ID: 1152506842

View in Genome Browser
Species Human (GRCh38)
Location 17:80755058-80755080
Sequence CACCCTGGGAGGGGCCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 7, 3: 46, 4: 395}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152506825_1152506842 30 Left 1152506825 17:80755005-80755027 CCCTGGGCGGACACGGGGAGCTA 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1152506842 17:80755058-80755080 CACCCTGGGAGGGGCCAGAGGGG 0: 1
1: 0
2: 7
3: 46
4: 395
1152506826_1152506842 29 Left 1152506826 17:80755006-80755028 CCTGGGCGGACACGGGGAGCTAA 0: 1
1: 0
2: 0
3: 5
4: 40
Right 1152506842 17:80755058-80755080 CACCCTGGGAGGGGCCAGAGGGG 0: 1
1: 0
2: 7
3: 46
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152506842 Original CRISPR CACCCTGGGAGGGGCCAGAG GGG Intronic
900144131 1:1150629-1150651 CGCCCTGGAAGAGGCCAGTGAGG - Intergenic
900534187 1:3168939-3168961 CACCCTGGGCGTGGCCACAGGGG - Intronic
901037590 1:6345637-6345659 CATCCAGTGAGGGCCCAGAGAGG + Intronic
902686180 1:18079195-18079217 CAAGCTGGGTGTGGCCAGAGAGG + Intergenic
902884561 1:19395495-19395517 CAGCCTGGAAGGGGCCACAACGG + Intronic
903594936 1:24486825-24486847 CTCCCTGTGAGGGGCCTGTGAGG + Intergenic
904469107 1:30724917-30724939 CCCCATGTGAGGGGCAAGAGGGG + Intergenic
905138978 1:35825730-35825752 CCCTCTGGGAGGGGGCAGGGAGG + Exonic
905569223 1:38991055-38991077 GACCCTGGGAGGGGCGGGGGTGG + Intergenic
906033121 1:42735778-42735800 CACCCTGGGCAGGGCCACTGGGG - Intronic
906206332 1:43988977-43988999 AACCCTGGAAGGAGCCAGATTGG + Intronic
906676681 1:47698314-47698336 GACCCTGGAAGGGGCCCTAGAGG + Intergenic
911242562 1:95481989-95482011 CATCCTGGCAGGGGGCAGGGAGG - Intergenic
911742446 1:101401463-101401485 CAACCTGAGAAGGGGCAGAGAGG - Intergenic
912710789 1:111948413-111948435 AGCCCTGGGAGGTGCCAGGGAGG + Intronic
912909254 1:113740782-113740804 CACTTTGGGAGGGGCCAAGGTGG + Intronic
914802972 1:150974188-150974210 CACCCTGGCAGCGGCCCGCGGGG - Intronic
915166407 1:153950298-153950320 CAGCCTTGAAGAGGCCAGAGGGG + Intronic
915541982 1:156573222-156573244 CAGCCAGGGAGAGGCCAGAAGGG + Intergenic
915662665 1:157416850-157416872 CACCCTGGGAGTTCCCAGGGTGG - Intergenic
916263161 1:162862418-162862440 CTCCATGGGAGGGAGCAGAGGGG + Intronic
917141551 1:171841058-171841080 CACCCTGGGAGGAGTCATCGCGG + Intergenic
917236039 1:172892834-172892856 CAGCCTGGGAGCTGCCACAGAGG - Intergenic
917538023 1:175888372-175888394 CTGCCTCGGAGGGGCCTGAGCGG + Intergenic
917946830 1:179982212-179982234 CACCCTTGAAGTGGCTAGAGAGG - Intronic
918240004 1:182612608-182612630 CATCTTGGGAGGGGTTAGAGGGG + Intergenic
919009038 1:191935962-191935984 CAGCATGGAAGGGGCCCGAGCGG + Intergenic
919640514 1:200040648-200040670 CACCCTGGAAGGGGCGAGGATGG - Intronic
919794295 1:201311938-201311960 CTCCTTGGGAGGGGCCTGTGAGG - Intronic
920038595 1:203081817-203081839 CCCCCTTGGAGGGGCTGGAGAGG - Intergenic
922565136 1:226596783-226596805 GTCCCTGTGAGAGGCCAGAGGGG - Exonic
922913180 1:229234339-229234361 CACACTGGTAGGGGGCAGAGGGG + Intergenic
922933876 1:229409496-229409518 CACCCAGGGACGGCTCAGAGAGG - Intergenic
1064229592 10:13518310-13518332 GGCCCTGTGAGGGGCCAGTGGGG - Intronic
1064646017 10:17460478-17460500 GACCCTGGGAGAGGCCAGTTTGG - Intergenic
1067153981 10:43759542-43759564 CTCCCTAGGAGGGTCCAGAAGGG - Intergenic
1067523624 10:47025899-47025921 ATCCCCAGGAGGGGCCAGAGTGG - Intergenic
1068523933 10:58106586-58106608 TTCCCTGGGAGAGGGCAGAGAGG + Intergenic
1070761722 10:79028190-79028212 GTCCCTGGCAGGGGTCAGAGAGG + Intergenic
1070819500 10:79346746-79346768 CACCCTGGGAGGGGACTCAGTGG - Intergenic
1071941043 10:90592171-90592193 CACGATGGGAGGGGCAAGCGTGG + Intergenic
1072582387 10:96750577-96750599 CACCTTGAGACGGTCCAGAGCGG - Intergenic
1072783513 10:98265956-98265978 AAGCGTGGGAGGGGTCAGAGGGG - Intronic
1073771306 10:106738567-106738589 GATCCTGCGTGGGGCCAGAGGGG + Intronic
1074483536 10:113851752-113851774 CAGCCTGGGTGGGGCGACAGAGG - Intronic
1074546331 10:114404531-114404553 CTCACGGGGAGGGGCCAGCGCGG - Intronic
