ID: 1152509260

View in Genome Browser
Species Human (GRCh38)
Location 17:80774194-80774216
Sequence AACTCAAGGCGGGTGGAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152509260_1152509269 23 Left 1152509260 17:80774194-80774216 CCCGTCTCCACCCGCCTTGAGTT 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1152509269 17:80774240-80774262 TGATGATGATGCTCACGCTCCGG 0: 1
1: 0
2: 1
3: 8
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152509260 Original CRISPR AACTCAAGGCGGGTGGAGAC GGG (reversed) Intronic
900771428 1:4547829-4547851 ATCTCCAAGCAGGTGGAGACTGG + Intergenic
900853867 1:5165001-5165023 AATTCATGGGGGGTGGAGACAGG - Intergenic
900944111 1:5820046-5820068 TACACAAGGTGTGTGGAGACAGG + Intergenic
903668288 1:25021222-25021244 ACCTCAGGGAGGGTGCAGACGGG + Intergenic
904258111 1:29270038-29270060 AACTCAGGGTGGGGGGAGAAGGG - Intronic
904457105 1:30654370-30654392 AAGGCAAGGCATGTGGAGACAGG + Intergenic
904468111 1:30719693-30719715 GCCTCAGGGCGGGTGCAGACAGG - Intronic
905399491 1:37691486-37691508 GTCTCAAGGCGGGCGGCGACTGG - Intronic
905848757 1:41257595-41257617 AATCCAAGGCGACTGGAGACTGG - Intergenic
921376862 1:214483471-214483493 AACTGGAGGCGGGTGGGGAAGGG - Intronic
922442498 1:225667593-225667615 AACTGTAGGCGGGGGGAAACTGG + Intergenic
922575512 1:226658645-226658667 ATCACACGGCGGGTGGAGACGGG - Intronic
1065925480 10:30431530-30431552 CACACAAGGCGGGTGGGGAGGGG + Intergenic
1068327995 10:55519398-55519420 AAGTCAAGGTGTGTGGGGACGGG + Intronic
1069604331 10:69730307-69730329 CACTCAAGGCTGGTGGGGACAGG - Intergenic
1072733907 10:97866220-97866242 AATTCAAGGTGTGGGGAGACGGG + Exonic
1074681799 10:115914457-115914479 GAGTCAAGGCAGATGGAGACTGG + Intronic
1074915158 10:117948240-117948262 AACTCAAAGAAGGTGGAGATTGG - Intergenic
1074943051 10:118253835-118253857 ACCAGAAGGCGGGTGAAGACAGG + Intergenic
1076804541 10:132848801-132848823 AAATTAAGGCGCGTGGACACAGG - Intronic
1077588309 11:3471571-3471593 ATCACAAGGCAAGTGGAGACAGG + Intergenic
1080623278 11:34005381-34005403 CACACAAGGCAGGTGGACACAGG - Intergenic
1084244003 11:67843200-67843222 ATCACAAGGCAAGTGGAGACAGG + Intergenic
1084828688 11:71751364-71751386 ATCACAAGGCAAGTGGAGACAGG - Intergenic
1085454286 11:76656954-76656976 AGCTCCAGGCGGGTTGAGAACGG + Intergenic
1088178056 11:107076453-107076475 AACTCAAAGCGGGTGGCGGGGGG - Intergenic
1090615108 11:128507222-128507244 TACTCATGGAGGGTGGAGCCCGG - Intronic
1092414563 12:8280331-8280353 ATCACAAGGCAAGTGGAGACAGG + Intergenic
1098185766 12:67894584-67894606 AACTAAATGTGGGTGGAGATTGG + Intergenic
1099555215 12:84101881-84101903 ATCACAAGGCAAGTGGAGACAGG - Intergenic
