ID: 1152503413

View in Genome Browser
Species Human (GRCh38)
Location 17:80729024-80729046
Sequence CCCCCACACATCTGCGTCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152503409_1152503413 5 Left 1152503409 17:80728996-80729018 CCACGATGATGTACGTGTCTCCA 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1152503413 17:80729024-80729046 CCCCCACACATCTGCGTCGTTGG 0: 1
1: 0
2: 0
3: 4
4: 84
1152503408_1152503413 6 Left 1152503408 17:80728995-80729017 CCCACGATGATGTACGTGTCTCC 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1152503413 17:80729024-80729046 CCCCCACACATCTGCGTCGTTGG 0: 1
1: 0
2: 0
3: 4
4: 84
1152503407_1152503413 10 Left 1152503407 17:80728991-80729013 CCTGCCCACGATGATGTACGTGT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1152503413 17:80729024-80729046 CCCCCACACATCTGCGTCGTTGG 0: 1
1: 0
2: 0
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152503413 Original CRISPR CCCCCACACATCTGCGTCGT TGG Intronic
900103182 1:971433-971455 CCCCCACACAGCTGCCTCCCTGG - Intronic
904295032 1:29514616-29514638 TCCCCACACATCTCCGTCTCAGG + Intergenic
906372506 1:45266233-45266255 CCCACACACAGCTGCGTGGCTGG + Intronic
908806469 1:67937828-67937850 CCCACACACAGCTGCGTGGCTGG + Intergenic
909233755 1:73125497-73125519 ACCACACACATCTGCTTCATTGG + Intergenic
912448268 1:109753391-109753413 CCCCCAGACACCTGCACCGTGGG - Intronic
914045264 1:144086127-144086149 GCCTCACACATCTGCTTCCTTGG - Intergenic
914132846 1:144874559-144874581 GCCTCACACATCTGCTTCCTTGG + Intergenic
914456977 1:147845420-147845442 CCCACACACAGCTGCATGGTTGG - Intergenic
1066957375 10:42185820-42185842 GCCTCACACATCTGCTTCCTTGG - Intergenic
1075780621 10:125015029-125015051 CTACCACACATCTGCTTCCTTGG + Intronic
1075872881 10:125783417-125783439 CCCCCACACCTATGAGTCCTAGG + Intergenic
1076206837 10:128610519-128610541 ACCCCACACATCTGAGGCTTTGG + Intergenic
1081569612 11:44281494-44281516 CCTCCAAACATCTGCTTTGTGGG + Intronic
1086943836 11:92825550-92825572 CCCCCACACATCTCCTTCCCTGG - Intronic
1087812240 11:102621002-102621024 CCCACACACATCTGCGTGGCTGG + Intronic
1089367068 11:117927215-117927237 TTCCCACACAGCTGCGTGGTCGG - Intronic
1094495865 12:30989000-30989022 CCTCCTCACATCAGCGTCCTGGG + Intronic
1105889953 13:24675575-24675597 ACCCCACATATCTGCGGCTTTGG - Intergenic
1118398506 14:65357550-65357572 CCCCAACACATCTCCATCATAGG + Intergenic
1122066343 14:99176380-99176402 CGCCCACAGACCTGCGTCTTCGG - Intronic
1124075847 15:26443570-26443592 CCCTCACACATCTGTGTGGCAGG - Intergenic
1129680641 15:77656679-77656701 ACCCCACATATCTGCATCCTGGG - Intronic
1131231919 15:90665695-90665717 CCGCCCCAAACCTGCGTCGTGGG + Intergenic
1132415716 15:101617470-101617492 CCGCCACAGGTCTACGTCGTGGG + Intergenic
1135577504 16:23597125-23597147 CCCCCACACAACTGCGAGGCTGG + Intergenic
1142066705 16:88067108-88067130 CCCCCACACACCTGGGCCCTAGG - Intronic
1142233772 16:88911885-88911907 CCCCCACACAGCTGCGAGGCAGG - Intronic
1152503413 17:80729024-80729046 CCCCCACACATCTGCGTCGTTGG + Intronic
1153622206 18:6989830-6989852 CCCCCACACATCTGAGTTGCTGG + Intronic
1153622285 18:6990424-6990446 CCCCCACACATCTGAGTTGGTGG - Intronic
1162777377 19:12987987-12988009 CCCCAACACACCTGCATGGTAGG + Intergenic
1202684822 1_KI270712v1_random:39531-39553 GCCTCACACATCTGCTTCCTTGG - Intergenic
927962526 2:27249987-27250009 CCCCCACACAGCTGCATCTGGGG + Intergenic
929092892 2:38237263-38237285 CCCCCACACCTCTGCATCCCAGG - Intergenic
929125056 2:38515802-38515824 CCCACACACAGCTGCGTGGCCGG - Intergenic
934161469 2:89253489-89253511 CCCTCACATATCTGCTTCCTTGG + Intergenic
