133849865 16:9492637-9492659 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1133907022 16:10031711-10031733 GATTTTAAAGCCAGGGTGGATGG - Intronic
1134257294 16:12622749-12622771 CTTTTTAGGGGGAGGGGGGAAGG + Intergenic
1134610034 16:15600606-15600628 TTTTTTAAGGGGGGAGGGGATGG + Intronic
1135169502 16:20170824-20170846 GTTTTTAAGTGGAGGGTAGGAGG + Intergenic
1136103508 16:28012237-28012259 GTGTTTAAGGGGTGGTGGGAGGG - Intronic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1136586900 16:31192244-31192266 CTTTTTGATTGGAGGGTGGAAGG + Exonic
1137278679 16:46956113-46956135 TTTTTTAAGGGGGTGGTGGTAGG + Exonic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1138096237 16:54214210-54214232 GTTTCTAAGGGGAGGGGACATGG + Intergenic
1138790632 16:59899744-59899766 GTCTTTATGGGGAGGGGGGAGGG + Intergenic
1139174872 16:64674789-64674811 CTTTTTAGGGTGAGGCTGGAGGG - Intergenic
1139220881 16:65180359-65180381 TTGTTTAAAGGGAGGTTGGAAGG - Intergenic
1139803602 16:69544609-69544631 GTTTCTAAGGGGAAGGAGAAAGG + Intergenic
1139975201 16:70804434-70804456 GTTTTTAAGGGGATCCTGGAGGG + Intergenic
1139999534 16:71011826-71011848 GATTGGAAGAGGAGGGTGGAAGG - Intronic
1140712939 16:77695121-77695143 CTTTTTAGGGGGTGGGTGGGCGG + Intergenic
1140837966 16:78812719-78812741 TTTTTTAGGGGGTGGGAGGATGG - Intronic
1141105388 16:81229232-81229254 GTTTGCACTGGGAGGGTGGAAGG - Intergenic
1141682807 16:85554150-85554172 GCGTTTAAGGAGAGGGTGGGGGG + Intergenic
1141804935 16:86336214-86336236 GCTTTTCAGGGAAGGGTGGACGG + Intergenic
1142018839 16:87767184-87767206 ATTTTAAATGGGAAGGTGGAAGG - Intergenic
1143267538 17:5651428-5651450 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1143718511 17:8793734-8793756 GATTTTAAGGGAAGGATGGGAGG - Intergenic
1145996202 17:29106342-29106364 GTCTTTAAGGCAGGGGTGGAGGG + Intronic
1146017465 17:29245447-29245469 GTTTTGAAGGTGTGGGTGGCAGG + Intergenic
1146120409 17:30188975-30188997 TTTTTTGAGGGGGGTGTGGAGGG + Intergenic
1148021470 17:44556747-44556769 GTTTTTTAAGGGTGTGTGGAGGG + Intergenic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1148394458 17:47296930-47296952 CTATTTAAGCGAAGGGTGGATGG - Intronic
1148705019 17:49622518-49622540 GTTTTTCAGTGGAGGTTGAAAGG - Intronic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1149827034 17:59838067-59838089 GTTTTTAAGGGGTTGTTAGATGG + Intronic
1150069997 17:62142183-62142205 GTTTTTTAGAGAAGGGAGGAGGG + Intergenic
1150097132 17:62387103-62387125 TTTTTTAAGGGAAGGGTGATGGG + Intronic
1150553235 17:66230427-66230449 GTTGGTATGGGGAGGATGGAAGG - Intronic
1151889315 17:76942858-76942880 GTTTGCAAGGGGAGGGGAGAGGG - Intronic
1151952984 17:77365533-77365555 GTGTTCAAGTGTAGGGTGGATGG + Intronic
1152147596 17:78577525-78577547 CATTTTGAGGGGAGGTTGGAGGG + Intergenic
1152262228 17:79273414-79273436 GTGTTTTAGGGTGGGGTGGATGG + Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1152784098 17:82239118-82239140 GTTTTGAGGGGGAAGGTGGCGGG + Exonic
1152784137 17:82239293-82239315 GACTTTAATGGGAGGGTGGGTGG + Exonic
1153109969 18:1574279-1574301 GTTTTTAAAGGCAGGGAGGTTGG - Intergenic
1153248497 18:3096794-3096816 ATTTTGAGGGGGTGGGTGGAGGG - Intronic
1153544473 18:6191990-6192012 TTTTTTGAGGGGGGGGAGGAGGG - Intronic
1154214184 18:12403342-12403364 GATTTGAAGGTGAGGGTGGCAGG + Intergenic
