ID: 1152511762

View in Genome Browser
Species Human (GRCh38)
Location 17:80794800-80794822
Sequence CCATCTCCAAGGGTGGCGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152511755_1152511762 7 Left 1152511755 17:80794770-80794792 CCCAGAAGTATCACACTAAGTGT 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1152511762 17:80794800-80794822 CCATCTCCAAGGGTGGCGCATGG 0: 1
1: 0
2: 0
3: 7
4: 113
1152511756_1152511762 6 Left 1152511756 17:80794771-80794793 CCAGAAGTATCACACTAAGTGTC 0: 1
1: 0
2: 1
3: 6
4: 129
Right 1152511762 17:80794800-80794822 CCATCTCCAAGGGTGGCGCATGG 0: 1
1: 0
2: 0
3: 7
4: 113
1152511754_1152511762 21 Left 1152511754 17:80794756-80794778 CCATTTGGGCGGTTCCCAGAAGT 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1152511762 17:80794800-80794822 CCATCTCCAAGGGTGGCGCATGG 0: 1
1: 0
2: 0
3: 7
4: 113
1152511753_1152511762 24 Left 1152511753 17:80794753-80794775 CCGCCATTTGGGCGGTTCCCAGA 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1152511762 17:80794800-80794822 CCATCTCCAAGGGTGGCGCATGG 0: 1
1: 0
2: 0
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152511762 Original CRISPR CCATCTCCAAGGGTGGCGCA TGG Intronic
900651669 1:3732871-3732893 CCATCTCCATCGGCGGCTCAGGG + Exonic
900751647 1:4401517-4401539 CGAGCTCCAGGGGTGGCCCATGG - Intergenic
902292838 1:15446512-15446534 CCACCTTCTAGGGTGGCACAGGG - Intronic
905601227 1:39253548-39253570 CCATCTCCCAGGCTGGTGTACGG + Intronic
906539281 1:46572606-46572628 CCAGCTCCAAGTGTGGGGCCTGG + Intronic
910209326 1:84777368-84777390 CCATCTCCACTGGTGGCTCTCGG + Intergenic
915126050 1:153665820-153665842 CCATATCCAAGGCTGAAGCAAGG + Intronic
918711924 1:187741769-187741791 CCATCACCCAGGCTGGAGCATGG - Intergenic
923081593 1:230661964-230661986 CTATCTCCAAGGGTGGGGGTAGG - Intronic
1062934026 10:1372598-1372620 CCATCTCACAGGGTGGTGCCAGG + Intronic
1069876363 10:71565602-71565624 GCACCTTCAAGGGTGGGGCAGGG - Intronic
1069920004 10:71810691-71810713 CCATCTCCCAGACTGGGGCAGGG + Intronic
1070665033 10:78336713-78336735 CCACCTCCCAGGCTGGAGCAGGG + Intergenic
1073683193 10:105727249-105727271 CCATTTCAAAGGGTGGCTCCTGG + Intergenic
1074870974 10:117575862-117575884 CCACCTCCCAGGGTGGGGCAGGG - Intergenic
1078069332 11:8097993-8098015 CCATCTCCAAGTCTGGCTCTAGG - Intronic
1084736194 11:71107204-71107226 CCATCTCCCTGGGTGACGCAGGG + Intronic
1089092111 11:115886543-115886565 CCCTCTCCAAGGCTGGCCTAGGG - Intergenic
1089322436 11:117635512-117635534 CCATTTCCCAGGGTGCAGCAGGG + Intronic
1089634969 11:119806168-119806190 CCATCTCTAAAGGTGCCACAGGG + Intergenic
1096188447 12:49599279-49599301 ACATCTTCAAGGGTTGCCCAAGG + Intronic
1101052378 12:100876342-100876364 CCATGTCCAAGGGTGGAGTGGGG + Intronic
1102606707 12:114073379-114073401 CCATCTCCAGGGCTGTCACATGG - Intergenic
1104008922 12:124915155-124915177 CCATCTCGCAGGGTGGGCCAGGG - Exonic
1114246851 14:20922235-20922257 GCTTCTCCAAGGGTGTGGCAGGG + Intergenic
1119735084 14:76976507-76976529 CCCTCTCCCAGGGAGGGGCAGGG + Intergenic
1120423318 14:84315764-84315786 CCCTCTGCTAGGGTGGCGCAGGG - Intergenic
1121848976 14:97202015-97202037 CCATCTTCAAGGTTGCCTCATGG + Intergenic
1125605550 15:40937943-40937965 CCTTCTCCCAGGGAGGCCCAGGG + Intronic