1075092350 10:119450913-119450935 CAGCCTGGGGAGGGCCAGTGGGG - Intronic
1075483800 10:122803740-122803762 CCCCCTGGGATGGATCAGAGAGG - Intergenic
1075511101 10:123073624-123073646 GAGCCTGTGAGAGGCCAGAGGGG - Intergenic
1075688345 10:124379212-124379234 CACCCTTGGAAAGGCCAGGGAGG - Intergenic
1075969881 10:126643391-126643413 CAGCTTGGGAGGGGCCACAGAGG - Intronic
1076594816 10:131618972-131618994 CAGCCTGGGAGGGGCCCGTGGGG + Intergenic
1077061966 11:621452-621474 CACCCTGGGGAGGGTCAGGGAGG + Exonic
1077095401 11:797015-797037 ACCCCTGGGAGGGACTAGAGTGG - Intronic
1077110617 11:860535-860557 CACCCTGGCAGGGCCCACGGAGG - Intronic
1077340415 11:2023969-2023991 CACCTTTGGAGGGGCCAGCCCGG + Intergenic
1078516365 11:12026127-12026149 AACCTTGGGAGAGGCAAGAGGGG - Intergenic
1078631633 11:13009306-13009328 CACCTTGGGCAGAGCCAGAGCGG + Intergenic
1080646757 11:34193317-34193339 CACCCTGGAAGGGTGCAGGGAGG + Intronic
1083159149 11:60844009-60844031 CCCCCTGGGACAGGGCAGAGGGG - Intronic
1083822632 11:65181685-65181707 TCCCCGGGGAGGGGCCAGCGCGG - Exonic
1083924448 11:65797554-65797576 AACCCTGGGAGGGTCCTGGGAGG - Intergenic
1084220560 11:67674980-67675002 GACCCTAGGAGGGGCCATGGGGG - Intronic
1084332780 11:68439599-68439621 CACTCTAGTAGTGGCCAGAGAGG + Intronic
1084361310 11:68670120-68670142 CTTCCTGGGAGGGGCCTCAGGGG - Intergenic
1084517430 11:69644395-69644417 CAGCCTGGGAGAGGCCAGGAGGG - Intronic
1084672658 11:70616365-70616387 CAGCCTGGGAGGGGCCTGGATGG + Intronic
1085455923 11:76665337-76665359 CAGCCTGGGAGGGGCTGGGGAGG + Intronic
1085512821 11:77096886-77096908 AACCCTGGGTGGGGCCTGGGAGG + Intronic
1086890754 11:92255213-92255235 AACCCAGGGAGGGGCCTGTGAGG - Intergenic
1088653288 11:111976980-111977002 CACCAAGGGAGGGCTCAGAGTGG + Intronic
1088813344 11:113406099-113406121 AAGCATGGGAGGGGCAAGAGAGG - Intergenic
1089325057 11:117651272-117651294 CACCCTGGCAGGGGCTGCAGTGG + Intronic
1090265332 11:125349964-125349986 GACCCTGGGAAGGGCCAGGCTGG + Intronic
1090817851 11:130314640-130314662 AGCGCTCGGAGGGGCCAGAGGGG + Exonic
1091124686 11:133083451-133083473 CAGCCTGGGAAGGGCCAGAGAGG + Intronic
1091237686 11:134032926-134032948 CGCTGTGGGAGGGGCGAGAGGGG + Intergenic
1202823400 11_KI270721v1_random:79158-79180 CACCTTTGGAGGGGCCAGCCCGG + Intergenic
1091664163 12:2407073-2407095 CACCCTGGCTGGAGGCAGAGGGG + Intronic
1091826974 12:3520130-3520152 CACTCTGGGAGGGGACTCAGTGG - Intronic
1092232298 12:6782954-6782976 CACCCTGGGGTGGGCCTGTGCGG - Intergenic
1094800077 12:34022792-34022814 CACCCCAGGAGAGGCCTGAGAGG + Intronic
1095983998 12:47987706-47987728 CACCCTGGGAAGAGACAGGGAGG + Exonic
1096071020 12:48775615-48775637 CACCCTGGGATGGGGCTGGGGGG - Intronic
1096156742 12:49345417-49345439 CCCCGCGGGAGCGGCCAGAGAGG - Intergenic
1096538387 12:52289565-52289587 CATCCTGGGAGTGGACAGCGTGG + Intronic
1096540390 12:52303799-52303821 CATCCTGGGAGTGGACAGCGTGG - Intronic
1096540578 12:52304779-52304801 CACCCCGGGAAGGGCCAGAAGGG + Intronic
1096781669 12:53995619-53995641 CAGCCTGGGAGTGGCTGGAGGGG - Intronic
1103699825 12:122843232-122843254 CCGCCTGGGAGGGGCCTGAGGGG + Intronic
1103878023 12:124143952-124143974 ATTCCTGGGAGGGGCCAGTGAGG + Intronic
1104261448 12:127186974-127186996 CACTCTGGCAGGTGCCACAGAGG - Intergenic
1104924908 12:132309007-132309029 CTCCCTGGTTGGGGGCAGAGGGG - Intronic
1105070420 12:133231175-133231197 CACCCAGGGACTGGCCAGAAAGG - Intronic
1106102888 13:26709780-26709802 GTCCCGGGGAGGGGCGAGAGAGG - Intergenic
1107014115 13:35695249-35695271 CAGCCCGGGAGGGGCCAGAGAGG - Intergenic
1107821517 13:44289973-44289995 CAGCCAAGGAGGGACCAGAGCGG - Intergenic
1112182968 13:97103484-97103506 CACCCTGGAATGGGCCTCAGAGG - Intergenic
1113839427 13:113350363-113350385 CACTCTGGGAGTGGCCTCAGAGG + Intronic
1113940160 13:114014771-114014793 GACCCTGGCAGGGCCCAGAGTGG - Intronic
1113973701 13:114210807-114210829 AACCCTGGGAGTGACCTGAGAGG - Intergenic
1113994448 14:16054825-16054847 CCCCCTGGCCGGGGCCGGAGAGG - Intergenic
1115642148 14:35341707-35341729 CTCTGTGGGAGGGGACAGAGGGG - Intergenic