934166280 2:89297209-89297231 GCCCCATACATCTGCTTCCTTGG + Intergenic
934168515 2:89319571-89319593 TCCTCACACATCTGCTTCCTTGG + Intergenic
934198772 2:89863011-89863033 TCCTCACACATCTGCTTCCTTGG - Intergenic
934200996 2:89885247-89885269 GCCCCATACATCTGCTTCCTTGG - Intergenic
934205812 2:89928926-89928948 CCCTCACATATCTGCTTCCTTGG - Intergenic
934246896 2:90315315-90315337 GCCTCACACATCTGCTTCCTTGG + Intergenic
934262430 2:91487288-91487310 GCCTCACACATCTGCTTCCTTGG - Intergenic
934305480 2:91818277-91818299 GCCTCACACATCTGCTTCCTTGG - Intergenic
934327776 2:92034471-92034493 GCCTCACACATCTGCTTCCTTGG + Intergenic
934466163 2:94265001-94265023 GCCTCACACATCTGCTTCCTTGG + Intergenic
943748815 2:191490131-191490153 CCCCCACTCACCTGAGTCCTGGG + Intergenic
946930964 2:224670720-224670742 CCCTCACACATCTGGGCAGTTGG + Intergenic
948681066 2:239635003-239635025 CTCCCACACCTGTCCGTCGTTGG + Intergenic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
1176161938 20:63652749-63652771 CCCCCACACCGCTGCGGCCTCGG - Intronic
1179571976 21:42283717-42283739 TCCCCACTCATCTGGGTGGTGGG - Intronic
1180044134 21:45295135-45295157 GCCCTTCACATCTGCGTCCTAGG - Intergenic
1180587292 22:16904168-16904190 GCCTCACACATCTGCTTCCTTGG + Intergenic
1182127714 22:27828316-27828338 GCCCCACCCATGTGCGTGGTGGG - Intergenic
951188828 3:19745633-19745655 CACCCACACATCTGTTTCATGGG + Intergenic
953515240 3:43584461-43584483 CCCATACACAGCTGCGTGGTCGG - Intronic
962302478 3:134254347-134254369 CCCCCACCCAGCTGAGTGGTTGG - Intergenic
963316472 3:143764273-143764295 CCCCCACCCATCTGCTTCTCAGG + Intronic
969566124 4:7979262-7979284 TCCCCACACATCTGGGTGCTCGG + Intronic
979438407 4:120722072-120722094 CCCATACACATCTGCGTAGCCGG - Intronic
981654588 4:147099039-147099061 CCCTCACACAGCTGAGTCCTTGG - Intergenic
984642892 4:182189629-182189651 CCCCCACACATCTCAGAAGTTGG + Intronic
984724883 4:183011259-183011281 CCTCCACACATGTGGGTAGTGGG + Intergenic
1006423970 6:33952253-33952275 CCCCAACACAAGTGGGTCGTGGG - Intergenic
1013587928 6:111596020-111596042 CCCCCACACAGCTGCATGGCTGG + Intronic
1017868198 6:158463117-158463139 CCACCACAGATCTGCCTCTTTGG - Intronic
1019026681 6:168971445-168971467 CCACCACACATCGGAGTCCTGGG - Intergenic
1019409529 7:900524-900546 GCCACTCACATCTGCGTCGCCGG + Exonic
1019617602 7:1973253-1973275 CCCAGACACTTCTGCGTCCTGGG + Intronic
1026572418 7:71542897-71542919 CCCCAACACATCTGCCAGGTGGG - Intronic
1034385488 7:150737446-150737468 CCCCCACACCTCTGCGGACTAGG - Exonic
1037623747 8:20589916-20589938 CCCCCACACAGCTGCGCAGCTGG + Intergenic
1049796832 8:144500830-144500852 CCCGCACACATCTGAGAAGTGGG - Exonic
1053696214 9:40641773-40641795 GCCTCACACATCTGCTTCCTTGG + Intergenic
1054307461 9:63440992-63441014 GCCTCACACATCTGCTTCCTTGG + Intergenic
1054439821 9:65250476-65250498 GCCTCACACATCTGCTTCCTTGG + Intergenic
1054490586 9:65771463-65771485 GCCTCACACATCTGCTTCCTTGG - Intergenic
1061010124 9:127949839-127949861 CCCCCAGGCAGCTGCCTCGTTGG - Intronic
1061491823 9:130949138-130949160 CCACCACCCACTTGCGTCGTGGG - Intergenic
1061583997 9:131554814-131554836 GCCCCCCACATCGGCTTCGTTGG + Intergenic
1061923460 9:133794689-133794711 CCCCCCCACATCTCCCTCGTCGG - Intronic
1202778663 9_KI270717v1_random:15434-15456 GCCTCACACATCTGCTTCCTTGG + Intergenic
1203585738 Un_KI270747v1:1843-1865 GCCTCACACATCTGCTTCCTTGG + Intergenic
1187089616 X:16081990-16082012 CCCCCACACATCTCCATTATGGG - Intergenic
1187243398 X:17533116-17533138 CCCCCACACTCCTGTGTGGTGGG - Intronic
1190304606 X:49074897-49074919 CCCCCAGCCATCTGCGTAGATGG - Exonic
1201193967 Y:11473711-11473733 GCCTCACACATCTGCTTCCTTGG + Intergenic