1155569483 18:27176041-27176063 GTTTTTAGGGGATGGGGGGATGG + Intronic
1155605760 18:27604096-27604118 GTTTTGAAGAGGAGAGTGTATGG + Intergenic
1155851056 18:30774566-30774588 GTTTTTGAGGGGATCATGGAGGG - Intergenic
1156205556 18:34882296-34882318 TTTTGAAAAGGGAGGGTGGAAGG - Intronic
1157264283 18:46203997-46204019 GTTTTTACGGGGAGGGAAGTGGG + Intronic
1157324924 18:46662128-46662150 GCTTTTAAGGGGACCATGGAGGG - Intergenic
1157865036 18:51175431-51175453 GTAATTTAGGGGAGGGAGGAGGG - Exonic
1158705007 18:59784424-59784446 GTTTTAAAGGGGAAAGTGGATGG + Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1159263885 18:66053687-66053709 ATTTTTAAGGGGTTGGTGGAAGG + Intergenic
1159632903 18:70769312-70769334 GGCTTTTGGGGGAGGGTGGATGG + Intergenic
1161588284 19:5117312-5117334 GTTTTCAGGGTGGGGGTGGAGGG + Intronic
1161982633 19:7637716-7637738 GTTCTTGGGGGAAGGGTGGAGGG + Intronic
1163939265 19:20477625-20477647 GTTTTTAAGGGTAATGTGAACGG + Intergenic
1164284518 19:23801237-23801259 TTTTTTTAGGGGAGGGTTGGGGG + Intronic
1165302079 19:34976672-34976694 GATTTTAAGGGGATCATGGAAGG - Intergenic
1165660042 19:37570105-37570127 GTCTTTTAGGGGAGGGTGGGTGG - Intronic
1167389587 19:49185753-49185775 TTTTTTGGGGGGAGGGGGGATGG + Intronic
1167691448 19:50986460-50986482 GTCTTGAAGGAGATGGTGGAGGG + Intergenic
925310333 2:2877245-2877267 GCCTTCAAGGAGAGGGTGGAGGG + Intergenic
925948309 2:8887260-8887282 TTTTTTGAGGGGGTGGTGGAGGG - Intronic
926781237 2:16473995-16474017 GTTTGTAAGGGGTGGAAGGAGGG + Intergenic
927694763 2:25232234-25232256 TTTTATAATGGGAGGGGGGATGG - Exonic
929009671 2:37428536-37428558 GATTTAAGGGAGAGGGTGGAAGG - Intergenic
929419994 2:41780838-41780860 GTTTTTAAGGGGATCATGGAGGG - Intergenic
929630267 2:43452913-43452935 TTTTTTTGGGGGTGGGTGGAGGG - Intronic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
929942091 2:46342000-46342022 GTTTTTAAAGGAAGGATGGATGG - Intronic
930117313 2:47729610-47729632 GTTTTTAAGGGGATCATGGAGGG + Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
931161116 2:59691600-59691622 GGTTAAAAGGGGATGGTGGAAGG + Intergenic
931917266 2:66969696-66969718 GTTTTGAATGGGAGAGTGGGTGG + Intergenic
933562477 2:83905727-83905749 GGGTTTAAGGGGAGGAGGGAAGG + Intergenic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
935742125 2:106159025-106159047 GTTTTTAAGGGTAGTTTGGTGGG - Intronic
937054874 2:118926123-118926145 GTTTTTAAGAGCTGGGTGGAGGG - Intergenic
937082610 2:119151236-119151258 GTTTTTAAGGTTGGGGTGAAAGG - Intergenic
937227386 2:120377590-120377612 TTTTCTCAGGGGAGGGTGTAAGG - Intergenic
937718599 2:125063943-125063965 GTTTGTGTGGGGAGGGTGGTTGG + Intergenic
937816491 2:126256511-126256533 GCTTTTAAGGGGATCATGGAGGG - Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
939139749 2:138340126-138340148 TTTTTTAAGGGGTGGGGGGCAGG - Intergenic
939496630 2:142934238-142934260 CTTTTTAAGGGCAATGTGGATGG + Intronic
939531831 2:143372968-143372990 TTTTTTAAGAGGAGAGAGGATGG - Intronic
939829473 2:147054558-147054580 GGTATTAAGGGGAGTTTGGAAGG - Intergenic
939954783 2:148518608-148518630 GTTTTTAAGGAGGGGGTGATAGG + Intergenic
940158176 2:150681404-150681426 GTTTTTAAGAGGATCATGGAGGG + Intergenic
941233721 2:162943295-162943317 GTATTTAACCTGAGGGTGGAGGG - Intergenic