1116651328 14:47596543-47596565 CTTCCTGGGAGGAGACAGAGTGG - Intronic
1117530900 14:56659567-56659589 CACCTTGGGAGGCTCCGGAGAGG + Intronic
1118317295 14:64733006-64733028 AACCCTGGGAAAGGCTAGAGCGG + Intronic
1118457544 14:65958507-65958529 CACGCTGAGGGAGGCCAGAGCGG - Intronic
1119474683 14:74920253-74920275 CACCCTGGGAAGGGACAGGGTGG + Intronic
1119731622 14:76954891-76954913 AACCCTGGCAGGACCCAGAGTGG + Intergenic
1120719881 14:87879256-87879278 CTCCCAGGCAGGGGACAGAGGGG + Intronic
1122409761 14:101519853-101519875 CACCCCGGTAGTGGACAGAGGGG - Intergenic
1122632083 14:103111758-103111780 CTCCCAGCCAGGGGCCAGAGGGG + Intergenic
1122862352 14:104588336-104588358 CACCCACGGAGGGGGCAGTGGGG - Intronic
1122950514 14:105042055-105042077 AACACTGGGAGGGGGCGGAGAGG - Intergenic
1122995395 14:105261153-105261175 CAGCGTGGCAGGGGCCAGAAGGG - Intronic
1123036114 14:105472643-105472665 CACAGTGGGACGGGCCCGAGTGG - Intergenic
1124206257 15:27723596-27723618 CACCCAGGGAGGAGCAAGAGGGG + Intergenic
1124385915 15:29207995-29208017 CAGGCTAGGAGGGGCCAGCGTGG - Intronic
1124399115 15:29333194-29333216 AAACCAGGGAGAGGCCAGAGAGG + Intronic
1124658081 15:31524658-31524680 AACCCGGGGAATGGCCAGAGAGG - Intronic
1125329027 15:38564601-38564623 CACCCTGGGCAAGGCGAGAGAGG - Exonic
1127221789 15:56887580-56887602 CAGCCTGGGAGGGGCGTGTGGGG + Intronic
1127973621 15:63981227-63981249 CACACGGTGAGGGGGCAGAGTGG - Intronic
1129270896 15:74418734-74418756 GACCCTTGGCAGGGCCAGAGGGG + Intronic
1130052965 15:80499053-80499075 CAGCCTGGCAGGGGCTATAGAGG + Intronic
1130298155 15:82661795-82661817 CTCCCTGGGAGTGGGCAGAGAGG - Intronic
1131095585 15:89652603-89652625 CACCATGGGGGAGGCCAGTGTGG - Exonic
1131838998 15:96416613-96416635 GCGCCTGGGAGGAGCCAGAGGGG + Intergenic
1132379714 15:101358120-101358142 GGCCCTGGGAGGGACCACAGAGG - Intronic
1132587078 16:710250-710272 CACCCAGGGAGGGGGCAGCAGGG + Intronic
1132651774 16:1024424-1024446 CACTCAGGGAGGGGACAGCGAGG + Intergenic
1132654624 16:1036636-1036658 TCCCCGGGGAGGGGCCTGAGGGG + Intergenic
1132670246 16:1099574-1099596 CCCTCTGGGAGGGGCCAGGTGGG + Intergenic
1132747661 16:1443692-1443714 CACCCTGGCCGGGGCGAGAGTGG + Exonic
1133328716 16:4958190-4958212 CGCCTGGGGCGGGGCCAGAGTGG + Intronic
1134480436 16:14614422-14614444 CACCCAGAGAGGGGCAGGAGTGG + Intronic
1134659952 16:15976551-15976573 CACCCTGGGGTGGGCCAGAGAGG + Intronic
1137390253 16:48075327-48075349 CACCCAAGGAAGGGCCAAAGGGG - Intergenic
1137500903 16:49011026-49011048 TACCCTTGGAGGGGACAGCGAGG + Intergenic
1137665105 16:50245431-50245453 CACCCTGGGAGGGGCAGAGGAGG - Intergenic
1137688337 16:50402383-50402405 GAGGCTGGCAGGGGCCAGAGAGG - Intergenic
1138424378 16:56920973-56920995 CAGTGTGGGAGGGGCCTGAGGGG + Intergenic
1139088591 16:63617608-63617630 CACCTTGAGCGCGGCCAGAGCGG + Intergenic
1139391891 16:66610446-66610468 TACCAGGGGAGGGGCCAGATGGG + Intronic
1140199280 16:72881517-72881539 GACCTTGGTAGGGGCCAGGGAGG - Intronic
1140485320 16:75288820-75288842 CACCCTGGCAGGGACCAGGAAGG - Intergenic
1140644897 16:77018714-77018736 CAGCCTGGAAGGGCCCAGATAGG + Intergenic
1141359554 16:83382833-83382855 TACCATGGGTGGGGTCAGAGGGG - Intronic
1141772264 16:86096493-86096515 CACCCAGGGAGGTGGCGGAGTGG - Intergenic
1142004493 16:87682993-87683015 CAGTCAGGGAGCGGCCAGAGGGG + Intronic
1142033972 16:87852396-87852418 CAGCCTGGGAGGGGCCACAGGGG + Intronic
1142156030 16:88533266-88533288 CACCAACGGAGAGGCCAGAGCGG + Exonic
1142288216 16:89180113-89180135 CAGCTGGGGAGGGGCCTGAGGGG + Intronic
1142379669 16:89724136-89724158 CACCCTGGTGTGGGCCAGTGTGG + Intronic
1142403320 16:89872565-89872587 CATCCTGGGAGGGGCCAGGCCGG + Intergenic
1142540528 17:655155-655177 CAGCCTGAGACGGGCCACAGAGG + Intronic
1142890769 17:2941024-2941046 CACCCTGCCAGGGTCCAGAGAGG - Intronic
1144152005 17:12457295-12457317 CTCCCTGGGAAGGGAAAGAGAGG - Intergenic
1144833590 17:18144977-18144999 AGCCCTGGGCAGGGCCAGAGAGG + Intronic
1146291464 17:31610568-31610590 CACCCTGAGAGGTCCCTGAGGGG + Intergenic
