ID: 1152508406

View in Genome Browser
Species Human (GRCh38)
Location 17:80769022-80769044
Sequence GAATCGATAATGCCTCTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152508405_1152508406 1 Left 1152508405 17:80768998-80769020 CCTCATTTTACTTGTGCTGAGAT 0: 1
1: 0
2: 1
3: 20
4: 272
Right 1152508406 17:80769022-80769044 GAATCGATAATGCCTCTTGATGG 0: 1
1: 0
2: 0
3: 3
4: 61
1152508404_1152508406 11 Left 1152508404 17:80768988-80769010 CCATTTTCATCCTCATTTTACTT 0: 1
1: 3
2: 11
3: 142
4: 1089
Right 1152508406 17:80769022-80769044 GAATCGATAATGCCTCTTGATGG 0: 1
1: 0
2: 0
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152508406 Original CRISPR GAATCGATAATGCCTCTTGA TGG Intronic
901181198 1:7342877-7342899 AAGTGGAAAATGCCTCTTGAAGG - Intronic
906141659 1:43537228-43537250 GACTCAATAATGGCTCTAGAAGG + Intronic
922555049 1:226526664-226526686 GAATCTAGATTGCCTCTTGGTGG + Intergenic
1064991548 10:21261097-21261119 GAATCACTAATGCTTCTTGCAGG + Intergenic
1068598916 10:58935189-58935211 GAATACATACAGCCTCTTGATGG - Intergenic
1077968576 11:7163044-7163066 GAATCCATAGTTCCTCTTGTTGG - Intergenic
1081244041 11:40742052-40742074 GAAGTGATAATGCCCCTTTATGG - Intronic
1082653079 11:55818510-55818532 GAATATATAATGTGTCTTGAAGG + Intergenic
1088451090 11:109982143-109982165 GAATCTAGAATACATCTTGATGG - Intergenic
1093147373 12:15582413-15582435 GAATGGATTTTTCCTCTTGAAGG - Intronic
1097504449 12:60447671-60447693 GAATTTATAATGCATTTTGAAGG + Intergenic
1103574004 12:121863563-121863585 GAAGAAATAATGCCTTTTGAGGG - Intronic
1103757018 12:123216336-123216358 GAATAAATAATGCCTTATGAAGG + Intronic
1106154319 13:27138563-27138585 GCATTGATAATGCCTCATGGAGG - Intronic
1108014016 13:46054128-46054150 GAATTCATAATTCCTATTGATGG - Intronic
1128662219 15:69510165-69510187 AAAATGATAATGCCTCTAGAAGG + Intergenic
1129672529 15:77615184-77615206 GAGTCGGTACAGCCTCTTGAAGG + Exonic
1134352227 16:13448324-13448346 GACTCGATAATGGCCTTTGAAGG - Intergenic
1139213673 16:65106612-65106634 GAATGGATAGTACCTATTGATGG + Intronic
1146447668 17:32945428-32945450 GTATTGAAAATGCCTCTTTATGG - Intergenic
1148681286 17:49475100-49475122 AAATCCATAATCCCTCTAGAGGG + Intronic
1152508406 17:80769022-80769044 GAATCGATAATGCCTCTTGATGG + Intronic
1164431961 19:28196717-28196739 GTCTCCCTAATGCCTCTTGAAGG - Intergenic
925213858 2:2075317-2075339 GAAGCTATGATTCCTCTTGATGG + Intronic
925319088 2:2948407-2948429 GAATCAATAATCACTATTGATGG - Intergenic
925945537 2:8859360-8859382 GAAGCAATATTGCTTCTTGATGG + Intronic
928310036 2:30202016-30202038 GAAGCTATAAAGTCTCTTGAGGG - Intergenic
930113759 2:47701342-47701364 GAGTAGAAAATGCCTCTTGAAGG - Intronic
942786026 2:179703838-179703860 ACATTGATAATGCCTCATGATGG + Intronic
945785571 2:214231717-214231739 GAAAATATAATGCCTCTTGAAGG - Intronic
1169690366 20:8323709-8323731 GCATCGATTTTACCTCTTGATGG + Intronic
1173928990 20:46802840-46802862 GATGGGATAATGCCTCATGATGG + Intergenic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
953565110 3:44025704-44025726 TAATCAATAATGACTCATGAGGG + Intergenic
958222505 3:90710648-90710670 GAGTTGATCATTCCTCTTGATGG - Intergenic
958233947 3:90954305-90954327 GAATTGAATATTCCTCTTGATGG + Intergenic
958238812 3:91036703-91036725 GAATTGAACATTCCTCTTGATGG + Intergenic
958239011 3:91040102-91040124 GAATTGAACATTCCTCTTGATGG + Intergenic
958239685 3:91051144-91051166 GAATTGAATATTCCTCTTGATGG + Intergenic
958242170 3:91092775-91092797 GAATTGAATATTCCTCTTGATGG + Intergenic
958249269 3:91211712-91211734 GAATTGAATATTCCTCTTGATGG + Intergenic
960059534 3:113306413-113306435 GAATCAATAATGTCTATTTATGG + Intronic
961598542 3:128040557-128040579 GAATGGATAATGACTGCTGATGG + Intergenic
967557098 3:190873175-190873197 AAATAGATTCTGCCTCTTGATGG - Intronic
972406418 4:38750977-38750999 GAATAGATTCTGCCTCATGATGG + Intergenic
975347925 4:73314986-73315008 GAATTAGGAATGCCTCTTGAGGG + Intergenic
976191366 4:82490248-82490270 GAATGGATAATGACACATGAAGG + Intronic
976590433 4:86844460-86844482 AAGTCGATTTTGCCTCTTGATGG - Intronic
980897384 4:138872952-138872974 ACATCTATAATGCCTCCTGAGGG - Intergenic
995424299 5:112003205-112003227 GAAACTATAATGTCTGTTGATGG + Intergenic
998534877 5:142920515-142920537 GAATCAATAAAGTCTCTTGAGGG + Intronic
1017913205 6:158812863-158812885 GAATTGATAGTGCCTGGTGATGG - Intronic
1017952357 6:159146754-159146776 GAATAGATAATGCATGCTGACGG + Intergenic
1021469061 7:20980547-20980569 GAATTGATCATAGCTCTTGACGG + Intergenic
1029315223 7:99706104-99706126 AAAACGATAATGCTTCCTGAAGG - Intronic
1041730541 8:61057926-61057948 GACTCGAAAATGTCTTTTGAAGG + Intronic
1042143590 8:65704423-65704445 AAATCTGTGATGCCTCTTGATGG + Intronic
1047954031 8:129959715-129959737 GACTGAAGAATGCCTCTTGATGG - Intronic
1052041083 9:23739822-23739844 GAAGCTGTACTGCCTCTTGATGG - Intronic
1055289433 9:74767637-74767659 GAATCTATTTTCCCTCTTGATGG - Intronic
1188076878 X:25787849-25787871 GAATTCAAGATGCCTCTTGAGGG + Intergenic
1190361668 X:49655403-49655425 GAAACCATAAAGCCTTTTGATGG + Intergenic
1193034134 X:76931272-76931294 GCCTGGATAATGCCTCTTGGGGG + Intergenic
1200696627 Y:6366750-6366772 GAATCTACAGTGGCTCTTGATGG - Intergenic
1201037486 Y:9797949-9797971 GAATCTACAGTGGCTCTTGATGG + Intergenic