941806873 2:169718573-169718595 GTTGTTAGGGGGAGGGTGCTAGG - Intronic
942312664 2:174669992-174670014 GTTTTCAAGGGGAGGAGGGGAGG + Intronic
942367666 2:175244842-175244864 CTTTTTAAGGGGAGGTAGAAGGG + Intergenic
942738110 2:179139808-179139830 GTTTTTAAGGGGATCATGTAGGG - Intronic
943247016 2:185467625-185467647 TTTTTGAGGGGGAGGGTGGCAGG + Intergenic
944209260 2:197189454-197189476 GTAGTTAGGGGGAGTGTGGAAGG - Intronic
944386544 2:199171093-199171115 GTTTTTAAGTGGTGGTAGGATGG - Intergenic
944402599 2:199345413-199345435 GTTTGTGGGGGGAGGGGGGAGGG - Intronic
944755649 2:202759363-202759385 TTTTTTGTGGGGATGGTGGAAGG - Intronic
945188409 2:207163283-207163305 GGTTTTAAGGTGAGAGTGGCTGG + Intronic
945374278 2:209061125-209061147 GATTTTAAGGGGATGGTGCAGGG + Intergenic
945815108 2:214595978-214596000 GTATTTGGGGGGAGGGGGGAGGG + Intergenic
946366550 2:219252683-219252705 GATTTAAAGGTGAGGGAGGAGGG - Intronic
946728714 2:222688052-222688074 TTTTTGAAGGGGGAGGTGGAAGG - Intronic
947255487 2:228159307-228159329 GTTTTTAAGAGCAGGGTTGGGGG + Intronic
947308851 2:228778282-228778304 GTTTTTAAGGGGATCATGGAAGG - Intergenic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
947929652 2:233953016-233953038 ATTTTGAAGGAGAGGGTGGGTGG - Intronic
948157795 2:235798479-235798501 TTTTTTAAGGACATGGTGGAAGG + Intronic
949013039 2:241692761-241692783 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1168901583 20:1369490-1369512 GGGTTTAAGGGGAGGGTGGGTGG + Exonic
1168941802 20:1719068-1719090 GTTTTTAAGGGTAAGTTGGTGGG + Intergenic
1169181350 20:3570785-3570807 GTTTTTAAGGGGTGACAGGAGGG + Intronic
1169669462 20:8080102-8080124 TTTTGTAAGTGGTGGGTGGAAGG + Intergenic
1170109654 20:12791106-12791128 GTTTTTAAGAGGGGGTTGAATGG - Intergenic
1170208421 20:13823982-13824004 GTGTTCAAGGGTATGGTGGAAGG - Intergenic
1170494712 20:16913834-16913856 GTTGTTTTGGGGAGGGTTGAAGG - Intergenic
1171142630 20:22756013-22756035 GTTTATTGGGGGTGGGTGGATGG + Intergenic
1171166195 20:22974093-22974115 GTTTTTAAGAGGACTGTGGAGGG - Intergenic
1171878944 20:30602589-30602611 GTCTTTAAAGAGAGGTTGGAGGG + Intergenic
1172389556 20:34557927-34557949 TTTTTTTGGGGGAGGGGGGAGGG - Intronic
1172711920 20:36931635-36931657 TTTTTTGGGGGGAGGGTGGTGGG - Intronic
1173277611 20:41598271-41598293 GGTTTGAAGGAGAGGGCGGAGGG - Intronic
1175395649 20:58658828-58658850 TCTTTTAAGGGGAGGGGGAAGGG - Intronic
1177914200 21:27067983-27068005 CTATTTGAGGGGAGGGTGGGGGG + Intergenic
1177935571 21:27341087-27341109 GTATTTAAGGGGAGGAAGGGAGG + Intergenic
1178509116 21:33187809-33187831 ATTTTTAAAGTGAGGGAGGAGGG + Intergenic
1179250946 21:39670838-39670860 GTTTTTAAAATGAGGGTGCATGG - Exonic
1179413892 21:41182516-41182538 ATTCTAAAGGGGAGGGGGGAAGG + Intronic
1179589813 21:42399427-42399449 GGTTCTCAGGGGAGGGTGTAGGG + Intergenic
1179662228 21:42883956-42883978 GGGTTTATGGGGAGGGTGAAAGG - Intronic
1180794062 22:18593295-18593317 GGCTTTATGGGGAGGGTGGATGG + Intergenic
1181227677 22:21402025-21402047 GGCTTTATGGGGAGGGTGGATGG - Intergenic
1181250974 22:21532814-21532836 GGCTTTATGGGGAGGGTGGATGG + Intergenic
1181722084 22:24783393-24783415 GTTGTTCAAGGGAGAGTGGATGG - Intergenic
1181827072 22:25525683-25525705 TTTTTTAAGGGGATCATGGAGGG + Intergenic
1182215380 22:28712753-28712775 GTTTTGAAGGGGTGAGTTGAGGG + Intronic