1146804615 17:35855453-35855475 CAGGCTGGGAGGCTCCAGAGAGG + Intronic
1146842350 17:36164632-36164654 CACGCTGGGAGGGGAGAGGGAGG + Intergenic
1146854660 17:36252591-36252613 CACGCTGGGAGGGGAGAGGGAGG + Intronic
1146865960 17:36335785-36335807 CACGCTGGGAGGGGAGAGGGAGG - Intronic
1146870560 17:36376483-36376505 CACGCTGGGAGGGGAGAGGGAGG + Intronic
1146877919 17:36427564-36427586 CACGCTGGGAGGGGAGAGGGAGG + Intronic
1147068830 17:37936397-37936419 CACGCTGGGAGGGGAGAGGGAGG - Intergenic
1147073443 17:37977107-37977129 CACGCTGGGAGGGGAGAGGGAGG + Intergenic
1147080353 17:38015934-38015956 CACGCTGGGAGGGGAGAGGGAGG - Intronic
1147084965 17:38056645-38056667 CACGCTGGGAGGGGAGAGGGAGG + Intronic
1147096301 17:38139894-38139916 CACGCTGGGAGGGGAGAGGGAGG - Intergenic
1147100911 17:38180611-38180633 CACGCTGGGAGGGGAGAGGGAGG + Intergenic
1147309194 17:39584277-39584299 CACTTTGGGAGGGGGCTGAGGGG + Intergenic
1147312576 17:39604185-39604207 CACCCCAGGAGGGGACAGAATGG + Intronic
1147645800 17:42033162-42033184 CATCCAGGGAGGGGCCATGGGGG - Intronic
1147793295 17:43026089-43026111 AACCAAGGGAGGGGACAGAGTGG - Intronic
1148113389 17:45160839-45160861 CCCCCTGGGAGCAGCTAGAGAGG - Exonic
1148988815 17:51647489-51647511 CACCAAGGGAGGAGCAAGAGAGG - Intronic
1149895724 17:60426910-60426932 AGCCCTGGGAAGGACCAGAGGGG - Intronic
1150832988 17:68540597-68540619 CACCCTGCCACGGGCCTGAGTGG - Intronic
1151224797 17:72640337-72640359 CACCCTGGGAAGGGACAAACTGG + Intergenic
1151492866 17:74443158-74443180 CACCCTGGGAGTGCCCAGCAGGG + Intronic
1151678200 17:75610617-75610639 CAGCCAGGGAGGGGCCAGAGAGG - Intergenic
1152506842 17:80755058-80755080 CACCCTGGGAGGGGCCAGAGGGG + Intronic
1152626023 17:81388372-81388394 CTCCCTGGGCTGGACCAGAGGGG - Intergenic
1152722596 17:81930176-81930198 CACCCTGGGAGGGCCCTGCCTGG - Intergenic
1152756063 17:82087575-82087597 CAGCTTGGGAGGGAGCAGAGGGG - Intronic
1153635080 18:7106603-7106625 CACTTTGGGAGGGGCCAAGGCGG - Intronic
1155231995 18:23783147-23783169 CACCATGGGAGGGACCAGTCTGG - Intronic
1157620794 18:49016578-49016600 CAGCCTGGAAGGGGGCAGGGTGG + Intergenic
1157901308 18:51520878-51520900 CAGGCTGGGAGGGGTGAGAGTGG + Intergenic
1160462064 18:79046784-79046806 GACCCAGGGAGGGGCCAGACGGG + Intergenic
1161104602 19:2437062-2437084 CTCCCTGGGCCTGGCCAGAGCGG + Intronic
1161648160 19:5467252-5467274 CAGCCTGGGAGTGGCCTCAGCGG - Intergenic
1162658421 19:12150407-12150429 CACGTTTGGAGGGGCCAGGGTGG - Intronic
1162934705 19:13976077-13976099 CAAGCTGGCAGGGGCCAGACAGG - Intronic
1163268284 19:16234318-16234340 CACCCTGGGGGCAGCCACAGAGG - Intronic
1163390588 19:17027549-17027571 CACACGGGGAGGGGCAGGAGGGG - Intergenic
1163476209 19:17527401-17527423 CAGCCGGGGAGGGGACAGGGTGG + Intronic
1163493819 19:17633034-17633056 CAGCCTTGGAGGGGACACAGAGG + Intronic
1163698678 19:18776458-18776480 CAGCCTGGAAGAGGCCAGTGAGG - Intronic
1164767832 19:30785178-30785200 CACCCTGCAAGGTGCCAGAGGGG - Intergenic
1164788581 19:30957293-30957315 CACCCTTGGAGGGCAAAGAGTGG + Intergenic
1164934000 19:32197190-32197212 CACCCTACCTGGGGCCAGAGGGG - Intergenic
1164955792 19:32382911-32382933 CATGCTAGGAGGGGCCAGACTGG - Exonic
1165091178 19:33389149-33389171 CACGCTGGGCACGGCCAGAGAGG + Intronic
1165232214 19:34394266-34394288 CACCATGGGAGGGGCATGACTGG + Intronic
1165317541 19:35065849-35065871 CGCCCTGGGAGGGGAGAGGGAGG - Exonic
1165357223 19:35311725-35311747 CAGCCGGGCAGGGGCCACAGAGG + Intronic
1165420025 19:35717991-35718013 CACCGTGAGAGGGGCCGGGGAGG - Intergenic
1165764688 19:38343386-38343408 CAGCCTAGGAGGGGGCAGAGGGG - Intronic
1165777750 19:38414820-38414842 CAGCCTGGGCGGGGCCAGGGGGG + Intronic
1165957042 19:39507493-39507515 CATCCTGGGAGTGGCCACGGCGG - Exonic
1166071929 19:40393007-40393029 CTTCCTGGGTGGGGCCAGAGTGG + Intergenic
1166668741 19:44697466-44697488 CACCAGAGGAGGGGCCAGGGAGG + Intergenic
1166978637 19:46620020-46620042 CACCCCGGCAGGGCCCAGGGTGG + Intergenic
1166994134 19:46711235-46711257 CGCCCTGGGCAGGGACAGAGCGG + Intronic
1167077326 19:47257476-47257498 AGCCGTGGGCGGGGCCAGAGCGG + Intronic