1127293375 15:57589940-57589962 CCAGCTCCTAGGGTGGGCCAGGG - Intergenic
1129596335 15:76967332-76967354 CCCTCTCCAGGGATGGCACACGG + Intergenic
1135744761 16:25007400-25007422 CCATCACCCAGGCTGGAGCACGG + Intronic
1136551345 16:30984126-30984148 CCATCTCCAAGCGTGGGGTTGGG + Exonic
1138988180 16:62357323-62357345 CCAACTCCAAGGATGGTACAAGG - Intergenic
1140667286 16:77239172-77239194 CCATCACCCAGGGTGGAGTACGG - Intergenic
1143728770 17:8867946-8867968 CCATGTCCAGGGGTGGGGGATGG - Intergenic
1147376673 17:40026817-40026839 CCCACTCCAAGGGTGGCGGTGGG - Intronic
1151255663 17:72874457-72874479 CCATCTGCAAGGCTGTCGCAGGG + Intronic
1152511762 17:80794800-80794822 CCATCTCCAAGGGTGGCGCATGG + Intronic
1154245374 18:12692277-12692299 CTATCGCCCAGGGTGGAGCACGG - Intronic
1157210408 18:45737198-45737220 CAATCTCTAAGGGTGGGGCCTGG + Intronic
1160995484 19:1880293-1880315 CCATCTCCGAGGGTTCCCCATGG + Intronic
1162661369 19:12171730-12171752 CCATCATCAAGGGTGGGGAAGGG + Intronic
1164687140 19:30174305-30174327 CCAACTCCCAGGGTCGCTCAAGG - Intergenic
926679768 2:15654381-15654403 CCATCACCAAGGGAGGCCCTGGG + Intergenic
927205881 2:20609946-20609968 CTATCACCAAAGGTGGGGCATGG + Intronic
927355383 2:22167252-22167274 CCATGTTCAAGGGTGGGGCCAGG - Intergenic
927428411 2:23006252-23006274 CCATCTCCAAGGGACAAGCATGG + Intergenic
927923061 2:26988750-26988772 CCCTCTCTGAGGGTGGCCCAAGG + Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
937291671 2:120785637-120785659 CCCTCTCCATGGGTGGTGCTGGG - Intronic
940860442 2:158765299-158765321 CCATCTGCAGGGCTGGCCCATGG - Intergenic
947377719 2:229513816-229513838 TCATCTCCAAGCCTGGCACATGG + Intronic
947576245 2:231277181-231277203 CCACCTCCAGGGCTGGGGCAGGG - Intronic
948165128 2:235855206-235855228 CCATCCCTTGGGGTGGCGCACGG + Intronic
948210717 2:236191260-236191282 CCATCTCAAAGGGTGGGTGAAGG + Intergenic
948855343 2:240727703-240727725 CCCTGTCCCAGGGTGGCTCAGGG + Intronic
1169414248 20:5402479-5402501 CAATCTCCAAAGGTGGAGCTGGG - Intergenic
1172126438 20:32627546-32627568 TCAGCTCCAAGGGTGGCCCAGGG - Intergenic
1174172423 20:48625790-48625812 CCTTCTCCAGGGATGGCCCAAGG - Exonic
1176097580 20:63351452-63351474 CCTTATCCATGAGTGGCGCATGG + Intronic
1176249863 20:64115419-64115441 CCATCCCCAGGGATGTCGCAGGG + Intergenic
1176722630 21:10404566-10404588 CCATCACCTAGGCTGGAGCACGG + Intergenic
1178889464 21:36509194-36509216 CCATCTCCACCTGTGGCGCTAGG - Intronic
1179817195 21:43914222-43914244 CCATCTCAAATTGTGGCGTAAGG - Intronic
1180303809 22:11057315-11057337 CCATCACCTAGGCTGGAGCACGG + Intergenic
1181455693 22:23059039-23059061 CCATCACCCAGGGTGGGGAAGGG + Intergenic
1183363620 22:37395805-37395827 GCATCACCAAGGGAGGCCCAGGG + Intronic
1184281629 22:43440754-43440776 TCACTCCCAAGGGTGGCGCAGGG - Intronic
1184762559 22:46552960-46552982 CAATCTCCAAAGGTGGCCCCAGG + Intergenic
1203324970 22_KI270738v1_random:4828-4850 CTATCGCGAAGGGAGGCGCAGGG - Intergenic
949321891 3:2820549-2820571 CCATCCCCAAGAGTGGGGAATGG + Intronic
950484768 3:13266681-13266703 CCCTCTCCAAGGTAGGCACAGGG + Intergenic
950541664 3:13616806-13616828 CCATCTCCCAGGGTTGTGCTGGG - Intronic
951251933 3:20404144-20404166 CCATCTCAAAGGGTGTGTCAGGG - Intergenic