1183002417 22:34872424-34872446 GTGTTCAAGGAGAGGCTGGATGG - Intergenic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
1183774119 22:39951759-39951781 GTATTTGAGGGGAGGGGAGATGG - Intronic
1183939492 22:41285349-41285371 GTTTATAAAGTGAGTGTGGAGGG - Intronic
1185093453 22:48790772-48790794 GATTGGAAGGGGAGGGAGGAGGG - Intronic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
950209944 3:11115884-11115906 GTTATGCAGGGGAGGGTGGCAGG - Intergenic
950490068 3:13299227-13299249 TTTTTTGAGGGGTGGGGGGATGG - Intergenic
950998239 3:17528048-17528070 GTTTTTTAGGGGGGGCTGGGAGG + Intronic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
952693133 3:36233598-36233620 GCTTTTAAGGGGATGATGGAGGG - Intergenic
953092794 3:39746424-39746446 GTTTTTAAAGGCAGGGAGGCAGG + Intergenic
953827466 3:46266287-46266309 GTTTTAGAGGTGAGTGTGGAAGG - Exonic
954288480 3:49636389-49636411 GTGTGTATGGGGAGGGTGCAGGG + Intronic
954996724 3:54888473-54888495 TTTCTGAAGTGGAGGGTGGAGGG + Intronic
955062727 3:55507134-55507156 GTTGTTAAGGGGCAGCTGGAGGG + Intergenic
955300854 3:57777099-57777121 TTTTTTGGGGGGAGGGGGGAGGG + Intronic
955760724 3:62278939-62278961 ATTTGTATGGGGAGGCTGGAGGG + Intronic
955943082 3:64165140-64165162 GTGATTAAGAGGAGGGTCGATGG - Intronic
957219814 3:77367375-77367397 GTTGGGAAGGGGAGAGTGGAAGG - Intronic
957287928 3:78241028-78241050 GTTTTTAAGGGGAATGATGATGG - Intergenic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
958691404 3:97472143-97472165 TTTTTTGAGGGGAGGGGGAAAGG + Intronic
959496780 3:107061014-107061036 GTGTTTGAGGGTAGGGAGGAAGG + Intergenic
960574840 3:119219214-119219236 CTTTTGCAGGGGAGGGTTGAAGG + Intronic
961013060 3:123448599-123448621 GTCTCCAAGGGGAGGGCGGACGG + Exonic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962095490 3:132288312-132288334 GTTTTTAAGGGGATCATGGAGGG + Intergenic
963243496 3:143035009-143035031 GTTTTAAATGGGTGGGGGGAGGG + Intronic
967335458 3:188339095-188339117 ATTTTTGAGGGGAGAGAGGATGG + Intronic
968207724 3:196819143-196819165 GTTTTTAAGATGAGGGAGGCCGG + Intronic
968939173 4:3629156-3629178 GTTTTTAAGGGGATCATGGAAGG - Intergenic
969289144 4:6227574-6227596 CTTTTGAAGGGGAGGGAGAAAGG - Intergenic
969659189 4:8516461-8516483 GTTTTTCAGGGAATGGTGAAGGG - Intergenic
971004913 4:22362516-22362538 TTTTTGAAAGGGAGGGAGGAGGG - Intronic
971077130 4:23163070-23163092 TTATATAAGGGAAGGGTGGAAGG - Intergenic
971137566 4:23886424-23886446 GTTGGTAAGGGGAGGATGGGGGG + Intronic
972844745 4:42974178-42974200 GTTTTTAAGTGGATCATGGAGGG + Intronic
973015533 4:45133028-45133050 GTTGTTCTGGGGAGGGTGGCAGG + Intergenic
974140728 4:57883207-57883229 TTTTTACAGGGGAGGGTGGATGG + Intergenic
974453444 4:62095414-62095436 GTTTTCAAGGAGAGGCAGGAGGG + Intergenic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
975021581 4:69497334-69497356 GTTTTTAAGGGGTTAATGGAGGG - Intronic
975650916 4:76592056-76592078 ATTTTTTAGGGGGTGGTGGAAGG + Intronic
976612827 4:87047382-87047404 CTTTTTGAGGGGAGGGAGGGAGG - Exonic
976931882 4:90576530-90576552 GTTGTTAGGGGGTGAGTGGAGGG - Intronic
977059483 4:92239545-92239567 GTTTATAAGGGGATCATGGAAGG - Intergenic
977077528 4:92474962-92474984 TTTTTTGGGGGGGGGGTGGAGGG + Intronic