1167172053 19:47839775-47839797 GTCCCACGGAGGGGCCAGAGAGG - Exonic
1167290017 19:48619379-48619401 CGGCCTGGGTAGGGCCAGAGAGG - Exonic
1167437971 19:49490812-49490834 CACCTTGAGACGGTCCAGAGCGG - Exonic
1167645340 19:50702627-50702649 CACCCCGGGAAGGGCCAGCCGGG - Exonic
1168097076 19:54122006-54122028 GACCCTGGGAAAGGCCAGTGGGG - Intronic
1168097874 19:54125778-54125800 CATCCTGGGAGGAGAGAGAGTGG + Intronic
1168435974 19:56317258-56317280 CACCCAGGGCAAGGCCAGAGTGG - Intronic
1168582615 19:57568184-57568206 GACCCTTGGAGGGGCAAGGGTGG - Intergenic
924962511 2:46708-46730 CACCCGGAGAGCGGCCAGGGAGG - Intronic
925349354 2:3190087-3190109 CACCCTGGGGGAGGCCAGGCAGG - Intronic
925422482 2:3724336-3724358 ATCCCAGGGAGGTGCCAGAGTGG + Intronic
926224928 2:10960906-10960928 CGCCCGGGGAGGGGCCGGCGTGG + Intergenic
926952254 2:18254888-18254910 AAATTTGGGAGGGGCCAGAGTGG + Intronic
928076303 2:28267708-28267730 CAGCATGGCAGGGGCCATAGGGG + Intronic
928340036 2:30435094-30435116 CAGCCGGGGAGGGGCCCTAGTGG + Intergenic
928442114 2:31301122-31301144 AACCCTAGTAGGGTCCAGAGTGG + Intergenic
929622959 2:43376089-43376111 AATCCTTGGAGAGGCCAGAGAGG - Intronic
929982479 2:46694618-46694640 GACCTTGGGAGGTGGCAGAGAGG + Intergenic
930015049 2:46964396-46964418 CCCCATGAGAGGGCCCAGAGCGG + Intronic
930122061 2:47768437-47768459 CACCCTGGAAGTGAGCAGAGGGG - Intronic
931430995 2:62208943-62208965 CAACCTGGGTGGGGGCAGTGGGG + Intronic
932254550 2:70273087-70273109 CTCCCTGGGAGGGGGCGGGGTGG - Intronic
932417051 2:71579922-71579944 CACCTTGGAAGAGGCCTGAGTGG + Intronic
932689498 2:73900257-73900279 TACCCTGGGAGGACCCAGTGGGG - Intronic
934653917 2:96107683-96107705 TACTCTGGGAGGGGCAAGTGGGG - Intergenic
936034639 2:109101104-109101126 CACAGTGGGAGTGGCCCGAGTGG + Intergenic
937359399 2:121218561-121218583 CCCCCAGCGAAGGGCCAGAGTGG - Exonic
938146420 2:128838415-128838437 CAGCCAGGCAGGGGCCTGAGGGG + Intergenic
939958622 2:148547079-148547101 CATGCTGGCAGGGGCAAGAGAGG + Intergenic
940396428 2:153196746-153196768 CACCCTGGGGGCTGCCACAGTGG - Intergenic
941905830 2:170715828-170715850 CAGCCTGGGGCGGGCCAGGGAGG + Intronic
944339544 2:198580148-198580170 CGCCCTGGGAGAAGCCAGAAGGG + Intergenic
945864143 2:215158160-215158182 GACCCTGGGAAGGGAAAGAGTGG - Intergenic
946253979 2:218430105-218430127 CCCAATGGGAGGGGCCTGAGGGG + Intronic
946773280 2:223111391-223111413 CTCCCTGGAAGGGGCTAGGGAGG + Intronic
947581978 2:231325947-231325969 GGCCCTGGGTGGGGCAAGAGTGG + Intronic
948422068 2:237865761-237865783 CTCCTTGTGAGAGGCCAGAGAGG + Intronic
948624540 2:239260976-239260998 CAGCCTGGGAGCGGCTGGAGCGG + Intronic
948721905 2:239905865-239905887 CAGCCTGGGAGGGGACAGGAGGG + Intronic
1170702181 20:18713453-18713475 CACCCTGGAAGGGACCTGACAGG + Intronic
1170955319 20:20974276-20974298 AACCCTGGGAGAGGCAAGGGAGG - Intergenic
1171298856 20:24041952-24041974 CACCCTGGGTGGGAGCAGATGGG - Intergenic
1172285050 20:33734386-33734408 CAGACTGGAGGGGGCCAGAGTGG + Intronic
1172974239 20:38894427-38894449 CACGTTGGGAGGGGACAGTGAGG - Intronic
1173390358 20:42626689-42626711 CCCCCTGGGAGTAGCCACAGAGG + Intronic
1173557303 20:43974875-43974897 CACACAGGGACAGGCCAGAGAGG - Intronic
1173706200 20:45111990-45112012 CACCCAGGCAGGGGGCTGAGGGG - Intronic
1174202397 20:48816199-48816221 CACTCTGGGCAGGGCCAGAGAGG + Intronic
1174540903 20:51288562-51288584 AAGCCAGGGAGGGGCCATAGAGG - Intergenic
1175720051 20:61280367-61280389 CGCCTTGGGAGGCGCCAGAGAGG - Intronic
1175736019 20:61387857-61387879 GACCTGGGGCGGGGCCAGAGGGG - Intronic
1175777266 20:61661170-61661192 CCACCTGGGAAGGGCCAGAAGGG + Intronic
1175894383 20:62329599-62329621 CACCTTGTGAGGCTCCAGAGGGG - Intronic
1176049767 20:63112574-63112596 CTCCCTGGCATGGTCCAGAGTGG - Intergenic
1176241673 20:64078466-64078488 GACCCTGGGTGGGGACAGAGAGG - Intronic
1176431342 21:6578238-6578260 TGCCCTGGGATGGGACAGAGAGG + Intergenic
1178608422 21:34058731-34058753 CACCCTCAGAGGGGGCACAGAGG + Intergenic
1178880632 21:36447390-36447412 CACTCTGGGAGTGGTCAGAGAGG + Intergenic