1102951421 12:117033938-117033960 AACTGCAGGCAGGTGGGGACAGG + Intergenic
1103242795 12:119428967-119428989 AATTCTAGGCGGCTGGAGGCTGG - Intronic
1103359992 12:120347792-120347814 AGCTCATGGAGGGTGGAGGCAGG + Intronic
1107677768 13:42814611-42814633 AATTGAAGGCTGGTGGAGAGAGG + Intergenic
1114215464 14:20654620-20654642 ATCACAAGGCAAGTGGAGACAGG + Intergenic
1116181359 14:41540658-41540680 ATCACAAGGCAAGTGGAGACAGG + Intergenic
1118436900 14:65779776-65779798 GACTGAAGGTGGTTGGAGACAGG - Intergenic
1118896514 14:69949866-69949888 AACTCGAGGGGGGTTGAGGCTGG + Intronic
1125328191 15:38558259-38558281 AACTAGAGGATGGTGGAGACCGG - Intronic
1127623031 15:60752618-60752640 AACTCGAGGCGGGTGGGGGTGGG - Intronic
1131716674 15:95119071-95119093 AACCCAAGTCTGTTGGAGACAGG - Intergenic
1133171797 16:3986343-3986365 AACTCAGGGCAGGTGGCCACAGG - Intronic
1137617539 16:49856367-49856389 ATCTCAAGGGGGGAGGAGACCGG + Intronic
1137829054 16:51526470-51526492 ATCTGAACGCGGGTGGAGATTGG - Intergenic
1139288660 16:65837706-65837728 AACTCTAGGGGTGTGGAGAATGG + Intergenic
1140246251 16:73252622-73252644 AGCTCAGGGTGGGAGGAGACGGG + Intergenic
1140953661 16:79842902-79842924 GCCTCAAGGCAGGAGGAGACAGG + Intergenic
1144599290 17:16598633-16598655 CACTCATGGCGGAAGGAGACGGG - Intergenic
1146480300 17:33199914-33199936 AACGCAAGGAGGCAGGAGACAGG - Intronic
1147938042 17:44024815-44024837 AAATCATGGGAGGTGGAGACAGG - Intergenic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148844297 17:50519766-50519788 CACTCCATCCGGGTGGAGACAGG + Exonic
1149929118 17:60732396-60732418 AACTTAGGGAGGGTGGAGACTGG + Intronic
1151062625 17:71113621-71113643 AAATCAAGGCAGCTGGAGGCAGG + Intergenic
1152108023 17:78342034-78342056 AGCCCGAGGCGGGTGGAGCCGGG + Intergenic
1152509260 17:80774194-80774216 AACTCAAGGCGGGTGGAGACGGG - Intronic
1156490175 18:37491471-37491493 AATTCAGTGAGGGTGGAGACGGG + Intronic
1157482780 18:48066192-48066214 AAACCAAGGCTGGTGGAGCCAGG - Intronic
1159490117 18:69121679-69121701 AATTCAAGGTGGGTGCAGAAGGG - Intergenic
1160667994 19:342258-342280 AACTCCATGTGGGTGGAGGCAGG - Intronic
1164218069 19:23168527-23168549 AACACAAGGCAAGTGGAGGCAGG - Intergenic
1165155972 19:33788102-33788124 AGCTCCAGGCAGCTGGAGACTGG - Intergenic
1165426477 19:35748643-35748665 AAGTCAAGGCGGGAGAAGGCGGG - Exonic
925837479 2:7960091-7960113 GACTCAAGGCGTGAGAAGACAGG + Intergenic
925957938 2:8986527-8986549 CACTCTAGGCTGGGGGAGACAGG + Intronic
939045746 2:137247724-137247746 AACTCCAGGAGGGTTGACACAGG - Intronic
940487245 2:154311511-154311533 ATCACAAGGCAAGTGGAGACAGG + Intronic