977956736 4:103036368-103036390 ATTTTAAAGTGGAGGGTGGCAGG + Intronic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
979006690 4:115307830-115307852 ATTTTTAAGGTGATGGAGGATGG - Intergenic
979538391 4:121850741-121850763 GTTTTAAAGGAGGGAGTGGAAGG + Intronic
980790142 4:137609810-137609832 GCTTTGAAGAGGAGGGGGGAAGG + Intergenic
981812590 4:148792800-148792822 GTTTTTCAGGGAAGTGTGGTAGG - Intergenic
981975379 4:150722100-150722122 TGTTCTGAGGGGAGGGTGGAAGG - Intronic
982767721 4:159367432-159367454 TTTTTTTAGGGCAGGGTGGGTGG - Intergenic
983118706 4:163852641-163852663 GATTGTAAGGGGAGGGCTGAAGG - Intronic
983177499 4:164608208-164608230 GTTCGTAAGCGGAGGGAGGAGGG - Intergenic
983249179 4:165325880-165325902 GCTTTTAAGGGGATCCTGGAGGG + Intergenic
983451564 4:167918212-167918234 GTTTTTAAGGGGATCATGGAGGG + Intergenic
983574988 4:169251239-169251261 GGTTTTACAGGGAGGGTGGAAGG + Intronic
986225796 5:5811024-5811046 GTTTTTAAGGGGGCGGGGGTTGG + Intergenic
986408171 5:7447806-7447828 GGTTTAACGGGGAGGCTGGAGGG + Intronic
986920712 5:12676076-12676098 GATTTTGAGGGGATCGTGGAGGG + Intergenic
987287805 5:16476268-16476290 GTTTTTAAAGGAAGGAGGGAGGG - Intronic
988345974 5:30038007-30038029 GTTTCTACGGGAAGGGAGGAGGG + Intergenic
988631522 5:32936641-32936663 GGTTTTAATGGGAAGGTGTAAGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989700002 5:44252627-44252649 GTTTTTAAGGGGATCATTGAGGG + Intergenic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
993063306 5:83067503-83067525 GTTTTTTGGTGGGGGGTGGAGGG + Intronic
993167326 5:84373989-84374011 GTTTTTAAGGGGACGAATGATGG + Intronic
995640000 5:114244609-114244631 GTTATTGGGGGGAGTGTGGAGGG + Intergenic
995798409 5:115964411-115964433 GTTTTTAAGGGCAGCGTGCTTGG + Intronic
995806402 5:116057244-116057266 CTTTTTGAGGGGAGGGTAGAGGG + Intronic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
996429802 5:123361174-123361196 GTTTTTAACTGGAGAGTAGATGG - Intronic
998173994 5:139889643-139889665 GTTTGTAATGGGAAGGGGGAGGG - Intronic
999269614 5:150289145-150289167 GTATCTAAGTGGAGGGCGGATGG + Intronic
999330544 5:150671141-150671163 GAAATTAAGTGGAGGGTGGATGG - Intronic
999859267 5:155627956-155627978 ATTTTTAAGGGGAAATTGGAGGG + Intergenic
1000173055 5:158722866-158722888 GTCTTTAAGGGGAGGATGTTGGG + Intronic
1000881114 5:166698664-166698686 TTTTTAAAGGGCAGGGGGGATGG - Intergenic
1002304618 5:178275869-178275891 GTGTTTAAGGGGATCATGGAGGG - Intronic
1002466807 5:179412347-179412369 GTCATTGGGGGGAGGGTGGAAGG - Intergenic
1002467038 5:179412876-179412898 GTCATTGGGGGGAGGGTGGAAGG - Intergenic
1003573203 6:7269342-7269364 TTTCTTCATGGGAGGGTGGATGG - Intronic
1003669371 6:8141948-8141970 GATTATAAGGGGAGGTTGTATGG + Intergenic
1004305023 6:14492804-14492826 GCTTTTAAGGGGACTGTGGAAGG - Intergenic
1004485073 6:16058704-16058726 GTTTTTAAGGGAAAGATGGAGGG - Intergenic
1005047750 6:21658281-21658303 GTTTTTTTGGGGAGGAGGGACGG - Intergenic
1005327809 6:24720015-24720037 TTTTTTGGGGGGAGGGTGGGTGG - Exonic
1005825502 6:29629229-29629251 GTTTCTGAGGGGAGGGTGCCTGG + Intronic
1006273706 6:32984108-32984130 GTTTGTAAGGGGTGGATGGGTGG + Intergenic
1006493721 6:34406164-34406186 ATTTTTAAGGGGACGATGGCGGG - Intronic
1006856402 6:37136496-37136518 GTTTGGAAAGGGAGGGAGGAGGG + Intergenic
1006861962 6:37177754-37177776 AGTTTTAGGGGGAGGGTGAAAGG + Intergenic