1179451469 21:41471225-41471247 GACCCTTGGATGGACCAGAGTGG + Intronic
1179658014 21:42857398-42857420 CACCCAGGGTGGGGCCCGAGGGG - Intronic
1179706736 21:43185700-43185722 TGCCCTGGGATGGGACAGAGAGG + Intergenic
1179891082 21:44335390-44335412 CACCGTGGGGGCGGCCAGGGCGG + Intronic
1180161708 21:46001164-46001186 CAGCCAAGGAGGGGCCAGGGCGG + Intronic
1180342592 22:11629793-11629815 CCCCCTGGCCGGGGCCAGAGAGG - Intergenic
1180656101 22:17422107-17422129 CATCCTGCAAGAGGCCAGAGGGG - Intronic
1181101862 22:20546143-20546165 CAGGCTGGGAGGGGCCAGAGGGG - Intronic
1181172101 22:21015560-21015582 CCCCCTGGGTGGGGCCTGGGTGG - Intronic
1181311480 22:21947116-21947138 CACCCTGGGAGGAGGCTGTGAGG - Intronic
1181763902 22:25077474-25077496 GACCCTGGGCGGGGCTGGAGAGG - Intronic
1182094731 22:27618385-27618407 GGCCCTGGGAGGGGTGAGAGTGG - Intergenic
1182696375 22:32201830-32201852 CACTGTGGGTGGGGCCAGGGAGG + Intronic
1183352071 22:37340025-37340047 GACCTGGGGTGGGGCCAGAGGGG + Intergenic
1183985447 22:41567606-41567628 CGCCCTGGCAGGGCCCAGAGAGG + Intronic
1184224060 22:43118935-43118957 CAACCTGGGAGGGGCTTGGGAGG + Intronic
1184252299 22:43267776-43267798 CCCTCTGGGAGAGGGCAGAGAGG - Intronic
1184856867 22:47151051-47151073 CAGCCTCTGAGGGGCCACAGCGG - Intronic
1185047678 22:48537199-48537221 CACCCGGGGTGGGGGCAGGGTGG + Intronic
1185126025 22:49011284-49011306 CACCGTGGCAGGCCCCAGAGGGG - Intergenic
1185186964 22:49407039-49407061 CCTCCTGGGAAGGGCAAGAGGGG + Intergenic
1185389281 22:50549998-50550020 CCTCCTGGGATGGGCCTGAGAGG + Exonic
949954171 3:9253828-9253850 AACCCTGGGAGGGGACGGAATGG + Intronic
950207497 3:11092077-11092099 CACCCTGGGAGCTGCCACAATGG + Intergenic
950495601 3:13332467-13332489 GAGCCGAGGAGGGGCCAGAGAGG + Intronic
953268861 3:41419900-41419922 CACCCTGTGAGGGGTCACAGTGG - Intronic
953850665 3:46463711-46463733 CCACCTGGGAGGGGCAGGAGAGG - Intronic
954711192 3:52505864-52505886 GACCCTGGCAGGGGAGAGAGAGG - Exonic
954796178 3:53162163-53162185 CACCCTGGGAGGGGTCTCAGAGG - Intronic
954799973 3:53181370-53181392 CACCCTGGGAGGGACTGTAGGGG + Intronic
960412363 3:117342902-117342924 AGCCCTGGGAGTGGCCAGAGTGG - Intergenic
960413713 3:117358973-117358995 CTCCCTGGGTGGGGGAAGAGCGG + Intergenic
961103611 3:124222414-124222436 TCCCATGGTAGGGGCCAGAGGGG + Intronic
961543483 3:127616691-127616713 TTCCCTGGGAGTGCCCAGAGTGG + Intronic
961870994 3:129988194-129988216 CACCTGGGTAGGGGCCAGGGAGG - Intergenic
962263313 3:133928445-133928467 CTCCCTGAGAGGGCGCAGAGTGG + Exonic
964928185 3:161982606-161982628 TGCACTGGGAGGTGCCAGAGTGG + Intergenic
965496531 3:169405056-169405078 TCCCCTGGGAGAAGCCAGAGTGG - Intronic
967235554 3:187380510-187380532 GAAGCTGGGAGGGGCCAGAAAGG + Intergenic
967424279 3:189308304-189308326 AATCCTGGGAGGCGACAGAGTGG - Intronic
967896015 3:194396880-194396902 CCCCCCGGCAGGGCCCAGAGCGG + Exonic
968845780 4:3040940-3040962 CACCCAGGGAGAGGCCAGCGGGG + Intergenic
968975774 4:3821422-3821444 CAGCCAGGAAGGGGCCAGGGTGG + Intergenic
969103372 4:4786642-4786664 ATTCCTGGGAGGGGGCAGAGGGG + Intergenic
969615827 4:8252144-8252166 CAGCCTGGGAGGGGCAGGAAGGG - Intergenic
975459243 4:74631175-74631197 CAGCCTGGGAAGGGGCACAGAGG - Intergenic
977486058 4:97647860-97647882 CAGGCTGGCAGGGGCCAGTGTGG + Intronic
979267500 4:118720334-118720356 GAAACTGGGAAGGGCCAGAGAGG - Intergenic
979979091 4:127232433-127232455 CATCTGGGGAGAGGCCAGAGAGG + Intergenic
984208617 4:176817798-176817820 CACCCTGGAAGGGTCCACAGAGG - Intergenic
985881576 5:2642312-2642334 CTGCCATGGAGGGGCCAGAGTGG + Intergenic
986148077 5:5099095-5099117 GACCCTGGGAAGGGACAGGGAGG - Intergenic
986280931 5:6321824-6321846 CAGTCTGGGATGGGCCAGATGGG - Intergenic
987029676 5:13964293-13964315 CAACCGTGGAGGAGCCAGAGGGG - Intergenic
988285691 5:29213375-29213397 CATCCTGGTGGGGGCCAGGGAGG - Intergenic
988710751 5:33772100-33772122 CACCTTGGGAGGCCGCAGAGAGG - Intronic
989042499 5:37243430-37243452 CACCCTGAGAGTGGGGAGAGGGG + Intronic
989279341 5:39622559-39622581 CACCCTGGGAGCAGCCACAATGG - Intergenic