943956761 2:194201580-194201602 AGTTCAAGGAGGGTGGAGAAGGG + Intergenic
945291245 2:208129571-208129593 AACTCCATCCGGGTGGAGAGCGG - Exonic
948020092 2:234724876-234724898 AACTCAAAGCGGGGGGAGCAGGG + Intergenic
948756491 2:240162573-240162595 ATCTCAGGGCGGGTGGAGGGAGG + Intergenic
948830317 2:240595420-240595442 AGCCCAAGGAGGGGGGAGACTGG - Intronic
1170686754 20:18576250-18576272 AATTCCAGGTGGGTGGAGGCAGG - Intronic
1170793636 20:19527925-19527947 AACTAAGGGCGGGTGGAGTGAGG + Intronic
1172587711 20:36096152-36096174 AGCTCAAGAGAGGTGGAGACAGG + Intronic
1173291630 20:41719976-41719998 AAATCAAGGAGGTTGGAGACAGG + Intergenic
1173706264 20:45112286-45112308 CACTCAAAGCCGGTGGAGCCGGG + Intronic
1178531922 21:33383041-33383063 ATCTGAAGGTGGGTGGAGCCGGG - Intergenic
1181896863 22:26117422-26117444 AACTAATGGAGGGGGGAGACGGG + Intergenic
1183230371 22:36578402-36578424 AACTCTAGGCGGGTGAAGCCTGG + Intronic
950574871 3:13826191-13826213 AACTCAGGGAAGGTGGGGACCGG - Intronic
954656713 3:52198361-52198383 ACCTCAAGGCGGCGGGTGACTGG - Intronic
960596706 3:119414057-119414079 ACCTCCAGAGGGGTGGAGACTGG - Exonic
961892108 3:130138952-130138974 ATCACAAGGCAAGTGGAGACAGG + Intergenic
968876363 4:3269798-3269820 AGCTCAGGGCGGGTGGGGTCTGG + Intronic
969008643 4:4042386-4042408 ATCACAAGGCAAGTGGAGACAGG + Intergenic
969009307 4:4048365-4048387 ATCTCAAGGCAAGTGGAGACAGG + Intergenic
969273298 4:6117470-6117492 ATCACAAGGCAAGTGGAGACAGG + Intronic
969745042 4:9063984-9064006 ATCACAAGGCAAGTGGAGACAGG - Intergenic
971373086 4:26033919-26033941 AAGTCAATGTGGGTGGGGACTGG + Intergenic
971695896 4:29902485-29902507 AATTCAAGGTAGGTGGAGAATGG + Intergenic
979392581 4:120143954-120143976 CACTCAAGGAGGGTGGCAACAGG + Intergenic
982661306 4:158210296-158210318 CACTTAAGGAGGGTGGAGAAAGG - Exonic
985843518 5:2327309-2327331 ACCACAAGGCGGGTGGAGGGTGG + Intergenic
988835617 5:35029552-35029574 AACCCCAAGCGGGTGGAGACAGG + Intronic
989554563 5:42778319-42778341 ATCTCTTGGGGGGTGGAGACAGG - Intronic
989699050 5:44239880-44239902 ATCACAAGGCAAGTGGAGACAGG - Intergenic
1002447156 5:179296608-179296630 ACCGCAAGGCAGGTGGAGATGGG + Intronic
1003068844 6:2928277-2928299 ATCACAAGGCAAGTGGAGACAGG - Intergenic
1003133662 6:3416786-3416808 AACTCCAGGTCAGTGGAGACGGG + Intronic
1005358783 6:25010366-25010388 CACTCAAGGCGGGAGGTGAAGGG - Intronic
1006424428 6:33955464-33955486 AACTCAGGGCAGATGGACACAGG - Intergenic
1006610560 6:35291983-35292005 AACTCAGGGTGGGTGTAGAGGGG - Intronic
1007633803 6:43286376-43286398 AGTTCAAAGCAGGTGGAGACTGG + Exonic
1011066108 6:83327694-83327716 ATCACAAGGCAAGTGGAGACAGG - Intronic