1007163720 6:39813034-39813056 GTTTGTGAGGGGTGGGTGGCTGG - Intronic
1010383668 6:75253105-75253127 TATTTTGAGGGGAGGGTGGAGGG - Exonic
1010703013 6:79075571-79075593 ATTTTTGGGGGGAGGGTGGGGGG - Intronic
1010966795 6:82219569-82219591 GTTTTTGAGGGGTGGGAGGGTGG - Intronic
1011184660 6:84660961-84660983 ATTTTTGAGAGGAGGGTGGGAGG + Intergenic
1011326557 6:86154603-86154625 GTATTAAAGGGGATGGTGAATGG + Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1012171985 6:96028043-96028065 GTTTTTATGGGAAGAATGGAAGG + Intronic
1012576484 6:100807293-100807315 TTTTTTGAGGGGAGGGAGGGTGG - Intronic
1013139009 6:107312239-107312261 GTATTTCTGGGGAGGATGGATGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1015799585 6:137046599-137046621 CTTTATAATGGGAGGGGGGAAGG + Intergenic
1017152076 6:151289787-151289809 CTTTGTAAAGGGAGGGTGGTGGG + Intronic
1017248929 6:152259150-152259172 GATTTTAAGGGGATGCTGGGTGG - Intronic
1017301619 6:152867593-152867615 GTATGTGAGGTGAGGGTGGATGG - Intergenic
1017358695 6:153541317-153541339 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1017358936 6:153543202-153543224 GGTTTTAAGGGGATCATGGAGGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1018368676 6:163148499-163148521 GTTCTCAAGGGAAGGGTGGTGGG - Intronic
1018989350 6:168661595-168661617 TTTTTTGGGGGGAGGTTGGATGG - Intronic
1019553194 7:1614167-1614189 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1019892010 7:3954525-3954547 GTTGTAAAGGGGAGGTGGGAGGG - Intronic
1020572502 7:9883481-9883503 CTTTTTAAGGGGAGGGAGCCAGG + Intergenic
1021224743 7:18013923-18013945 GTTTTTAAGGGAATCATGGAGGG + Intergenic
1021778363 7:24076060-24076082 GTTCTTAAGGGGAGGAAGTAGGG - Intergenic
1021963249 7:25893393-25893415 TTTTTTGCGGGGTGGGTGGAGGG - Intergenic
1022545132 7:31180202-31180224 GTATTTAATGGGAGGGTCCAGGG - Intergenic
1023054934 7:36283708-36283730 GTTTTTAGGAGGAGGGAGGGAGG - Intronic
1023207703 7:37768906-37768928 GTTTTTCAGAGGAGGATGAATGG + Intronic
1023558358 7:41446825-41446847 ATTTTTAAGGTGGGGGTGGGGGG + Intergenic
1023986363 7:45099458-45099480 GTCTCTAAGGAGAGGCTGGAAGG + Intergenic
1024740133 7:52344479-52344501 GTTTTAAAGAGGAGGGTGACAGG + Intergenic
1025193916 7:56917921-56917943 GTGTTTATTGGGTGGGTGGATGG + Intergenic
1025678030 7:63659025-63659047 GTGTTTATTGGGTGGGTGGATGG - Intergenic
1026199042 7:68198186-68198208 GTTTTTGAGAGATGGGTGGATGG - Intergenic
1026537022 7:71246939-71246961 CTTTTTGGGGGGAGGGGGGAGGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027251038 7:76398857-76398879 GTGTTTAAGGGGCAGGAGGATGG + Intronic
1027492334 7:78844624-78844646 GGTTTCCAGGAGAGGGTGGAGGG + Intronic
1028122841 7:87076167-87076189 CTTTTTAAGTGGAGGCTGGTGGG + Intergenic
1028950205 7:96626147-96626169 GTTTGGAAGGGGAGGTGGGATGG - Intronic
1029418864 7:100461618-100461640 GGTTGTTAGGGGAAGGTGGAGGG - Intronic
1029880799 7:103807608-103807630 GCTTGAGAGGGGAGGGTGGAAGG - Intronic
1029900544 7:104034763-104034785 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1030249293 7:107424330-107424352 GGTTTTCAGAGAAGGGTGGAAGG + Intronic
1031455268 7:121971428-121971450 ATTTTTATGGGGAGTGTTGAGGG + Intronic
1031680874 7:124673190-124673212 GTTTTTAAGAAAAGGGTAGAAGG - Intergenic