953036135 3:39212465-39212487 CCCTCTCCAAGGGTTGCTCATGG - Intergenic
953332154 3:42062929-42062951 CCATCTCCTAAGGTGGCTCTGGG - Intronic
953404500 3:42653935-42653957 CCCTATCCCAGGGCGGCGCAGGG - Intronic
956042748 3:65162790-65162812 CAGTTTCCAAGGGTGGAGCAAGG + Intergenic
957940907 3:87002327-87002349 CCAACTCCAAGGGTGGGGACAGG + Intergenic
961155729 3:124678030-124678052 CCAGCTCCAAGGGTGGCTGGCGG - Intronic
963866845 3:150370521-150370543 GCATCCCCAAGGGTGGGGCCTGG - Intergenic
966793053 3:183690945-183690967 CCATCTACAAGGGTGGGATATGG + Intergenic
967739364 3:192987957-192987979 TCATTTCCAAGGGTAGCTCAAGG + Intergenic
970316503 4:14833001-14833023 ACACCTCTAAGGGTGGCCCAGGG + Intergenic
985786382 5:1897488-1897510 CCTTCTCCAAGGGAGTCCCATGG - Intergenic
985942663 5:3150935-3150957 CAATCTCCATGGCTGCCGCAGGG - Intergenic
986605019 5:9514123-9514145 CCATCTACAAGGGAGGAGCAGGG + Intronic
989111797 5:37913824-37913846 CCATCTCCAAGTGTGCCTCTGGG - Intergenic
996685698 5:126278270-126278292 CCTTCTCCAAGGGAGACACATGG + Intergenic
998368070 5:141644066-141644088 CCATCTCCTATGGGGGGGCAGGG - Intronic
999920715 5:156317309-156317331 CCATCTCCTATGGTTGTGCAAGG - Intronic
1001133994 5:169087337-169087359 CCATCTCCCAGGTAGGCCCAGGG + Intronic
1007430750 6:41775384-41775406 CCCTATCCCAGGGTGGAGCAGGG + Intronic
1013099255 6:106974075-106974097 CCAACTCCGAGGGTGGAGGATGG + Intronic
1013268993 6:108528405-108528427 CCTTGTCCAAGGGTGGTCCAGGG - Intergenic
1017168864 6:151436672-151436694 ACATCTCCAAGGGTGATACAAGG + Intronic
1019398968 7:840244-840266 GCATCTCCAAGGGTGAGGCTGGG - Intronic
1022494564 7:30844738-30844760 CCCTCTCCCAGGGTGGCTGAGGG - Intronic
1026634498 7:72069593-72069615 CCCTCTGCAAGGGAGGCACAGGG - Intronic
1027513262 7:79109952-79109974 CAACCTCCTAGGGTGGCACAGGG - Intronic
1029335833 7:99898448-99898470 CCATCCCCAAGGGGAGGGCATGG - Intronic
1033560243 7:142523820-142523842 CAATCACCAAGGATGGCCCACGG + Intergenic
1033597516 7:142867850-142867872 CCATCTCCACGTGGGGCCCAGGG - Intronic
1034169801 7:149054210-149054232 CCTTCTCCCAGGGTGGTGAAGGG + Intergenic
1034692441 7:153024491-153024513 CCAGCTACAAGGGTGGAGCTGGG + Intergenic
1038975613 8:32692546-32692568 CCATCTCCAAAAGTGGGTCATGG + Intronic
1040632403 8:49230580-49230602 CCTTCCCCAAGGGTGTGGCAGGG + Intergenic
1042042693 8:64609967-64609989 GAATCTCTAAGGGTGGGGCAAGG + Intronic
1043796743 8:84551763-84551785 CTATCTCCTAGGCTGGTGCATGG + Intronic
1044525409 8:93245713-93245735 CCATCTCCAACTGTGGCTCCAGG + Intergenic
1047358943 8:124150091-124150113 CCATGTCCAAGGGAGGTGGAGGG - Intergenic
1048288851 8:133164232-133164254 CCCTCTCCAAGTGGGGTGCAGGG + Intergenic
1051261096 9:15265517-15265539 CCAACACCAAGGGAGGAGCAGGG + Intronic
1052212755 9:25926490-25926512 CCATCACCCAGGCTGGAGCACGG - Intergenic
1056825532 9:89874033-89874055 ACCTGTCCAAGGGTGGCCCAGGG - Intergenic
1058890139 9:109354447-109354469 CCCCCTCCCAGGGTGGCCCAAGG + Intergenic
1059422012 9:114197964-114197986 CCATCTACAATGGTGGCCCCAGG - Intronic
1185736246 X:2499094-2499116 GCTTCTCAAAGGGTGGCGCTGGG + Intronic
1186513943 X:10152050-10152072 AGCTCTCCAAGGGTGGGGCATGG - Intergenic
1190107706 X:47571564-47571586 TCATCTCCCAGGGTGGGGAATGG - Exonic