989417375 5:41195452-41195474 CAAGCTGGGAGGTGCCAGGGTGG - Intronic
989725149 5:44578939-44578961 CACCCTGGGAGGAGCCAAGATGG + Intergenic
990473786 5:56142381-56142403 CACCCTGTGAGGGCCCAGCGGGG + Intronic
990786566 5:59426942-59426964 CACTGTGGGAGGTGGCAGAGGGG - Intronic
992269964 5:75053658-75053680 CACCCCGGGCCGGGCGAGAGCGG - Intergenic
992632021 5:78690794-78690816 CACCTTGTGAAGGGCCACAGTGG - Intronic
993574760 5:89587151-89587173 CACCTTGGGAGAGGCGAGAGGGG + Intergenic
994906601 5:105846879-105846901 GACTCTTGGAGGGGCAAGAGTGG - Intergenic
996700307 5:126444170-126444192 CACTGTGGTAGGGGCCAGGGTGG + Intronic
997186317 5:131885072-131885094 GACCCTGGGCAGGTCCAGAGTGG - Intronic
997235489 5:132269869-132269891 CACCCTGGGAATGGCCATAGTGG - Intronic
997525713 5:134552033-134552055 AAACCTGTGAGGGGCAAGAGGGG - Exonic
998104123 5:139457495-139457517 CATCCAGGGAGGGCCCAGTGAGG - Intronic
998171907 5:139877465-139877487 CACCTTGGGATGAGTCAGAGGGG + Intronic
998257936 5:140603164-140603186 CACCTGGGGAGGGGAGAGAGAGG - Intergenic
1000183200 5:158833020-158833042 CATCCTGGGAAGAGCCAGAGAGG - Intronic
1001086390 5:168702876-168702898 AACCCAGGCAGGGGCTAGAGAGG - Intronic
1001094073 5:168762686-168762708 GAGCCTGGGAGGGGCCAAAGAGG + Exonic
1001126485 5:169024221-169024243 CACCCCGGGAGGAAGCAGAGTGG + Intronic
1001384172 5:171324710-171324732 CGCCCTGGGAGGGACCCGAGAGG + Intergenic
1001576572 5:172768670-172768692 AACTCTGGGAGGGGCTCGAGAGG - Exonic
1001839727 5:174864869-174864891 CTCCCTGGGTGGGGACAGGGTGG - Intergenic
1002074494 5:176700042-176700064 CACCCAGGAAGGGGCCTGGGTGG + Intergenic
1002103472 5:176868713-176868735 CACCCTGGCAGGGGCCACTCTGG + Intronic
1003269316 6:4593269-4593291 CACAGTGGGAAGGGCCCGAGGGG + Intergenic
1003957032 6:11173667-11173689 CAGCCTGGGAGGGGGCATTGAGG - Intergenic
1004002714 6:11610019-11610041 CACGCTGGTGTGGGCCAGAGGGG + Intergenic
1004590167 6:17042974-17042996 CCCCATGGGAGGGGCAGGAGAGG + Intergenic
1004723865 6:18292430-18292452 CACTTTGGGAGGGGCCAAGGCGG - Intergenic
1007850035 6:44793936-44793958 CAAACTGGCAGGAGCCAGAGTGG - Intergenic
1010649673 6:78437664-78437686 CAGCCTGGGAGGGGAAAGAGGGG - Intergenic
1011164580 6:84431812-84431834 TTCCCTGGGTGGGGCCTGAGAGG - Intergenic
1013013864 6:106143770-106143792 CTGCCTGGGAGGGGTAAGAGAGG + Intergenic
1013604069 6:111731841-111731863 CACCCTGGGTGAGCCCAGGGTGG + Intronic
1013677132 6:112477510-112477532 CACCATGGGACAGGCCAGACAGG - Intergenic
1015569199 6:134604400-134604422 CACTGTGGGAGAGGCCAGTGTGG - Intergenic
1015773624 6:136792588-136792610 CGCTCTGGGAGGGGCCAGGAAGG + Intergenic
1016187301 6:141212456-141212478 CACCCTGGAAGAGGAGAGAGAGG + Intergenic
1016809685 6:148247845-148247867 TTCCCAGGGAGGGGCCAGAGTGG - Intergenic
1017086870 6:150721255-150721277 CCCTCTGGGAGCAGCCAGAGAGG + Intronic
1017223531 6:151993705-151993727 CAACCTGGGAGGAAGCAGAGTGG + Intronic
1018135130 6:160771695-160771717 CACTGTGGGAGGGGCGAGAGAGG - Intergenic
1018226036 6:161629600-161629622 CAGCCTGGGAAGGGCAAGACAGG - Intronic
1018472102 6:164106425-164106447 CACCCAGGGAGGGGCCCCACGGG - Intergenic
1018899352 6:168043434-168043456 CACCCTGGGAGGTGGTGGAGGGG + Intronic
1018971716 6:168534472-168534494 CACCCAGGGAAGGGCCAGGGCGG - Intronic
1019170702 6:170131685-170131707 CAGCCTCGGAGGGACCACAGGGG + Intergenic
1019337292 7:491432-491454 CACCCAGGGAGGGGCGAGCAGGG + Intergenic
1019358584 7:593637-593659 CCCCCTGAGAGGGGCTGGAGCGG - Intronic
1019452674 7:1107938-1107960 CACCCCGGGAGGAAGCAGAGGGG + Intronic
1019452690 7:1107986-1108008 CACCCCGGGAGGAAGCAGAGGGG + Intronic
1019911893 7:4105832-4105854 CACTCTGAGAGGGGGAAGAGTGG + Intronic
1020127150 7:5539328-5539350 GCCCCTGAGAGGGGCCAGTGAGG + Intronic
1020683019 7:11259923-11259945 CAGCCAAGGAGGGGCCAGACTGG - Intergenic
1022207592 7:28179744-28179766 CTCCCTGGGAGGCGGCCGAGGGG - Intronic
1022527944 7:31050388-31050410 TCCCCTGGAAGGGGCCAGTGGGG - Intergenic
1024157223 7:46638144-46638166 CACAGTGGGATGGGCCAGAGAGG - Intergenic
1025819329 7:64947684-64947706 CACCCTGTGTGGGGGCGGAGGGG + Intergenic
1026979496 7:74518143-74518165 GGCCCTGGGAAGGGCCAGTGTGG + Exonic
1027263177 7:76479332-76479354 GAGCCTTGGAGAGGCCAGAGAGG + Intronic
1027314561 7:76977437-76977459 GAGCCTTGGAGAGGCCAGAGAGG + Intergenic
1029643015 7:101832897-101832919 CATGCAGGGAGGGGCCGGAGAGG + Intronic
1029927102 7:104329272-104329294 GAGCCGGGGAGGGGCCAGAGTGG + Intronic
1032096003 7:128938830-128938852 GACCCCGGGAGGGGCGGGAGCGG + Intronic
1032894996 7:136240685-136240707 CATCCAGGAGGGGGCCAGAGGGG + Intergenic
1034270772 7:149802620-149802642 CAGCCAGGGAGGAGCCAGGGTGG - Intergenic
1034426579 7:151017157-151017179 TGCCCTGGGGGGCGCCAGAGTGG + Exonic
1034457675 7:151180075-151180097 CACTCTGGGCTGAGCCAGAGGGG + Intronic
1035224424 7:157425565-157425587 CACCCAGGCAGGGTCCAGACGGG - Intergenic
1036184915 8:6614476-6614498 CACGCAGGGAGGGACAAGAGGGG - Intronic
1036947262 8:13106012-13106034 CAGCCTGGGAGGGTCCTTAGGGG - Intronic
1037019496 8:13951972-13951994 AGATCTGGGAGGGGCCAGAGTGG - Intergenic
1037524218 8:19708851-19708873 CACCATGAGAGGGACAAGAGAGG - Intronic
1037674280 8:21040986-21041008 TACCCTGGGAGAGGGGAGAGGGG - Intergenic
1037764914 8:21766722-21766744 CAGGGAGGGAGGGGCCAGAGCGG - Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1044930668 8:97248811-97248833 GGCCCTGGGAGAGGCCAGGGAGG - Intergenic
1045892621 8:107175151-107175173 CACCCTGAGAGGGGCTTGGGTGG - Intergenic
1047200331 8:122759920-122759942 CATCCTGGGAGGGGATTGAGAGG + Intergenic
1048440443 8:134455633-134455655 CACCCTGGGTTTGGCCAGAGAGG - Intergenic
1048872056 8:138807285-138807307 AACCCTGGGAAGTGACAGAGAGG + Intronic
1049141879 8:140962468-140962490 TACTCTGTGAGGGGCCTGAGGGG + Intronic
1049213173 8:141395949-141395971 CACCCTGGCTGGGGACAGATGGG + Intronic
1049289095 8:141792076-141792098 CAGCCGGGGAGGAGGCAGAGGGG - Intergenic
1049446924 8:142635456-142635478 GACCCTGGGAGGAGCCAGCCTGG - Intergenic
1049511016 8:143026695-143026717 GAGCCTGGGAGGGGCCAGCAGGG + Intergenic
1050244337 9:3672327-3672349 CAGCCTGGGATGAGCTAGAGAGG - Intergenic
1050895978 9:10886384-10886406 CAGCCTGGGAGAGGTCAGATGGG - Intergenic
1053293330 9:36896464-36896486 CACCCTGGGAGGTGCCTCTGTGG - Intronic
1053348438 9:37395347-37395369 CACCGTGGGAGAGGCCAGCTGGG + Intergenic
1056751560 9:89355355-89355377 CACCCTGGGAGGGAACACAGTGG - Intronic
1057189954 9:93081504-93081526 CACCCTGGGCCTGGCGAGAGAGG - Intronic
1057266477 9:93621176-93621198 CAGCCTTGGAGGGGCAGGAGGGG + Intronic
1058943117 9:109832835-109832857 CACCCTCAGAGAGGCCAGCGGGG + Intronic
1059339418 9:113589247-113589269 GACCTTGGAGGGGGCCAGAGTGG - Intronic
1059343050 9:113610364-113610386 CACTCTGGAAGGAGACAGAGAGG - Intergenic
1059762233 9:117349205-117349227 CTCCTTGGGAGGGACTAGAGTGG - Intronic
1060103186 9:120857580-120857602 CACCCAGAAAGGGGCGAGAGAGG + Exonic
1060486993 9:124054175-124054197 TTCCCTGGGAGGGGCCTGAAAGG - Intergenic
1060891225 9:127189794-127189816 AACCCAGCGAGGGGCCAGAGCGG + Intronic
1060917347 9:127398908-127398930 CACCCAGGGAGGGGCCTGAGTGG - Intronic
1061288606 9:129638365-129638387 GACCGTGGGAGGGGACAAAGAGG - Exonic
1061409106 9:130408950-130408972 CACCTTGGGTGGGGCCACTGAGG + Intronic
1062155565 9:135046293-135046315 GACCCTGGGTGGGGGCAGGGTGG + Intergenic
1062191143 9:135248476-135248498 AACCCTGGGACTGGACAGAGGGG + Intergenic
1062380255 9:136283680-136283702 CAGCCTGGGTGCAGCCAGAGGGG - Intronic
1062491371 9:136806707-136806729 GTCCCTGGGCAGGGCCAGAGGGG + Intronic
1062597298 9:137305048-137305070 CCGCCTGGGAGGGCCCAGGGAGG + Intergenic
1185529772 X:808196-808218 CACCCAGCAAGGGGCCAAAGTGG - Intergenic
1187501141 X:19839731-19839753 CTCAGTGGCAGGGGCCAGAGAGG - Intronic
1190066575 X:47245477-47245499 CCCCTGGTGAGGGGCCAGAGCGG + Exonic
1190265139 X:48823602-48823624 CACCCAGGTAGGGGCAAGAAGGG + Intronic
1192701783 X:73482178-73482200 CAACCTGGGAGAGTCCAGCGTGG - Intergenic
1195740921 X:108063742-108063764 CACCCTGGGGGCAGGCAGAGAGG + Intronic
1199529402 X:148830127-148830149 CACTCTGAGAGGGCCCTGAGAGG + Intronic