1031906499 7:127465806-127465828 GGTTTTCAGGGGATGGTGGCTGG - Intergenic
1032279584 7:130490443-130490465 GTAATTAAGGGGAGGGGCGAAGG - Intronic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034543863 7:151777095-151777117 GGCTTTAAGGAAAGGGTGGAGGG + Intronic
1034629879 7:152522672-152522694 GTTTTGTGGGGGAGGGGGGAGGG + Intergenic
1036948984 8:13123093-13123115 GTTTCTAAGTGGAGGATAGAGGG - Intronic
1037295115 8:17391277-17391299 GTTTACAGGGGGAGGGTGGCAGG + Intronic
1037885593 8:22594572-22594594 GCTTTGGAGGGGATGGTGGAGGG + Intronic
1038029074 8:23621272-23621294 GGTTTTAGAGGGAGTGTGGATGG - Intergenic
1038182571 8:25242844-25242866 GTTTGTCACTGGAGGGTGGATGG + Intronic
1038525881 8:28272885-28272907 GTTTTTAGGGGGATCATGGAGGG + Intergenic
1039367374 8:36944456-36944478 GTTTGAGTGGGGAGGGTGGAAGG + Intergenic
1039477192 8:37845381-37845403 GCTTGTTAGGGGAAGGTGGAGGG + Intronic
1040592290 8:48804870-48804892 GCCTTGTAGGGGAGGGTGGAGGG - Intergenic
1041936763 8:63340612-63340634 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1042551842 8:70001199-70001221 GTTTTTTGGGGGCGGGGGGATGG - Intergenic
1043191917 8:77235422-77235444 GTTTTTAAAGGGGGTGTGGAGGG + Intergenic
1043973839 8:86563377-86563399 GTTCTTGAGGGCAGAGTGGAAGG - Intronic
1045132972 8:99178298-99178320 CATTTCAAGGGGAGGGGGGAGGG - Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045593403 8:103625106-103625128 GTTTTTAGGGGGAAGGAGGTTGG + Intronic
1045797192 8:106060056-106060078 GTTTTTAATGGGATCATGGAGGG - Intergenic
1046470138 8:114661912-114661934 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1047816364 8:128467999-128468021 GTTTTTAATGGGAGAATGGCAGG + Intergenic
1048209844 8:132445660-132445682 GTTTTTTTGGGGTGGGTGGGTGG - Intronic
1048893825 8:138970878-138970900 GTTTTTAAGGGGACCATGGAGGG + Intergenic
1048977819 8:139682831-139682853 GTTTTTAAAGGGCGGGTGTGGGG - Intronic
1049639685 8:143709397-143709419 GTTTTTAAAGGGATTGTGGCGGG - Intronic
1049864109 8:144922504-144922526 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1050250361 9:3737179-3737201 GTCTTTTAGCAGAGGGTGGATGG + Intergenic
1050443619 9:5694036-5694058 AATTATATGGGGAGGGTGGAGGG - Intronic
1050518725 9:6474253-6474275 GTTTTTAAAGAAAAGGTGGAAGG + Intronic
1050654789 9:7815896-7815918 GTGTTTGCGGGGAGGGGGGAGGG - Intronic
1051669442 9:19495085-19495107 GTCATTAAGGGGAGGGTGTTAGG - Intergenic
1051759288 9:20443182-20443204 GTTTTTTATGGGATGGTGGTAGG - Intronic
1052240162 9:26261957-26261979 GTTTTTAAGGAGATCATGGAGGG + Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1053422695 9:37989798-37989820 GTTTTAAAGAGGAGTGGGGAAGG + Intronic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1055503557 9:76925839-76925861 TTTTTTGCGGGGAGGGGGGAGGG - Intergenic
1056213023 9:84382605-84382627 ATTTTGGAGGGGAGGGGGGAGGG - Intergenic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1057023674 9:91719742-91719764 ACTTGTAGGGGGAGGGTGGAGGG + Intronic
1057070328 9:92092727-92092749 TTTTTTGGGGGGAGGGAGGATGG - Intronic
1057594032 9:96399331-96399353 CTTTTTTGGGGGATGGTGGAGGG + Intronic
1059075820 9:111192959-111192981 GCTTTTAAGCGGAGAGTGGTAGG - Intergenic
1059555092 9:115272677-115272699 TTTTTTTTGGGGGGGGTGGATGG + Intronic
1060227630 9:121804086-121804108 GTGTTGAGGGTGAGGGTGGACGG - Intergenic