1013481703 6:110558486-110558508 AATTCAAGGAGAGTGGAGGCTGG + Intergenic
1015136921 6:129882806-129882828 CACTCAAGGAGGCTGGAGAGCGG + Intergenic
1017001199 6:149999041-149999063 GCCTCAAGGAGGGTGGAGGCTGG - Intergenic
1019633897 7:2065223-2065245 AGCTGAAGGCAGATGGAGACTGG - Intronic
1019719697 7:2560552-2560574 AACTGAAGGCCAGTGTAGACAGG - Intronic
1020329113 7:7000183-7000205 ATCACAAGGCAAGTGGAGACAGG + Intergenic
1020743351 7:12050403-12050425 AACTCAAGATGGTTGGAGTCTGG + Intergenic
1023395174 7:39745456-39745478 AAATCATGGCGGGTGGAGGGGGG - Intergenic
1029652524 7:101903239-101903261 TACACAAGGCGGGTGGTGGCGGG + Intronic
1031783195 7:125996873-125996895 AACTCAAGAGGTGTGGAGAATGG + Intergenic
1034623269 7:152472658-152472680 GAATCAAGGCGGGAGGAGAAAGG - Intergenic
1036249921 8:7153044-7153066 ATCACAAGGCAAGTGGAGACAGG + Intergenic
1036250589 8:7159039-7159061 ATCACAAGGCAAGTGGAGACAGG + Intergenic
1036366895 8:8128414-8128436 ATCACAAGGCAAGTGGAGACAGG - Intergenic
1036367574 8:8134393-8134415 ATCACAAGGCAAGTGGAGACAGG - Intergenic
1036373726 8:8182525-8182547 ATCACAAGGCAAGTGGAGACAGG - Intergenic
1036514486 8:9431094-9431116 ATCACAAGGCAAGTGGAGACAGG - Intergenic
1036877177 8:12483116-12483138 ATCACAAGGCAAGTGGAGACAGG + Intergenic
1036883306 8:12531268-12531290 ATCACAAGGCAAGTGGAGACAGG + Intergenic
1036883985 8:12537247-12537269 ATCACAAGGCAAGTGGAGACAGG + Intergenic
1037662247 8:20937959-20937981 AACTCAAAGGGGATGGAAACTGG - Intergenic
1037964197 8:23120608-23120630 AAGTCAAGGCAGTTGGGGACGGG - Intergenic
1038024130 8:23573916-23573938 AACCCAAGGCAGGTTGAGAGCGG - Exonic
1038375471 8:27036083-27036105 AACTCCAGGCAGGAGGACACAGG + Intergenic
1041667877 8:60463499-60463521 AACTTGAGGTGTGTGGAGACAGG + Intergenic
1041704896 8:60836196-60836218 AACTGAAGGCTGGTGGCCACAGG + Exonic
1045998369 8:108390145-108390167 AACTTTAGTGGGGTGGAGACAGG + Intronic
1060728822 9:126024527-126024549 AAGTAAATGCTGGTGGAGACGGG - Intergenic
1061192083 9:129087922-129087944 AAATGAAGGCAGGTGGAGGCCGG - Intronic
1062597450 9:137305657-137305679 AAGTGAGGGCGGGTGGAGGCGGG + Intergenic
1187867937 X:23740967-23740989 AACTCAAGGCGGGGGGAGTGGGG + Intronic
1193025755 X:76844173-76844195 ATCACAAGGCAAGTGGAGACAGG - Intergenic
1196238081 X:113306302-113306324 ATCACAAGGCAGGTGGAGGCAGG + Intergenic
1197702329 X:129608666-129608688 AACTAAAGGGGAGTGGAGAGAGG - Intergenic
1198788810 X:140319760-140319782 AACTCAAGGAGTTTGGAGACAGG + Intergenic
1201550758 Y:15214254-15214276 ACCTCAAGGAGGGAGGAGAGAGG + Intergenic
1201917846 Y:19201977-19201999 AACTCAAGGCACTTGGAAACAGG - Intergenic