1060227804 9:121806080-121806102 GTGTTGAGGGTGAGGGTGGACGG + Intergenic
1060465524 9:123901381-123901403 ATTTTTAATAGGAGGGTAGAGGG - Intronic
1060493646 9:124102455-124102477 TTATTGAAGGGAAGGGTGGATGG - Intergenic
1060662735 9:125413986-125414008 GCTGTTGAGGGGAGGGTGGCTGG + Intergenic
1061237106 9:129349586-129349608 CTTCTTCAGGGGAGGGTGGGTGG + Intergenic
1061863968 9:133482582-133482604 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1062088419 9:134661017-134661039 TTCTTTTAGGGGAGGATGGAAGG + Intronic
1062129699 9:134885768-134885790 GTTTTCCAGCGGAGGGTGGATGG + Exonic
1062133443 9:134912593-134912615 GTTTTCCAGCGGAGGATGGATGG - Exonic
1062228747 9:135469126-135469148 GTTTTTAAGGACAGCGTGGTGGG - Intergenic
1185512876 X:676370-676392 ATTTTTAAGGTCAGGGTGCAAGG + Intergenic
1186053801 X:5627669-5627691 TTTCTTCATGGGAGGGTGGAAGG + Intergenic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1186281915 X:8002387-8002409 GTTCTTAAGGGCAGCGTGGCCGG + Intergenic
1186312552 X:8336333-8336355 GTGTTTAAAGTGGGGGTGGAGGG + Intergenic
1186331685 X:8541403-8541425 GTTTTTGGGGGGGGGGTGGTGGG - Intronic
1186475882 X:9857333-9857355 GATTTTAGGGGGAGTGGGGATGG + Intronic
1186514489 X:10156444-10156466 ATTTGAAAGGCGAGGGTGGAGGG + Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1187627264 X:21129971-21129993 TTTTTTGGGGGGAGGGGGGAGGG - Intergenic
1187828316 X:23355025-23355047 TTTTTTGGGGGGAGGGGGGAGGG + Intronic
1188325839 X:28799857-28799879 ATTTTTGCGGGGAGAGTGGATGG + Intronic
1188811189 X:34656446-34656468 TTTTTTAACGGGGGTGTGGAAGG + Intronic
1189630541 X:42947965-42947987 GTTTTTAAGGGCTGGGTCCAAGG - Intergenic
1189724793 X:43957550-43957572 GTTTTTGAATGGAGAGTGGAGGG + Intronic
1189933674 X:46041741-46041763 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1190722091 X:53157833-53157855 GTTTTCAAGGGGATGGGGGTGGG - Intergenic
1192148963 X:68700050-68700072 GTTGGTCAGGGGTGGGTGGAGGG + Intronic
1192324308 X:70119204-70119226 GTTTCTAAGGGGATCATGGAGGG + Intergenic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1194159321 X:90431593-90431615 CTTTTTGTGGGGAGGGGGGAGGG + Intergenic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1195039598 X:101002084-101002106 GTTGTTAGGGGGAGGGTGTTAGG - Intergenic
1195322093 X:103728526-103728548 GTCTTGGAGGGGAGGGAGGAGGG + Exonic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG + Intronic
1196805676 X:119583402-119583424 ATGTTTAAGGAGAGGGTAGAAGG - Exonic
1196873227 X:120132239-120132261 GATTTTAAAGGCAAGGTGGAAGG + Intergenic
1197397276 X:125941954-125941976 GTTTTTAAGGGGGAGGATGAGGG + Intergenic
1197541235 X:127764493-127764515 GTTTTTAAGGGGCAGGTGTGAGG - Intergenic
1198605472 X:138332503-138332525 GTTTTTAAGGGAATGATGGCAGG - Intergenic
1198805152 X:140486843-140486865 GTTCATTTGGGGAGGGTGGAAGG - Intergenic
1199619102 X:149683400-149683422 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1199924105 X:152444693-152444715 GTTTTTAAGGGAAGGGGAGGTGG - Intronic
1200176513 X:154120932-154120954 TTTTTTAGGGGGAGGGGGGAAGG + Intergenic
1200788187 Y:7276773-7276795 CTTTTTGGGGGGTGGGTGGAGGG + Intergenic
1201423910 Y:13828718-13828740 CTTTTTTGGGGGAGGGGGGAGGG + Intergenic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic