ID: 1152512647

View in Genome Browser
Species Human (GRCh38)
Location 17:80800980-80801002
Sequence CTGCTGTCCCTGGGCCACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 861
Summary {0: 1, 1: 0, 2: 8, 3: 81, 4: 771}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152512647_1152512656 12 Left 1152512647 17:80800980-80801002 CCCGTGTGGCCCAGGGACAGCAG 0: 1
1: 0
2: 8
3: 81
4: 771
Right 1152512656 17:80801015-80801037 AGCCCCACAGCCCTGGAGCTTGG 0: 1
1: 0
2: 4
3: 69
4: 446
1152512647_1152512655 5 Left 1152512647 17:80800980-80801002 CCCGTGTGGCCCAGGGACAGCAG 0: 1
1: 0
2: 8
3: 81
4: 771
Right 1152512655 17:80801008-80801030 GGGCTGCAGCCCCACAGCCCTGG 0: 1
1: 1
2: 7
3: 78
4: 536
1152512647_1152512657 13 Left 1152512647 17:80800980-80801002 CCCGTGTGGCCCAGGGACAGCAG 0: 1
1: 0
2: 8
3: 81
4: 771
Right 1152512657 17:80801016-80801038 GCCCCACAGCCCTGGAGCTTGGG 0: 1
1: 0
2: 1
3: 58
4: 736
1152512647_1152512663 24 Left 1152512647 17:80800980-80801002 CCCGTGTGGCCCAGGGACAGCAG 0: 1
1: 0
2: 8
3: 81
4: 771
Right 1152512663 17:80801027-80801049 CTGGAGCTTGGGTTTGACTCTGG 0: 1
1: 0
2: 3
3: 20
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152512647 Original CRISPR CTGCTGTCCCTGGGCCACAC GGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900461764 1:2805175-2805197 CTCTTGACCCTGAGCCACACAGG + Intergenic
900796659 1:4712295-4712317 CTGCTGCTCCGGGGCCCCACCGG - Exonic
901065491 1:6492272-6492294 CTTGTGGCCCTGGGCCACAGGGG - Intronic
901089161 1:6629912-6629934 CTGCAGCCCCTGGGCCACACTGG - Intronic
901152683 1:7114366-7114388 TTGGCTTCCCTGGGCCACACTGG + Intronic
901255277 1:7819871-7819893 TTGGCTTCCCTGGGCCACACTGG - Intronic
901576026 1:10201654-10201676 CTGTTTTCCCTGGTCCTCACTGG - Intergenic
901604619 1:10449446-10449468 CTGCTGGCCCTGGGGCAGCCGGG - Intronic
902131705 1:14267284-14267306 TTGGCTTCCCTGGGCCACACTGG + Intergenic
902163079 1:14547956-14547978 TTGGATTCCCTGGGCCACACTGG + Intergenic
902200867 1:14832527-14832549 TTGGCTTCCCTGGGCCACACTGG + Intronic
902284201 1:15395867-15395889 TTGGCTTCCCTGGGCCACACTGG - Intronic
902866009 1:19280003-19280025 TTGGTTTCCCTGGGCCACACTGG - Intergenic
903630624 1:24766948-24766970 TTGGCTTCCCTGGGCCACACTGG + Intronic
903738919 1:25546900-25546922 TTGGCTTCCCTGGGCCACACTGG - Intronic
904056284 1:27672509-27672531 CAGCTCCCCCTGGGGCACACAGG + Intergenic
904684563 1:32251070-32251092 CTACTGTCCCAGGGTGACACTGG - Intergenic
904937439 1:34141586-34141608 CTGCTGTTCCTCAGACACACTGG - Intronic
905367151 1:37458807-37458829 TTGGCTTCCCTGGGCCACACTGG + Intergenic
905521391 1:38603198-38603220 CTGGTTTTCCTGGGCCACAGGGG - Intergenic
905698249 1:39991957-39991979 TTGCCTTCCCTGGGCCATACTGG + Intergenic
906635376 1:47406196-47406218 CTGTCCTCCCTGGGCCTCACAGG + Intergenic
907050929 1:51329729-51329751 CTGCTTTTCCTGGGCCCCAGTGG - Intronic
907086016 1:51674827-51674849 TTGCCTTCCCTGGGCCACATTGG + Intronic
907192300 1:52659643-52659665 TTGCAGGTCCTGGGCCACACTGG - Intronic
907441443 1:54481053-54481075 TTGGCTTCCCTGGGCCACACTGG - Intergenic
907486436 1:54781330-54781352 CGGCCGTCCCTGGGCCACCAGGG + Exonic
907895860 1:58690752-58690774 TTGGCTTCCCTGGGCCACACTGG - Intronic
908267603 1:62394741-62394763 CTAGTGTCCCTGGGCCTCTCGGG + Intergenic
908366979 1:63434688-63434710 TTGGCTTCCCTGGGCCACACTGG - Intronic
908794965 1:67821986-67822008 TTGGCTTCCCTGGGCCACACTGG + Intronic
908979899 1:69943053-69943075 CTGGCTTCCCTGGGCCACATTGG - Intronic
909330684 1:74406396-74406418 TTGGCTTCCCTGGGCCACACTGG - Intronic
909443287 1:75721487-75721509 TTGGCTTCCCTGGGCCACACTGG - Intergenic
909535052 1:76727045-76727067 CTGCTGCACCTGAGCCACAGAGG - Intergenic
909630813 1:77768021-77768043 TTGGCTTCCCTGGGCCACACTGG - Intergenic
909747684 1:79119065-79119087 TTGGTTTCCCTGGGCCACATTGG + Intergenic
910191591 1:84601184-84601206 CTGCCGTACCTGGTCCAAACTGG - Intergenic
910730579 1:90391644-90391666 TTGGCTTCCCTGGGCCACACTGG + Intergenic
910823528 1:91379386-91379408 TTGGCTTCCCTGGGCCACACTGG + Intronic
911141069 1:94503131-94503153 TTGGTTTCCCTGGGCCACACTGG - Intronic
911236193 1:95415086-95415108 TTGGATTCCCTGGGCCACACTGG - Intergenic
911252063 1:95587539-95587561 CTGGCTTCCCTGAGCCACACTGG - Intergenic
912033126 1:105274688-105274710 CTGCTTTTCCTGAGTCACACAGG + Intergenic
912175923 1:107156713-107156735 GTTCTGTCCCTGGACCACACAGG - Intronic
912328208 1:108789393-108789415 TTGGCTTCCCTGGGCCACACTGG - Intronic
913235162 1:116774684-116774706 TTGGCTTCCCTGGGCCACACTGG - Intergenic
913691721 1:121285910-121285932 TTGTTCTCCCTGGGCCACATTGG + Intronic
914145824 1:144994045-144994067 TTGGTCTCCCTGGGCCACATTGG - Intronic
914355733 1:146882634-146882656 CTCCTGCCACTGGGCCACCCCGG - Intergenic
914917905 1:151829615-151829637 CCTCTGCCCTTGGGCCACACTGG + Intronic
915617398 1:157049755-157049777 TTGGCTTCCCTGGGCCACACTGG - Intergenic
915933189 1:160072990-160073012 TTGGTTTCCCTGGGCCACATTGG + Intergenic
916049837 1:161028568-161028590 TTGGCTTCCCTGGGCCACACTGG + Intronic
916531589 1:165661443-165661465 TTGGCTTCCCTGGGCCACACTGG + Intronic
916575334 1:166061895-166061917 CTGCTGCTCCTGGACCATACTGG + Intronic
916578840 1:166089945-166089967 CCACTGTCCCTGAGCCACACTGG + Intronic
916743552 1:167666931-167666953 TTGGTTTCCCTGGGCCACAGTGG - Intronic
917035883 1:170746412-170746434 CTGCTGTCCTTGCTCCCCACGGG - Intergenic
917806982 1:178622601-178622623 TTGGCTTCCCTGGGCCACACTGG + Intergenic
918212605 1:182364698-182364720 ATGCTCTCCCTGAGCCTCACTGG + Intergenic
918381556 1:183960839-183960861 TTGACTTCCCTGGGCCACACTGG - Intronic
918385062 1:183997484-183997506 TTGGCTTCCCTGGGCCACACTGG + Intronic
918527956 1:185485730-185485752 TTGGCTTCCCTGGGCCACACTGG + Intergenic
918540392 1:185625868-185625890 TTGGCTTCCCTGGGCCACACTGG - Intergenic
919005234 1:191890639-191890661 TTGGCTTCCCTGGGCCACACTGG + Intergenic
919633854 1:199985152-199985174 TTGGCTTCCCTGGGCCACACTGG + Intergenic
920202930 1:204271199-204271221 TTGGCTTCCCTGGGCCACACTGG - Intronic
920458152 1:206116703-206116725 CTGCTGACCCTGGGCCAGCTGGG - Exonic
920479052 1:206304419-206304441 TTGGTCTCCCTGGGCCACATTGG + Intronic
920499800 1:206478978-206479000 CTGGTGTCGGGGGGCCACACTGG - Exonic
921339179 1:214117454-214117476 TTACTGTACCTGGGCCATACTGG - Intergenic
921660174 1:217791985-217792007 TTGGCTTCCCTGGGCCACACTGG + Intronic
921784887 1:219218575-219218597 TTGGCTTCCCTGGGCCACACTGG - Intergenic
921808687 1:219486655-219486677 TTGGCTTCCCTGGGCCACACTGG - Intergenic
922237101 1:223730417-223730439 TTGGCTTCCCTGGGCCACACTGG - Intronic
922307748 1:224358653-224358675 TTGGCTTCCCTGGGCCACACTGG - Intronic
922435985 1:225607151-225607173 TTGGCTTCCCTGGGCCACACTGG + Intronic
922821951 1:228490677-228490699 CACCTGGCCCTGGGCCACACAGG - Intronic
922823561 1:228501661-228501683 CTGGTGGCCTTGGGTCACACTGG - Intergenic
922896659 1:229106052-229106074 CTCCTGTCCTTGAGCCACACTGG - Intergenic
922902741 1:229149932-229149954 CAGCTGGCCCAGAGCCACACTGG + Intergenic
923329672 1:232911073-232911095 TTGGCTTCCCTGGGCCACACTGG - Intergenic
923570460 1:235108623-235108645 TTGGTTTCCCTGGGCCACACTGG - Intergenic
924376230 1:243412295-243412317 TTGGCTTCCCTGGGCCACACTGG + Intronic
924386730 1:243506167-243506189 CTGCGGTCCTTGGGCCTGACGGG - Intronic
924416860 1:243864903-243864925 CTGACTTCCCTGGGCCACACTGG + Intergenic
924586793 1:245367376-245367398 CTGCTCTTCCTGGCTCACACAGG - Intronic
924610398 1:245568644-245568666 CAGCTGGCCCTGGGCGTCACAGG + Intronic
924666174 1:246074141-246074163 TTGGCTTCCCTGGGCCACACTGG - Intronic
1063151124 10:3337317-3337339 CTGGCTTCCCTGGGCCACACTGG + Intergenic
1063586532 10:7357928-7357950 CTGATGTCCCAGGGCCATGCTGG - Intronic
1063617565 10:7614555-7614577 TTGGCTTCCCTGGGCCACACTGG - Intronic
1064018555 10:11791529-11791551 CTGCTGTCTCTGAGCCACAGAGG - Intergenic
1064140893 10:12789294-12789316 TTGGTTTCCCTGGGCCACAGTGG - Intronic
1064895054 10:20226370-20226392 TTGGCCTCCCTGGGCCACACTGG - Intronic
1065248364 10:23783106-23783128 TTGGCTTCCCTGGGCCACACTGG + Intronic
1065520759 10:26568953-26568975 GTGGCTTCCCTGGGCCACACTGG - Intergenic
1065946529 10:30610037-30610059 TTGACTTCCCTGGGCCACACTGG + Intergenic
1066176083 10:32907741-32907763 TTGGCTTCCCTGGGCCACACTGG + Intronic
1066246408 10:33587470-33587492 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1066326904 10:34369411-34369433 TTGGCTTCCCTGGGCCACACTGG - Intronic
1066359556 10:34717033-34717055 TTGGTATCCCCGGGCCACACTGG - Intronic
1066443330 10:35459476-35459498 TTGGTTTCCCTGGGCCACAATGG - Intronic
1068317264 10:55362880-55362902 TTGGCATCCCTGGGCCACACTGG + Intronic
1068613994 10:59091519-59091541 CTGGTGTCCCTGGAACACAGAGG + Intergenic
1070260343 10:74848628-74848650 TTGGCTTCCCTGGGCCACACTGG - Intronic
1070503335 10:77091586-77091608 CTCCTGTCCCTGTGCCCCCCAGG + Intronic
1071017394 10:81013955-81013977 AGGCTGTCACTGAGCCACACTGG - Intergenic
1071492084 10:86143126-86143148 CTGCTGTCCCTCAGGAACACTGG - Intronic
1071756811 10:88551144-88551166 CTGATGTCCCCAGGCCACCCAGG + Intronic
1072150777 10:92681005-92681027 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1072616101 10:97049670-97049692 CTGGAGTCCCTGGGCTTCACAGG + Intronic
1072826174 10:98608946-98608968 TTGCTGTCCAGTGGCCACACAGG - Intronic
1072844184 10:98810672-98810694 TTGGCTTCCCTGGGCCACACTGG + Intronic
1072937203 10:99724654-99724676 TTGGCTTCCCTGGGCCACACTGG + Intronic
1072952075 10:99856574-99856596 TTGGCCTCCCTGGGCCACACTGG + Intergenic
1073052410 10:100676489-100676511 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1073210306 10:101795732-101795754 TTGGCTTCCCTGGGCCACACTGG + Intronic
1073407808 10:103313222-103313244 TTGGCTTCCCTGGGCCACACTGG + Intronic
1074093454 10:110285699-110285721 CTGCTGCCCTTAGGCCACATGGG + Exonic
1074118052 10:110472502-110472524 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1074873758 10:117597996-117598018 CCACTGTACCTGGCCCACACTGG + Intergenic
1075093799 10:119458250-119458272 CTGCTGTCCCTGGTGGACAGAGG + Intronic
1075234055 10:120710705-120710727 CTACTGACCCTGGGCCACTGTGG + Intergenic
1075729543 10:124628077-124628099 CTGCTGTTCCTGGGCCAGCAGGG + Intronic
1075801775 10:125159194-125159216 CGGCTGTCCCTGCGCCGCACCGG + Intronic
1076402877 10:130194984-130195006 CTGGGGTCCCTGAGTCACACCGG + Intergenic
1076588984 10:131570384-131570406 CTGCCCTCGCAGGGCCACACAGG - Intergenic
1076746104 10:132515298-132515320 CTGCTGTGCCTCCGCCACAGAGG - Intergenic
1077096190 11:800111-800133 CTGCTGTCCCTCAGTCCCACCGG + Exonic
1077116005 11:884933-884955 CAGCTCTCCCTGGGCCAGGCGGG - Intronic
1077810080 11:5628063-5628085 CTGCTGGGCTTGAGCCACACTGG + Intronic
1078343423 11:10519893-10519915 TTGGCTTCCCTGGGCCACACTGG + Intronic
1078461143 11:11516057-11516079 CTGCTGTCCCTGTCACACTCAGG - Intronic
1078682235 11:13487681-13487703 TTGGTTTCCCTGGGCCACAATGG - Intergenic
1078859168 11:15231314-15231336 TTGACTTCCCTGGGCCACACTGG + Intronic
1079110134 11:17600712-17600734 CTGTGGTCCCTGGGGCAGACAGG + Intronic
1079145181 11:17844826-17844848 TTGGCGTCCCTGGGCCACACTGG + Intronic
1079205158 11:18408566-18408588 TTGCTTTCCCTGAGCCACATTGG + Intergenic
1080274399 11:30487428-30487450 CTGCTGTTCCTGCACCACAGAGG - Intronic
1080395853 11:31889330-31889352 TTGGTTTCCTTGGGCCACACTGG + Intronic
1080452520 11:32390294-32390316 CTGGTGTCCCAGGGTCAGACTGG + Intronic
1080980832 11:37403584-37403606 CTGCTCTGTCTGGGCCACAGAGG + Intergenic
1081228542 11:40555610-40555632 TTGGCTTCCCTGGGCCACACTGG + Intronic
1082089674 11:48079073-48079095 TTGGTTTCCCTGGGCCACACTGG + Intronic
1082221281 11:49640709-49640731 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1082698766 11:56402172-56402194 CTGCTGGCCCTGGGCAATAAGGG - Intergenic
1082930988 11:58604808-58604830 TTGGCTTCCCTGGGCCACACTGG - Intronic
1083441242 11:62678118-62678140 CTGTTTTCCCTCGGCAACACAGG - Exonic
1083610030 11:64000160-64000182 CTGATGTCCCAGTGACACACGGG + Intronic
1083661508 11:64253644-64253666 CTGCTGGTCCTGAGTCACACAGG + Intronic
1083698003 11:64455527-64455549 CTGCAGACCCTGTGCTACACGGG + Intergenic
1084139841 11:67218949-67218971 TTGGCTTCCCTGGGCCACACTGG - Intronic
1084403767 11:68959648-68959670 CTGCTGTCCCAGATCCACGCAGG + Intergenic
1084540941 11:69786785-69786807 TTGGATTCCCTGGGCCACACTGG - Intergenic
1085028985 11:73258331-73258353 CTGCTGTCCCTGGGTCCTCCTGG - Intergenic
1085075668 11:73589412-73589434 TTGGTTTCCCTGGGCTACACTGG + Intronic
1085262385 11:75214479-75214501 CTGCTGTCCCTTGGCCAGGAGGG + Intergenic
1085724454 11:78942026-78942048 TGGCTTTCCCTGGGCCATACTGG + Intronic
1086215490 11:84374558-84374580 TTGGTCTCCCTGGGCCACACTGG - Intronic
1086627761 11:88978391-88978413 TTGGCTTCCCTGGGCCACACTGG + Intronic
1087600299 11:100305862-100305884 TTGGCTTCCCTGGGCCACACTGG + Intronic
1087700834 11:101434635-101434657 CTGGCTTCCCTGGGCCACATTGG - Intergenic
1088275818 11:108084061-108084083 TTGGCTTCCCTGGGCCACACTGG - Intronic
1088299578 11:108342167-108342189 TTGGATTCCCTGGGCCACACTGG - Intronic
1089194575 11:116686787-116686809 CAACTGCCCCTGGACCACACAGG - Intergenic
1089781371 11:120875415-120875437 GTGCAGTCCCTGAGCCACAATGG - Intronic
1089891300 11:121884139-121884161 TTGTCTTCCCTGGGCCACACTGG - Intergenic
1089898843 11:121960356-121960378 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1091270741 11:134310133-134310155 TTGGCTTCCCTGGGCCACACTGG + Intronic
1091584239 12:1806822-1806844 CTTCTGTCCTTCAGCCACACTGG + Intronic
1091945059 12:4532167-4532189 TTGGCTTCCCTGGGCCACACTGG - Intronic
1092066029 12:5590285-5590307 CTGGCTTCCCTGGGCCACATTGG - Intronic
1092115102 12:5995131-5995153 TTGGCTTCCCTGGGCCACACTGG - Intronic
1092275901 12:7060788-7060810 CTGCTGTCCCTGGGGGCCAGAGG + Intronic
1092788433 12:12050714-12050736 TTGGCTTCCCTGGGCCACACTGG + Intronic
1093697098 12:22172839-22172861 TTGGCTTCCCTGGGCCACACTGG + Intronic
1093932655 12:24969769-24969791 GTGCTGTGGCTGGGCCCCACTGG + Intergenic
1093972791 12:25390513-25390535 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1094723882 12:33092495-33092517 CTACTGTCCATGTGTCACACTGG - Intergenic
1095113542 12:38326281-38326303 TTGGCTTCCCTGGGCCACACTGG - Exonic
1095546197 12:43373424-43373446 TTGGCTTCCCTGGGCCACACTGG + Intronic
1095662323 12:44751871-44751893 CTGGATTCCCTGGGCCACATTGG + Intronic
1096190238 12:49612608-49612630 TTGGCTTCCCTGGGCCACACTGG - Intronic
1096532643 12:52251299-52251321 TTGGCTTCCCTGGGCCACACTGG + Intronic
1097133747 12:56834593-56834615 TTGGTTTCCCTGGGCCACACTGG + Intergenic
1098037188 12:66316483-66316505 TTGGCTTCCCTGGGCCACACTGG + Intronic
1098389042 12:69949728-69949750 CTGGCTTCCCTAGGCCACACTGG - Intronic
1098903344 12:76135471-76135493 TTGACTTCCCTGGGCCACACTGG - Intergenic
1098907956 12:76180841-76180863 CTGCTCTTCTTGGCCCACACTGG - Intergenic
1099967185 12:89461053-89461075 TGGCTTTCCCTGGGCCACATTGG + Intronic
1100553198 12:95666868-95666890 TTGACTTCCCTGGGCCACACTGG + Intronic
1101008793 12:100428612-100428634 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1101549673 12:105750332-105750354 CTGCTATCATTGGGACACACAGG + Intergenic
1101714877 12:107302057-107302079 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1101878950 12:108613597-108613619 CTGCTGTCCCTGCCCCTCCCAGG - Intergenic
1101879228 12:108614992-108615014 CTGCTGTCCCTGCCCCTCCCAGG - Intergenic
1102240333 12:111320893-111320915 CTGCTGTCCCTGGGTCCCGCAGG + Intronic
1102331734 12:112038633-112038655 CTGGCTTCCCTGGGCCACACTGG + Intronic
1102465455 12:113128201-113128223 CTGGGGTCCTCGGGCCACACAGG + Intronic
1102545755 12:113654083-113654105 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1102766035 12:115433771-115433793 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1102830324 12:115992064-115992086 CTGCTATCACTGGGATACACTGG + Intronic
1104304279 12:127595090-127595112 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1104391310 12:128392701-128392723 TTGGCTTCCCTGGGCCACACTGG + Intronic
1104658873 12:130594481-130594503 CTGTCTTCCCTGGGCCACATTGG + Intronic
1104674860 12:130705502-130705524 CAGCTGTCCCAGGCCCACACAGG + Intronic
1104788305 12:131466048-131466070 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1105029499 12:132872956-132872978 CTGCTGACCCAGGGACAGACAGG + Intronic
1105547977 13:21365660-21365682 CTGCTGGCCTGAGGCCACACAGG - Intergenic
1105736021 13:23271333-23271355 TTGCCTTCCCTGGGCCACACTGG + Intronic
1105900052 13:24745970-24745992 CCGCTGCCCGTGGGCCACCCCGG + Intergenic
1105909557 13:24849519-24849541 TTGGCTTCCCTGGGCCACACTGG - Intronic
1105949066 13:25213430-25213452 TGGCTTTCCCTCGGCCACACTGG - Intergenic
1106034003 13:26027544-26027566 CTGGCTTCCCTGGGCCACACTGG - Intergenic
1106089768 13:26580096-26580118 TTGGCTTCCCTGGGCCACACTGG - Intronic
1106147166 13:27059924-27059946 TTGGCGTCCCTGAGCCACACTGG + Intergenic
1106204457 13:27577464-27577486 TTGGCTTCCCTGGGCCACACGGG + Intronic
1106460508 13:29963893-29963915 CTGCTGGCCCTGGTCCTCAGTGG - Intergenic
1106539980 13:30681755-30681777 CTGCTTTCTGAGGGCCACACTGG - Intergenic
1106699548 13:32214507-32214529 TTGGCTTCCCTGGGCCACACTGG - Intronic
1106772255 13:32972895-32972917 TTGGCATCCCTGGGCCACACTGG - Intergenic
1106981861 13:35294971-35294993 TTGGCTTCCCTGGGCCACACTGG + Intronic
1107120810 13:36794111-36794133 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1107843024 13:44479402-44479424 TTGGTTTCCCTGGGCCACGCTGG - Intronic
1108464419 13:50700519-50700541 TTTCTGTCCCTGGGCCCCAGAGG + Intronic
1108722468 13:53146133-53146155 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1109274705 13:60290705-60290727 CTGCTGAACCTGGGCCCAACAGG - Intergenic
1109744310 13:66602115-66602137 TTGGTTTCCCTGGGCCACATTGG + Intronic
1110145423 13:72184820-72184842 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1110354520 13:74551965-74551987 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1111601080 13:90475543-90475565 TTGCCTTCCCTGGGCCACATTGG - Intergenic
1112011782 13:95299649-95299671 TTGGGTTCCCTGGGCCACACTGG - Intronic
1112184087 13:97111663-97111685 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1112307044 13:98284260-98284282 TTGGTTTCCCTGGGCCACACTGG - Intronic
1112392308 13:98996756-98996778 TTGGCTTCCCTGGGCCACACTGG - Intronic
1112417961 13:99219660-99219682 TTGGTTTCCCTGGGCCACACTGG - Intronic
1112422587 13:99266447-99266469 CTGCAGCCCATGGGCCACATGGG - Intronic
1113714490 13:112493404-112493426 CTGGTGTCCCTGAGACACTCTGG + Intronic
1113714543 13:112493670-112493692 CTGGTGTCCCTGAGACACTCTGG + Intronic
1113714551 13:112493708-112493730 CTGGTGTCCCTGAGACACTCTGG + Intronic
1113877408 13:113602893-113602915 TTGTTTTCCCTGGGCCACATTGG + Intronic
1114568164 14:23647468-23647490 CTGCAGGGCCTGGGCCACAAAGG - Intergenic
1114856624 14:26454079-26454101 TTGGCTTCCCTGGGCCACACTGG + Intronic
1115520823 14:34231519-34231541 CTGCTGTCCCTCCGGCCCACAGG + Intronic
1115749030 14:36469614-36469636 TTGATTTCCCTGGGCCACATAGG - Intergenic
1116001310 14:39245297-39245319 TTGGTTTCCCTGGGCCACCCTGG + Intronic
1117058784 14:51939759-51939781 TTGCTCTCCCTGTGCCATACAGG + Intronic
1117962944 14:61180427-61180449 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1118353119 14:64988284-64988306 CAGCCTTCCCTGGGACACACTGG - Intronic
1118417808 14:65562107-65562129 AGGGTTTCCCTGGGCCACACTGG - Intronic
1118493833 14:66288270-66288292 CTGAGCTCCCTGGGCCTCACTGG - Intergenic
1118898570 14:69967535-69967557 TTGGCTTCCCTGGGCCACACTGG - Intronic
1119131098 14:72173962-72173984 ATGCTGTGCCTGGAACACACTGG + Intronic
1119151969 14:72368955-72368977 TTGACTTCCCTGGGCCACACTGG + Intronic
1119450545 14:74706116-74706138 CTGCTATGCCTGAGCCACAGAGG + Intronic
1120114716 14:80601363-80601385 TTGGCTTCCCTGGGCCACACTGG + Intronic
1120119420 14:80660009-80660031 CTGCAATCCCTGGTCAACACAGG - Intronic
1120983451 14:90311690-90311712 TTGGTTTCCCTGGGCCCCACTGG + Intronic
1121079839 14:91098779-91098801 GTGCTGGCCATGGGCCACATGGG - Intronic
1121212985 14:92223050-92223072 CTGCGGACCCTGGGCCACTTTGG + Intergenic
1121609096 14:95263531-95263553 CTCCTTTTCCTGGGTCACACCGG - Intronic
1121801408 14:96777287-96777309 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1122171375 14:99878128-99878150 TTGGTTTCCCTGGGCCACATTGG - Intronic
1122689732 14:103526459-103526481 CTGCTCTCCCTGGGGCCCACAGG + Intergenic
1122886759 14:104713701-104713723 CTCCTCTCCCTGGGCCACCCTGG + Intronic
1123466063 15:20516862-20516884 TTGGTTTCCCTGGGCCACACTGG + Intergenic
1123652051 15:22484177-22484199 TTGGTTTCCCTGGGCCACACTGG - Intergenic
1123742471 15:23293037-23293059 TTGGTTTCCCTGGGCCACACTGG - Intergenic
1123760854 15:23431449-23431471 TTGGTTTCCCTGGGCCACACTGG + Intergenic
1124276787 15:28332838-28332860 TTGGTTTCCCTGGGCCACACTGG + Intergenic
1124305913 15:28578768-28578790 TTGGTTTCCCTGGGCCACACTGG - Intergenic
1124485538 15:30111750-30111772 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1124518038 15:30385517-30385539 TTGGCTTCCCTGGGCCACACTGG - Intronic
1124540615 15:30580736-30580758 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1124758038 15:32426845-32426867 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1125841655 15:42806895-42806917 TTGGCTTCCCTGGGCCACACTGG - Intronic
1126823363 15:52526940-52526962 TTGGCTTCCCTGGGCCACACTGG + Intronic
1126830029 15:52592579-52592601 TTGGCTTCCCTGGGCCACACTGG + Intronic
1126830421 15:52597750-52597772 TTGGCTTCCCTGGGCCACACTGG + Intronic
1127467192 15:59255616-59255638 TTGGCTTCCCTGGGCCACACTGG + Intronic
1128108083 15:65058890-65058912 TGGCTGTCCCTGGGCACCACTGG + Intronic
1129117501 15:73373251-73373273 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1129375195 15:75125919-75125941 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1129392666 15:75228371-75228393 CTGCTGGCCCAGAGACACACAGG + Intergenic
1129717500 15:77860689-77860711 CTGCTGCCCCTGGGCCACTCTGG + Intergenic
1130097325 15:80865728-80865750 TTGGTTTCCCTGGGCCATACTGG - Intronic
1130262137 15:82363671-82363693 CTGGCTTCCCTGGGCCACGCTGG - Intergenic
1130279094 15:82505336-82505358 CTGGCTTCCCTGGGCCACGCTGG + Intergenic
1130452575 15:84071452-84071474 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1130461252 15:84159508-84159530 CTGCTGCCCCTGGGCCACTCTGG - Intergenic
1130992877 15:88887073-88887095 CTGCTGTCCCTGTCCCAGCCTGG + Intronic
1131079099 15:89519478-89519500 CTGGCTTCCCTGGGCCACATGGG - Intergenic
1132280957 15:100614660-100614682 TTGGCTTCCCTGGGCCACACTGG + Intronic
1133018300 16:2955019-2955041 ATGCTGTCCTCGGGCCTCACGGG - Intergenic
1133175349 16:4010245-4010267 TTGCAGTCCCGGAGCCACACAGG - Intronic
1133638770 16:7696934-7696956 CTCATATCCGTGGGCCACACTGG - Intronic
1133776684 16:8901881-8901903 CTACTGTCTCCGGGCCTCACAGG + Intronic
1134432360 16:14222499-14222521 TTGCCTTCCCTGGGCCACACTGG - Intronic
1135043818 16:19138112-19138134 TTGGCTTCCCTGGGCCACACTGG - Intronic
1135533413 16:23274128-23274150 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1135551913 16:23405112-23405134 CTCCTGTCCCTGGACCCCAAGGG + Intronic
1136142062 16:28294012-28294034 TTGCTGTCCCTGGGACAAATGGG - Intronic
1136142544 16:28296784-28296806 TTGCTGTCCCTGGGACACATGGG - Intronic
1136553182 16:30992660-30992682 CTGGTGTCCCTGGACCTCACCGG - Exonic
1136618280 16:31411426-31411448 CTGCTCTCCCGGGGCCCCAATGG - Exonic
1137931607 16:52593204-52593226 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1138356159 16:56382428-56382450 TTGGCTTCCCTGGGCCACACTGG + Intronic
1139082593 16:63541273-63541295 CTGGCTTCCCTGGGCCACAATGG - Intergenic
1139527396 16:67525342-67525364 CGGCTGTGCCCGGGCCACCCTGG - Intronic
1139841250 16:69882627-69882649 GTGCTTTCCCTGGGCCGCAGGGG + Intronic
1139958100 16:70702793-70702815 CTACAGTCCCTAGTCCACACCGG + Intronic
1139978284 16:70832810-70832832 CTCCTGCCACTGGGCCACCCCGG + Intronic
1140348751 16:74241109-74241131 TTGGCATCCCTGGGCCACACTGG + Intergenic
1140551354 16:75869683-75869705 CTGTTGTCCCAGGGTCACCCAGG + Intergenic
1141639756 16:85334274-85334296 CTGGTGGCCCTGGGCCTCACTGG + Intergenic
1141717992 16:85738035-85738057 TTGGCTTCCCTGGGCCACACTGG - Intronic
1142318397 16:89364578-89364600 TTGACCTCCCTGGGCCACACTGG + Intronic
1142377595 16:89714313-89714335 TTGCCTTCCCTGGGCCACACTGG - Intronic
1142567439 17:849794-849816 CTGCTGTCCCTGGCCCAGCAAGG - Intronic
1143086804 17:4422167-4422189 CTGCATTCCATTGGCCACACAGG - Intergenic
1143236565 17:5406688-5406710 TTGGCTTCCCTGGGCCACACTGG + Intronic
1143691673 17:8572573-8572595 TTGGCTTCCCTGGGCCACACTGG - Intronic
1144471966 17:15551750-15551772 TTGGTTTCCCTGGGCCACAGTGG - Intronic
1144514902 17:15910701-15910723 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1144697449 17:17314619-17314641 CCGCTGTCCCTTGGCCAGGCTGG + Intronic
1144788593 17:17845296-17845318 CTGCTGCCCCTGGGGCAGCCAGG + Intronic
1144854086 17:18258510-18258532 CCGCAGTCCCTGGGACACGCAGG + Intronic
1144924511 17:18792959-18792981 TTGGTTTCCCTGGGCCACAGTGG + Intronic
1145248249 17:21283857-21283879 CTGCTGCCCCTGTTCTACACAGG - Intergenic
1145255969 17:21322584-21322606 CTGCTGGCCCTGGGCACCACAGG + Intergenic
1145320652 17:21765361-21765383 CTGCTGGCCCTGGGCACCATAGG - Intergenic
1145757398 17:27402769-27402791 CTGCTGGGCCTGGTCCACTCCGG + Intergenic
1145883432 17:28367646-28367668 TTGCTGTCCCTGGTGCACAAGGG - Intronic
1146212584 17:30953949-30953971 TTGCCTTCCCTGGGCCACATTGG - Intronic
1146287258 17:31582253-31582275 CTGCTGGGCCTGGGCCAGAGTGG + Intergenic
1146676429 17:34776512-34776534 CAGCTGGGCCTGGGCCACGCTGG - Intergenic
1148052123 17:44774602-44774624 CTGCTGGGCGTGGGCCACACGGG - Intronic
1148952398 17:51325084-51325106 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1149333691 17:55612091-55612113 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1150364259 17:64567589-64567611 TTGGCTTCCCTGGGCCACACTGG + Intronic
1150563504 17:66316603-66316625 TTGGCTTCCCTGGGCCACACTGG - Intronic
1151233137 17:72699187-72699209 TTGGCTTCCCTGGGCCACACTGG + Intronic
1152044815 17:77928977-77928999 CTGCTGTCGAAGGGCCACAAGGG + Intergenic
1152210497 17:79000671-79000693 CTTCTGTCCCCTGACCACACTGG + Intronic
1152427686 17:80227128-80227150 TTGTCTTCCCTGGGCCACACAGG + Intronic
1152512647 17:80800980-80801002 CTGCTGTCCCTGGGCCACACGGG - Intronic
1152707315 17:81851350-81851372 ACGCTGTGCCTGGGCCACCCTGG + Intronic
1152735740 17:81996025-81996047 CTGCAGTCGCTGGGCCTGACCGG + Exonic
1153937848 18:9946551-9946573 CTGGCTTCCCTGGGCCTCACTGG - Intronic
1154967358 18:21373012-21373034 TTGCCTTCCCTGGACCACACTGG - Intronic
1155715646 18:28940281-28940303 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1156355268 18:36335110-36335132 TTGGCTTCCCTGGGCCACACTGG + Intronic
1156806267 18:41185939-41185961 TTGCTGTCCCTTGGGCACAGGGG + Intergenic
1157313605 18:46570663-46570685 TTGGTTTCCCTGGGCCACACTGG + Intronic
1157319822 18:46625410-46625432 TTGGCTTCCCTGGGCCACACTGG + Intronic
1157552307 18:48590229-48590251 CTGCTGCTCTGGGGCCACACTGG + Intronic
1157711006 18:49849746-49849768 CGGCTGCCCATGGGCCGCACTGG - Intronic
1158511682 18:58096000-58096022 TTGGCTTCCCTGGGCCACACTGG - Intronic
1158530544 18:58256256-58256278 CTGCTGCCCCTGGGCCCCGATGG + Intronic
1158976677 18:62716383-62716405 CTGCTGCAGCTGGGCCACAAAGG + Exonic
1159440957 18:68479323-68479345 TTGATTTCCCTGGGCCACATTGG - Intergenic
1159785590 18:72710504-72710526 ATGCTGTGCATGGGCCAGACTGG - Intergenic
1160378004 18:78428796-78428818 GTGGTTTCCCTGGGCCACACTGG + Intergenic
1161046656 19:2138487-2138509 CTGCTGTCGGTGAGCCACTCAGG - Intronic
1161513151 19:4682913-4682935 CCGCTGTCCCGGGGCCGCCCTGG + Intronic
1162139285 19:8576284-8576306 CCACTGTCCCTGGCCCTCACTGG + Intronic
1162158975 19:8697964-8697986 CTGCTGTCCCAGGGGCAGGCCGG + Exonic
1162502031 19:11059646-11059668 CAGCTGTCCAGGGGCAACACAGG + Intronic
1162524196 19:11197812-11197834 CTGCTGTCCCTGGGCCGCTGCGG + Intergenic
1162524942 19:11201645-11201667 CTGGAATCCCTGGGCCACCCTGG + Intronic
1163472768 19:17506890-17506912 CTGCAGTGTCTGGGCCTCACAGG + Intergenic
1164929687 19:32165897-32165919 CTGCTCTCCCAGGTCCACTCGGG - Intergenic
1165091392 19:33389954-33389976 CTGCGCTTCCTGGGCCACAGGGG - Intronic
1165256917 19:34582519-34582541 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1165352818 19:35285559-35285581 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1165700343 19:37932597-37932619 CTCCTGTCCCTGGTCCTCCCAGG - Intronic
1166645491 19:44528509-44528531 CCACTGTGCCTGGGCCCCACTGG + Intronic
1166795658 19:45423888-45423910 CTGCGAGCCCTGGGCCACGCTGG - Intronic
1166953420 19:46445701-46445723 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1167571787 19:50293104-50293126 ATGCTGTCCCTGGGTAACCCTGG - Intronic
1167802381 19:51752753-51752775 TTGCCTTCCCTGGGCCACACTGG + Intronic
1167820492 19:51923182-51923204 TTGGCTTCCCTGGGCCACACTGG - Intronic
1167833261 19:52044930-52044952 TTGGCTTCCCTGGGCCACACTGG + Intronic
1167978007 19:53247301-53247323 TTGGCTTCCCTGGGCCACACTGG + Intronic
924988931 2:294691-294713 TTGGCTTCCCTGGGCCACACTGG + Intergenic
925099944 2:1235714-1235736 AAGCTGCCCCTGGCCCACACTGG + Intronic
925247883 2:2400932-2400954 CTGTCGTCCCTGGGTCCCACAGG - Intergenic
926376227 2:12230682-12230704 TTGGCTTCCCTGGGCCACACTGG + Intergenic
926863163 2:17330290-17330312 TTGGTTTCCCTGGGCCTCACTGG + Intergenic
927326356 2:21810182-21810204 CTTCTGTCCCTGTGCCACAGTGG + Intergenic
927484465 2:23479149-23479171 CTGCTTTCCCTGGCCCACTCTGG + Intronic
927714667 2:25343596-25343618 CTGCTGTCCATGGTCCCCACCGG + Intergenic
927718784 2:25369804-25369826 CAGATGGCCCAGGGCCACACAGG - Intergenic
927727550 2:25438218-25438240 TTGGCTTCCCTGGGCCACACTGG + Intronic
927761879 2:25764346-25764368 CTGGCTTCCCTGGGCCACATTGG + Intronic
928034023 2:27805120-27805142 TTGGCTTCCCTGGGCCACACTGG + Intronic
928121155 2:28584447-28584469 CTCCAGTCACTGGGCCACACAGG + Intronic
928284939 2:29981912-29981934 TTGGCTTCCCTGGGCCACACTGG - Intergenic
928536810 2:32249133-32249155 TTGGTTTCCCTGGGCCACATTGG + Intronic
929389568 2:41454198-41454220 TTGGCTTCCCTGGGCCACACTGG - Intergenic
929655784 2:43730340-43730362 TTGGCTTCCCTGGGCCACACTGG - Intronic
929825610 2:45307287-45307309 CTGCTGTCCTTTGAACACACAGG - Intergenic
929994177 2:46814929-46814951 CTCCTGTGCCTGGGACAGACAGG - Intergenic
930614047 2:53574815-53574837 TTGGCTTCCCTGGGCCACACTGG + Intronic
930676312 2:54204390-54204412 TTGGCTTCCCTGGGCCACACTGG - Intronic
930702326 2:54471023-54471045 TTGGCTTCCCTGGGCCACACTGG - Intronic
930868570 2:56147091-56147113 TTGGCTTCCCTGGGCCACACTGG - Intergenic
930880413 2:56263920-56263942 TTGGCTTCCCTGGGCCACACTGG + Intronic
931488675 2:62720748-62720770 TTGGTTTCCCTGGGTCACACTGG + Intronic
932128921 2:69169760-69169782 CAGCTGTCACTGGTCCCCACGGG - Intronic
932340494 2:70960214-70960236 CAGCTGTCCCTGGGCAGCTCAGG + Intronic
932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG + Intronic
932628503 2:73318354-73318376 TTGCTGTTACTCGGCCACACAGG - Intergenic
932896942 2:75649479-75649501 CTGGCTTCCCTGGGACACACTGG - Intronic
933509163 2:83217876-83217898 TTGGCTTCCCTGGGCCACACTGG - Intergenic
933771165 2:85745059-85745081 CAGCTGTCCCTGGGGCATCCAGG + Intergenic
933992864 2:87646282-87646304 CTACTGGCACTGGGACACACAGG + Intergenic
934109247 2:88726440-88726462 TTGGTTTCCCTGGGTCACACTGG - Intronic
934978262 2:98821512-98821534 TTGGCTTCCCTGGGCCACACTGG + Intronic
935422189 2:102880786-102880808 TTGGCTTCCCTGGGCCACACTGG - Intergenic
936004688 2:108873667-108873689 TTGGCTTCCCTGGGCCACACTGG + Intronic
936052757 2:109237676-109237698 TTGTCTTCCCTGGGCCACACTGG - Intronic
936258832 2:110939862-110939884 TTGGCTTCCCTGGGCCACACTGG - Intronic
936300992 2:111304597-111304619 CTACTGGCACTGGGACACACAGG - Intergenic
936771544 2:115919896-115919918 ATGCTGTACCGGGGTCACACGGG + Intergenic
937134970 2:119544533-119544555 CGGCCGACCCTGGGCCACCCGGG - Intronic
937310523 2:120900032-120900054 CTGCCGGCCGGGGGCCACACTGG + Intronic
937317535 2:120941507-120941529 CTGCTCTCCCAGGGCCTCCCTGG - Intronic
937454189 2:122027115-122027137 TTGGATTCCCTGGGCCACACTGG + Intergenic
937457936 2:122059069-122059091 TTGGCTTCCCTGGGCCACACTGG - Intergenic
937856885 2:126678699-126678721 CTGTTGTCTCTGGGCCACTTTGG + Intronic
938053872 2:128198911-128198933 CAGCTGGCGCTGGGCCACAGGGG - Intergenic
938127648 2:128686128-128686150 TTGCTGTCCCTGGATCAGACTGG + Intergenic
938225680 2:129614351-129614373 TTGGCTTCCCTGGGCCACACTGG - Intergenic
938968399 2:136408329-136408351 CCTCTGTCCCTGGGCCACTTGGG - Intergenic
939792796 2:146600159-146600181 TTGGTTTCCCTGGGCCACATTGG - Intergenic
940221670 2:151359336-151359358 TTGCCTTCCCTGGGCCACATTGG + Intronic
940441023 2:153716432-153716454 TTGGTTTCCCTGGGCCACACTGG - Intergenic
941203025 2:162538300-162538322 TTGGTTTCCCTGGGCCACATTGG - Intronic
941979003 2:171434449-171434471 CAGCTTTCCCTGGGCCCCGCCGG + Exonic
942123441 2:172801132-172801154 CAGCTTTCCCAGGGCCACACAGG + Intronic
942674030 2:178407589-178407611 TTGGCTTCCCTGGGCCACACTGG - Intergenic
942901092 2:181119663-181119685 TTGGCTTCCCTGGGCCACACTGG + Intergenic
942929272 2:181470360-181470382 TTGGTTTCCCTGGGCCATACTGG - Intronic
942961115 2:181830718-181830740 CTGCTCTCCCTGGCACACAGAGG - Intergenic
943326927 2:186510937-186510959 TTGACTTCCCTGGGCCACACTGG - Intergenic
944242883 2:197502314-197502336 TTGGCTTCCCTGGGCCACACTGG - Intronic
945730656 2:213528705-213528727 TTGGCTTCCCTGGGCCACACTGG + Intronic
946132324 2:217616339-217616361 TTGATGTCCCTGTCCCACACAGG - Intronic
946295105 2:218777789-218777811 CTGCTGCCCTTGGGCAACATGGG + Intergenic
947186314 2:227458691-227458713 TTGGCTTCCCTGGGCCACACTGG + Intergenic
947874214 2:233457796-233457818 CTGCAGGGCCTGGGTCACACTGG + Intronic
948085967 2:235248497-235248519 TTGGATTCCCTGGGCCACACTGG + Intergenic
948119538 2:235518898-235518920 CTCCTGTCCTTGGGCCTCAGTGG + Intronic
948647044 2:239411865-239411887 CTGCTGTCTCTCGGCCCCCCAGG - Intergenic
948857194 2:240735644-240735666 CTGCTGTGCCTGGGCCATGGGGG - Intronic
948910382 2:240999504-240999526 CTCCTGGCTCTGGGCCGCACTGG - Intronic
949063973 2:241978350-241978372 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1169026852 20:2379074-2379096 CTGTTATCTCTGGGCCAAACTGG - Intergenic
1169324300 20:4662793-4662815 CTGGCTTCCCTGGGCCACATTGG + Intergenic
1169763039 20:9117681-9117703 CTCCTGTGCCTCGGCTACACTGG + Intronic
1169892525 20:10468955-10468977 TTGGCTTCCCTGGGCCACACTGG + Intronic
1169901765 20:10560252-10560274 CTACAGTCCCCTGGCCACACTGG + Intronic
1171004556 20:21451668-21451690 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1172665074 20:36593500-36593522 CTGATCCCCCTGGGGCACACGGG - Exonic
1173456908 20:43210087-43210109 CTGCTGTACTTTGGCCACAGTGG - Intergenic
1174066534 20:47869734-47869756 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1174256195 20:49257449-49257471 CTGCTGTCCCAGTGCCACAATGG + Exonic
1174327400 20:49790337-49790359 CAGCTGTCCCAGGGCCTCTCAGG - Intergenic
1174541149 20:51290695-51290717 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1175089299 20:56488829-56488851 CTGCTTTCCCTTGGCCTCCCTGG + Intronic
1175152280 20:56944539-56944561 CTGCTCTCCCTAGGACACTCTGG - Intergenic
1175322849 20:58101560-58101582 CTGCTGGCCCCGAGCCACACTGG + Intergenic
1175433531 20:58925991-58926013 TTGCCTTCCCTGGACCACACTGG - Intergenic
1175774822 20:61646496-61646518 CGGCTGGCCCAGGGTCACACAGG - Intronic
1175812234 20:61864560-61864582 CTGGAGTCCCTGAGCCACAGTGG - Intronic
1175920325 20:62447644-62447666 GTTCTGTACCTGGGCCACAGTGG - Intergenic
1176067894 20:63208779-63208801 CTGCTGTGCCTGGGCAGCTCTGG - Intronic
1176082974 20:63283204-63283226 GTGCTGTGCCTGCGGCACACTGG + Intronic
1177777952 21:25590300-25590322 TTGGCTTCCCTGGGCCACACTGG + Intronic
1178161932 21:29928026-29928048 TTGGCTTCCCTGGGCCACACTGG + Intronic
1178401613 21:32290982-32291004 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1178511059 21:33205496-33205518 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1179776937 21:43670746-43670768 TTGCCTTCCCTGGGTCACACTGG - Intronic
1179829802 21:43989462-43989484 CTTCTTGGCCTGGGCCACACAGG - Intergenic
1179831609 21:44000545-44000567 CTGCTGTCCCTGCACCAGCCTGG + Intergenic
1180008557 21:45034722-45034744 CGCCTGTCCCTGAGCCACCCTGG - Intergenic
1180107700 21:45630654-45630676 GTGCAGTTCCTGGGCCAGACGGG + Intergenic
1180137652 21:45871618-45871640 CTGCAGTCCCTGAGCCTAACCGG + Intronic
1180139038 21:45880264-45880286 CTGCTGGCCCTGGGCCTCGGAGG + Intronic
1180940290 22:19656464-19656486 CTGCAGTCCCTGGGTGCCACTGG + Intergenic
1181116464 22:20635133-20635155 CTGTCATCCCTGGGCCACAGTGG + Intergenic
1181342913 22:22197169-22197191 TTGATTTCCCTGGGCCACAATGG - Intergenic
1181346597 22:22223970-22223992 CTCATGTCACTGGGCCACATGGG + Intergenic
1181582253 22:23834850-23834872 CTGCCGTCCCTGGGCCGCCCTGG + Exonic
1181689875 22:24553236-24553258 TTGGCTTCCCTGGGCCACACTGG + Intronic
1181711999 22:24696733-24696755 CTCCTATCCCTGGGCCTCAGGGG - Intergenic
1182520781 22:30883458-30883480 CTGCTGACCCTGGCCCATGCAGG - Intronic
1182872611 22:33661994-33662016 TTGGCTTCCCTGGGCCACACTGG + Intronic
1183720638 22:39559709-39559731 CTGCTGTGCCTGCCCCACAATGG + Intergenic
1183829540 22:40410470-40410492 CTCCTGTCCTAGGGCCACGCTGG + Exonic
1184296218 22:43527178-43527200 CTGGTGCCCCTGGCCCTCACAGG + Intergenic
1184508725 22:44919444-44919466 TTGGTTTCCCTGGGCCACACTGG - Intronic
1184624684 22:45715603-45715625 TTGGCTTCCCTGGGCCACACTGG - Intronic
1185018576 22:48359876-48359898 CTGCTTGCCCAGGGTCACACAGG + Intergenic
1185135136 22:49066053-49066075 CTGGCTTCCCTGGGCCACACTGG + Intergenic
1185207813 22:49550172-49550194 CTTCTGACCCTGGGCCAGAAAGG + Intronic
1185208556 22:49553985-49554007 CCGGTGTCCATGGGCCACACTGG - Intronic
1185208570 22:49554053-49554075 CCGGCGTCCATGGGCCACACTGG - Intronic
1185269190 22:49920854-49920876 CTGCTGTCCCTGGCATGCACTGG + Intronic
949091485 3:34420-34442 TTGGCTTCCCTGGGCCACACTGG - Intergenic
949537891 3:5009978-5010000 CTGCTCTCCCTGGACCACAGTGG - Intergenic
949911219 3:8909760-8909782 TTGGCTTCCCTGGGCCACACTGG + Intronic
950047862 3:9961352-9961374 TTGGCCTCCCTGGGCCACACTGG - Intergenic
950806410 3:15607032-15607054 TTGGCTTCCCTGGGCCACACTGG - Intronic
951083353 3:18479174-18479196 TTGGCTTCCCTGGGCCACACTGG - Intergenic
952300605 3:32101486-32101508 TTGGCTTCCCTGGGCCACACTGG - Intergenic
952690585 3:36200596-36200618 CTTCTGTCCCTAGGCAACAGAGG + Intergenic
952885985 3:38011165-38011187 CTGCAGTCGCAGGGCCGCACTGG - Intronic
952953734 3:38543929-38543951 CAGCTGTCACTGGGTCACTCTGG - Intergenic
953284292 3:41591417-41591439 TTGGCTTCCCTGGGCCACACTGG + Intronic
953413853 3:42704443-42704465 CCGCTGGCCCTGGCCCTCACTGG + Intronic
953657208 3:44863169-44863191 TTGGCTTCCCTGGGCCACACTGG - Intronic
953923821 3:46970357-46970379 CTGGCTTCCCTGGGCCACAATGG - Intronic
954106234 3:48411181-48411203 CTGCTGTCCCTGGGGAAGGCAGG - Intronic
954283623 3:49602246-49602268 CTGCTGCCCCAGGGACACAGAGG - Intronic
954333833 3:49904736-49904758 CTGCTCTCCCAGGGCCATAAGGG + Intronic
954745033 3:52782898-52782920 GTGCTGTCCTGGGGCCACCCTGG + Intronic
955121552 3:56064798-56064820 CTGCAGCCCATGGGCCAAACTGG + Intronic
955330809 3:58045543-58045565 TTGGCTTCCCTGGGCCACACTGG - Intronic
955338692 3:58108037-58108059 TTGCCTTCCCTGGGCCACACTGG + Intronic
955836538 3:63061585-63061607 CTGCTGTCCCTTTGCCAAAGAGG + Intergenic
955926290 3:64008580-64008602 TTGGCTTCCCTGGGCCACACTGG - Intergenic
955943427 3:64168287-64168309 TTGGCTTCCCTGGGCCACACTGG + Intronic
956201349 3:66709567-66709589 ATGCTGTCCCTGTGCCACCGAGG + Intergenic
956217252 3:66861217-66861239 TTGGCTTCCCTGGGCCACACTGG + Intergenic
956624739 3:71256298-71256320 CTGCTGTCCCTGAGCTCTACAGG - Intronic
957031804 3:75250641-75250663 TTGGCTTCCCTGGGCCACACTGG - Intergenic
958599508 3:96277035-96277057 TTGGCTTCCCTGGGCCACACTGG + Intergenic
958810017 3:98850234-98850256 TTGGTCTCCCTGGGCCACAGTGG + Intronic
958900957 3:99886332-99886354 TTGGCTTCCCTGGGCCACACTGG + Intronic
959084985 3:101842669-101842691 TTGGCTTCCCTGGGCCACACTGG - Intronic
959205742 3:103304189-103304211 TTTCTTTCCGTGGGCCACACCGG + Intergenic
960927918 3:122814872-122814894 TTGGATTCCCTGGGCCACACTGG - Intronic
961053718 3:123768532-123768554 CTCCTGGCCCTTGGCCACAGTGG + Intronic
961070651 3:123921665-123921687 TTGGCCTCCCTGGGCCACACTGG + Intronic
961482677 3:127194250-127194272 TTGGCTTCCCTGGGCCACACTGG + Intronic
962361903 3:134749873-134749895 CTTCCAGCCCTGGGCCACACTGG + Intronic
962892192 3:139681642-139681664 TTGCTGTTCCTTGGACACACTGG + Intergenic
962954628 3:140253094-140253116 CTGGTGTACCTGGTCTACACAGG - Intronic
963810867 3:149775098-149775120 CTACTATGCCTAGGCCACACAGG + Intronic
964481200 3:157139955-157139977 CTGGCTTCCCTGGGCCACATTGG + Intergenic
964578703 3:158205743-158205765 CTGGCTTCCCTGGGCCACACTGG + Intronic
964587068 3:158318132-158318154 TTGGCTTCCCTGGGCCACACTGG - Intronic
964842329 3:161007720-161007742 TTGGCTTCCCTGGGCCACACAGG - Intronic
965477544 3:169176028-169176050 TTGGCTTCCCTGGGCCACACTGG + Intronic
965535823 3:169822771-169822793 CTGCTCTACCTGGGAAACACCGG + Exonic
965883915 3:173420747-173420769 TTGGCTTCCCTGGGCCACACCGG - Intronic
966139304 3:176736551-176736573 CTGGCTTCCCTGGGCCACATTGG - Intergenic
966356937 3:179090535-179090557 TTGGTTTCCCTGGGCCACATTGG - Intergenic
966380814 3:179343371-179343393 TTGGCTTCCCTGGGCCACACTGG - Intergenic
968006300 3:195245471-195245493 TTGGCTTCCCTGGGCCACACTGG - Intronic
968179228 3:196578871-196578893 TTGGCTTCCCTGGGCCACACTGG - Intronic
968571772 4:1346079-1346101 CTTCTGTCCCTGGGCGTCAGTGG - Intergenic
968822093 4:2861996-2862018 TTGGCTTCCCTGGGCCACACTGG - Intronic
969392400 4:6900597-6900619 CTGCTGTTCCTGGGCCTCCAGGG + Intergenic
969436921 4:7193777-7193799 TTGCTGTGCCAGCGCCACACAGG - Intronic
969878757 4:10155953-10155975 CTGCTTTCCCTGGGCCACCCTGG + Intergenic
970226503 4:13863840-13863862 CTGGCTTCCCTGGGCCACATTGG - Intergenic
970479683 4:16460360-16460382 CAGCTGTCCCTGAGCTCCACAGG - Intergenic
971283194 4:25259619-25259641 TTGGCTTCCCTGGGCCACACTGG + Intronic
971774429 4:30943798-30943820 TTGGCTTCCCTGGGCCACACTGG - Intronic
972323032 4:37990390-37990412 TTGGCTTCCCTGGGCCACACTGG - Intronic
972529320 4:39947528-39947550 TTGGCTTCCCTGGGCCACACTGG + Intronic
972703548 4:41517328-41517350 CTGCTGTCTCGGGCACACACTGG - Intronic
972976702 4:44644257-44644279 TTGGCTTCCCTGGGCCACACTGG + Intronic
973724723 4:53763913-53763935 CTGCTGTCACTGTGCACCACAGG + Intronic
973954395 4:56049001-56049023 CAGCTGTCCCTGGGCGAAGCCGG + Intergenic
973975950 4:56262590-56262612 TTGGTTTCCCTGGGCCACACTGG - Intronic
973981626 4:56313079-56313101 CTGCATTCCCTGGGCCAGGCTGG + Intronic
975116214 4:70683895-70683917 TTGGTTTCCCTGGGCCACACTGG - Intronic
975608514 4:76180240-76180262 CTGGAGTCCCTGGCCGACACAGG + Intronic
975671822 4:76787649-76787671 TTGGTTTCCCTGGGCCACAGTGG + Intergenic
976433879 4:84994671-84994693 TTGGCTTCCCTGGGCCACACTGG + Intergenic
976718783 4:88150579-88150601 TTGGCTTCCCTGGGCCACACTGG + Intronic
977055522 4:92185574-92185596 TTGGCTTCCCTGGGCCACACTGG + Intergenic
978293468 4:107174635-107174657 TTGGCGTCCCTGGGCCACATTGG - Intronic
979230388 4:118342413-118342435 CTTGTGTCCCTGGACCACACCGG + Intronic
981180255 4:141733691-141733713 TTGATTTCCCTGGGCCACATTGG - Exonic
981372607 4:143976235-143976257 CTGGCTTCCCTGGGCCACACAGG - Intergenic
981467000 4:145084498-145084520 TTGGCTTCCCTGGGCCACACTGG + Intronic
981761615 4:148201269-148201291 CTCCCCTCCCTGTGCCACACTGG - Intronic
982064532 4:151641608-151641630 TTGGCTTCCCTGGGCCACACTGG - Intronic
983305285 4:165976987-165977009 TTGGCTTCCCTGGGCCACACTGG - Intronic
983366189 4:166793362-166793384 TTGGCTTCCCTGGGCCACACTGG + Intronic
983519766 4:168695956-168695978 TTGAATTCCCTGGGCCACACTGG + Intronic
983743521 4:171165498-171165520 TTGGCTTCCCTGGGCCACACTGG - Intergenic
983833287 4:172358596-172358618 TTGGCTTCCCTGGGCCACACTGG - Intronic
983849986 4:172568985-172569007 TTGGCTTCCCTGGGCCACACTGG - Intronic
983926919 4:173412562-173412584 CTGGTGACCATGGGCCACTCAGG - Intergenic
983962337 4:173769920-173769942 CTGCTGCCCCTGTGCCATATTGG - Intergenic
984158227 4:176219942-176219964 TTGGTTTCCCTTGGCCACACTGG + Intronic
984738597 4:183136803-183136825 TTGGTTTCCCTGGGCCACACTGG - Intronic
984965645 4:185137539-185137561 CTGCTGCTCCTGCGCCACATTGG + Intergenic
985281043 4:188285563-188285585 CTGGCTTCCCTGGGCCACAATGG - Intergenic
985720377 5:1485715-1485737 TGGCTGTCCCTGGGCCGCAGCGG - Intronic
985720409 5:1485863-1485885 CAGCTCTCACTGGGCCACAGTGG - Intronic
985726394 5:1518124-1518146 CTCCTGACCCTGGGTCCCACAGG + Intronic
985749559 5:1666546-1666568 TTGGCTTCCCTGGGCCACACTGG + Intergenic
985966548 5:3342579-3342601 CCTCTGGTCCTGGGCCACACCGG + Intergenic
985966577 5:3342727-3342749 CCTCTGGTCCTGGGCCACACCGG + Intergenic
985988372 5:3535996-3536018 CAGCTGACCCTGGGCCTCAAAGG - Intergenic
986733756 5:10653399-10653421 CTGCACTCCCTGAGCCTCACTGG - Intergenic
986769420 5:10958276-10958298 CTGCTGTCCCTGGGCTGAGCTGG + Intergenic
987376056 5:17236098-17236120 TTGGCTTCCCTGGGCCACACTGG - Intronic
987882251 5:23763215-23763237 TTGGCTTCCCTGGGCCACACTGG - Intergenic
988547344 5:32171199-32171221 TTGGCTTCCCTGGGCCACACTGG + Intronic
988659781 5:33252811-33252833 TTGGCTTCCCTGGGCCACACTGG + Intergenic
990312305 5:54551814-54551836 CTGGGGTCCCTGGAGCACACCGG + Intergenic
990788667 5:59452131-59452153 CTGTCTTCCCTGGGCCACAATGG - Intronic
991484605 5:67121594-67121616 TTGTCTTCCCTGGGCCACACTGG + Intronic
991697247 5:69284742-69284764 TTGGCTTCCCTGGGCCACACTGG + Intronic
992240448 5:74764571-74764593 TTGGTTTCCCTGGGCCACACTGG - Intronic
992263432 5:74993206-74993228 CTGATGACCCTGGGCAAGACAGG - Intergenic
992435823 5:76755245-76755267 TTGGCTTCCCTGGGCCACACTGG + Intergenic
992464753 5:76992746-76992768 TTGGTTTCCCTGGGCCACAATGG + Intergenic
993996737 5:94732402-94732424 TTGGCTTCCCTGGGCCACACTGG - Intronic
994471433 5:100212776-100212798 CTTCTGTCCCCTGACCACACTGG + Intergenic
994996677 5:107072512-107072534 TTGGCTTCCCTGGGCCACACTGG + Intergenic
995526827 5:113057003-113057025 CTGATGTCACTGGATCACACAGG - Intronic
995781613 5:115781930-115781952 CTGGCTTCCCTGGGCCACATTGG - Intergenic
996076162 5:119197238-119197260 TTGGCTTCCCTGGGCCACACAGG + Intronic
996357415 5:122612206-122612228 TTGGCTTCCCTGGGCCACACTGG + Intergenic
996827594 5:127702987-127703009 CTGCTTTCCCTGGGACCCGCCGG - Intergenic
996872509 5:128207071-128207093 TTGGTTTCCCTGGGCCACATTGG + Intergenic
996898101 5:128510174-128510196 TTGATTTCCCTGGGCCACACTGG + Intronic
997199182 5:131999486-131999508 CTTCTTTCCCTGGGCCCCACAGG - Intronic
997207200 5:132056907-132056929 CTGCAGTCACTGGGCCTCTCCGG + Intergenic
997604515 5:135164495-135164517 CTGCTGTTCCTGAAACACACTGG - Intronic
997939931 5:138148075-138148097 TTGGCTTCCCTGGGCCACACTGG + Intronic
998143462 5:139712318-139712340 CTGCTATCCCTGAGCCAGAGGGG - Intergenic
998253329 5:140567134-140567156 CTGCTGCCCCTTAGCCACCCAGG + Exonic
998618452 5:143767718-143767740 TTGGCATCCCTGGGCCACACAGG - Intergenic
999258535 5:150223199-150223221 TTGCTGTTCCGGGACCACACTGG + Exonic
999976267 5:156915074-156915096 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1000145980 5:158453754-158453776 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1000320142 5:160128099-160128121 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1000378176 5:160603511-160603533 CTGGCTTCCCTGGGCCACAATGG - Intronic
1000383319 5:160648398-160648420 CTGGCTTCCCTGGGCCACATTGG - Intronic
1000423568 5:161064289-161064311 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1001242391 5:170080508-170080530 CTGCTGTCCCTTGGGCCCTCAGG + Intronic
1002155287 5:177273230-177273252 TTGGCTTCCCTGGGCCACACTGG + Intronic
1002820620 6:721114-721136 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1003270308 6:4602349-4602371 CAGCTGTGCCTGGGCCCCGCAGG - Intergenic
1003285815 6:4733041-4733063 TTCCTGGCTCTGGGCCACACAGG - Intronic
1003403536 6:5810096-5810118 CTGCTGGCCTGAGGCCACACAGG + Intergenic
1003622018 6:7708771-7708793 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1003666461 6:8116130-8116152 CTGGCTTCCCTGGGTCACACTGG + Intergenic
1004174529 6:13328395-13328417 CTCCTGGCCCTGGGCCCCAACGG - Intronic
1004496653 6:16170130-16170152 TTGGTTTCCCTGGGTCACACTGG - Intergenic
1004523340 6:16382743-16382765 TTGGCTTCCCTGGGCCACACTGG + Intronic
1004627397 6:17389887-17389909 TTGGTTTCCCTGGGCCACAGTGG - Intergenic
1005116213 6:22340415-22340437 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1005137256 6:22583927-22583949 CTGATGCCCATGGGCCACATAGG + Intergenic
1005356301 6:24986834-24986856 TTGGCTTCCCTGGGCCACACTGG + Intronic
1005927274 6:30453847-30453869 CCTCAGTCCTTGGGCCACACGGG + Intergenic
1006711746 6:36079418-36079440 CTGGCTTCCCTGGGCCACATTGG + Intronic
1006773103 6:36570210-36570232 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1006850044 6:37091917-37091939 CTAATGTCCCTGGGCCACATGGG + Intergenic
1006892106 6:37437584-37437606 TTGGCGTCCTTGGGCCACACTGG - Intronic
1006925189 6:37650119-37650141 CAGCTGCACCTGGGCCTCACGGG + Exonic
1007163862 6:39814267-39814289 TTGGCTTCCCTGGGCCACACTGG - Intronic
1008060778 6:46994440-46994462 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1008518091 6:52337091-52337113 CTGCTGTCCCAAGACCACTCAGG - Intergenic
1008641453 6:53466747-53466769 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1008895400 6:56548102-56548124 TTGGCTTCCCTGGGCCACACTGG + Intronic
1009269325 6:61598498-61598520 CTTCTGTCTATGGGGCACACTGG - Intergenic
1009915457 6:69989629-69989651 TTGCCTTCCCTGGGCCACATTGG - Intronic
1010056219 6:71568452-71568474 TTGCCTTCCCTGGGCCACACTGG - Intergenic
1010583344 6:77626846-77626868 TTGCCTTCCCTGGGCCACATTGG - Intergenic
1010629170 6:78176368-78176390 TTGTCTTCCCTGGGCCACACTGG + Intergenic
1011103770 6:83756106-83756128 TTGGTTTCCCTGGGCCACATTGG + Intergenic
1011641038 6:89416337-89416359 TTGACTTCCCTGGGCCACACTGG - Intergenic
1012599771 6:101080614-101080636 CCGCAGTCCCTGGTGCACACAGG + Intergenic
1012921662 6:105226406-105226428 CTTCTGTTCCCGGACCACACTGG + Intergenic
1012937910 6:105387525-105387547 TTGGCTTCCCTGGGCCACACTGG + Intronic
1013280050 6:108627620-108627642 TTGGCTTCCCTGGGCCACACTGG + Intronic
1013607382 6:111762720-111762742 TTGTCTTCCCTGGGCCACACTGG + Intronic
1013789598 6:113822015-113822037 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1014107996 6:117588965-117588987 TTGGCTTCCCTGGGCCACACTGG + Intronic
1014517960 6:122402119-122402141 TTGGTTTTCCTGGGCCACACTGG - Intronic
1014676201 6:124369618-124369640 TTGGCTTCCCTGGGCCACACTGG - Intronic
1014927047 6:127284950-127284972 TTGGTTTCCCTGGGCCACACTGG - Intronic
1014937765 6:127404108-127404130 TTGGTTTCCCTGGGCCACACTGG - Intergenic
1015036524 6:128661944-128661966 TTGCCTTCCCTGGGCCACATTGG - Intergenic
1015519335 6:134115091-134115113 CTGCTGTCACTGGGCCAACAGGG + Intergenic
1015681638 6:135814981-135815003 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1015991974 6:138954419-138954441 TTGGCTTCCCTGGGCCACACTGG + Intronic
1016939750 6:149474312-149474334 GGGCTGTCCCCGGGCCACGCTGG + Exonic
1017109080 6:150915336-150915358 TTGGCTTCCCTGGGCCACACTGG - Intronic
1017193787 6:151679773-151679795 CAGCTGTGCCTGGGACACTCCGG + Intronic
1017246358 6:152230857-152230879 TTGGCTTCCCTGGGCCACACTGG + Intronic
1017861049 6:158397630-158397652 TTGGTTTCCCTGGGCCACACTGG - Intronic
1017906395 6:158759961-158759983 TTGGCTTCCCTGGGCCACACTGG - Intronic
1017920972 6:158871564-158871586 TTGGCTTCCCTGGGCCACACTGG - Intronic
1018079338 6:160245587-160245609 CTAGTGTCCCTGGGTCACATAGG + Intronic
1018891504 6:167986233-167986255 CTGCTGGTCAGGGGCCACACTGG + Intergenic
1019373907 7:678625-678647 CTGTTGTGCCTGGGCCACCCAGG + Intronic
1019391685 7:791118-791140 CTCCAGTCCCTGGGGCACTCAGG - Intergenic
1019745930 7:2700390-2700412 CTGCTGTCCATGGGCCACCCGGG - Exonic
1019825141 7:3278421-3278443 TTGGTGTCCGTGGGCCACACTGG + Intergenic
1020205585 7:6112809-6112831 TTGGCTTCCCTGGGCCACACTGG - Intronic
1020260021 7:6526051-6526073 CTGCTGGCTCTGGGACACTCTGG + Intronic
1020354644 7:7263352-7263374 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1020832876 7:13113163-13113185 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1021659815 7:22908787-22908809 CTGGGGGCCTTGGGCCACACTGG + Intergenic
1021732378 7:23608556-23608578 TTGGCTTCCCTGGGCCACACTGG - Intronic
1021911796 7:25392873-25392895 CTTCTGTCCCAGGGCGACACTGG - Intergenic
1023204867 7:37737655-37737677 TTGGCTTCCCTGGGCCACACTGG - Intronic
1023373488 7:39534112-39534134 TTGTCTTCCCTGGGCCACACTGG + Intergenic
1023428556 7:40065379-40065401 TTGGTTTCCCTGGACCACACTGG + Intronic
1024038822 7:45533479-45533501 CGGCTGTCCCAGGCCAACACTGG + Intergenic
1024116117 7:46195505-46195527 CTGCATTCCATGGGCCACAGGGG - Intergenic
1024128259 7:46323166-46323188 ATTCTTTCCCGGGGCCACACTGG - Intergenic
1024605434 7:51019031-51019053 TTGCCTTCCCTAGGCCACACTGG - Intronic
1024725694 7:52191442-52191464 TTGGTTTCCCTGGGCCACATTGG - Intergenic
1027356141 7:77357547-77357569 TTGGGTTCCCTGGGCCACACTGG + Intronic
1027543316 7:79495603-79495625 TTGGCGTCCCTGCGCCACACTGG - Intergenic
1027611237 7:80363598-80363620 TTGGTTTCCCTGGGCCACATTGG - Intergenic
1028935771 7:96462537-96462559 TTGGCTTCCCTGGGCCACACCGG + Intergenic
1030060594 7:105618011-105618033 CTGCTGTCACTGAGCAACATTGG - Intronic
1030308005 7:108038740-108038762 TTGGCTTCCCTGGGCCACACTGG - Intronic
1030567637 7:111179455-111179477 TTGGTTTCCCTAGGCCACACTGG - Intronic
1031110138 7:117597419-117597441 GTGGTTTCCCTGGGCCACATTGG + Intronic
1031281094 7:119800266-119800288 TTGGTTTCCCTGGGCCACATTGG + Intergenic
1031603233 7:123738792-123738814 TTGGTTTCCCTGGGCCACATTGG + Intronic
1032257433 7:130308427-130308449 CTGCTGTCCCTGGGCTCGCCTGG + Intronic
1032267838 7:130381124-130381146 CTTCTGTACCTGGGCCTCATCGG - Exonic
1032317279 7:130850321-130850343 CTGGCTTCCCTGGGCCACATTGG + Intergenic
1032343427 7:131097316-131097338 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1033128359 7:138724437-138724459 CAGCTGCCCCTTGGCCACCCAGG + Intronic
1034182484 7:149148944-149148966 TTGGCTTCCCTGGGCCACACTGG - Intronic
1034840299 7:154389255-154389277 GTGAGGTTCCTGGGCCACACAGG - Intronic
1035459195 7:159028942-159028964 CTGCACACCCTGGGCCACGCCGG - Exonic
1035484063 7:159208714-159208736 GTGGTGTTCATGGGCCACACTGG - Intergenic
1035484078 7:159208835-159208857 GTGGTGTTCATGGGCCACACTGG - Intergenic
1035490705 7:159274613-159274635 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1035812495 8:2504403-2504425 CTGCTGTTCCAGGGCCTCCCTGG + Intergenic
1035842550 8:2828079-2828101 CTGGCTTCCCTGGGCCACACTGG + Intergenic
1036413108 8:8520643-8520665 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1036767910 8:11560612-11560634 CTGCTATCCCTGGCCCAGGCTGG + Intronic
1036957589 8:13205526-13205548 TTGGTTTCCCTGGGCCACATTGG + Intronic
1037441741 8:18923112-18923134 TTGGCTTCCCTGGGCCACACTGG + Intronic
1038651540 8:29408102-29408124 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1038700789 8:29847584-29847606 CTGGTGTCCCAGGGCCAGAGAGG - Intergenic
1039501892 8:38024337-38024359 TTGGCCTCCCTGGGCCACACTGG + Intergenic
1039504094 8:38039234-38039256 CTGGCTTCCCTGGGCCACACTGG - Intronic
1039749836 8:40467736-40467758 TTGGTTTCTCTGGGCCACACTGG - Intergenic
1039821165 8:41136842-41136864 CTCATGTGCCTGGGCCACTCTGG + Intergenic
1040605492 8:48927546-48927568 CTGATGCCCCTGGGGCACTCAGG - Intergenic
1040698652 8:50034635-50034657 TTGGCTTCCCTGGGCCACACTGG + Intronic
1041313931 8:56542512-56542534 CTGCTGTCACTGAGTCCCACCGG - Intergenic
1041644715 8:60239408-60239430 TTGGCTTCCCTGGGCCACACTGG + Intronic
1042211183 8:66382003-66382025 TTGGTTTCCCTGGGCCACATCGG - Intergenic
1042669434 8:71245613-71245635 TTGACTTCCCTGGGCCACACTGG - Intronic
1042951931 8:74209424-74209446 TTGATGTCCCTGGGCCATAACGG - Intergenic
1043576167 8:81660036-81660058 TTGGCTTCCCTGGGCCACACTGG + Intronic
1044367400 8:91365230-91365252 TTGGCTTCCCTGGGCCACACTGG + Intronic
1046094968 8:109546704-109546726 TTGGCTTCCCTGGGCCACACTGG - Intronic
1046764575 8:118055990-118056012 TTGGCTTCCCTGGGCCACACTGG + Intronic
1047279638 8:123434000-123434022 TTGGCTTCCCTGGGCCACACTGG - Intronic
1047628402 8:126679725-126679747 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1047692152 8:127366786-127366808 CTGCTCTCTCTGGGCCTAACGGG + Intergenic
1047747455 8:127855502-127855524 CTGCTGGCCCTGGCAGACACTGG + Intergenic
1048099899 8:131339694-131339716 CTGCTTACCATGTGCCACACAGG + Intergenic
1048603485 8:135943595-135943617 CTGCTGTCCCTGCACCACCATGG - Intergenic
1048787331 8:138063961-138063983 CTGCTGTCCCTTACCCACACAGG - Intergenic
1049010822 8:139885998-139886020 CTTCTGTCCCTGGGCTCCGCAGG - Intronic
1049092981 8:140530675-140530697 CTGCTATCCTTGGGCCTCCCAGG + Intergenic
1049161334 8:141099794-141099816 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1049261658 8:141642214-141642236 CTGCGGTCCCTGGGCCTCGCAGG - Intergenic
1049585971 8:143432519-143432541 CTGGAGGCCCTGGGGCACACTGG + Intergenic
1049612858 8:143563460-143563482 CTGCCCTCCTGGGGCCACACAGG + Intergenic
1049676853 8:143893266-143893288 CTGCTGTCCCTGTGGTAGACAGG - Intergenic
1049680346 8:143915367-143915389 CTGGTGTCCCTGGGCCCAAAGGG + Exonic
1049719512 8:144109149-144109171 ATGGTGTTCGTGGGCCACACAGG + Exonic
1049818448 8:144619423-144619445 CTGCTGTCTCAGGGACACACGGG - Intergenic
1050203932 9:3177807-3177829 CTTCTGTCCCTGACCCACCCAGG + Intergenic
1050749479 9:8920502-8920524 TTGGCTTCCCTGGGCCACACTGG + Intronic
1050974618 9:11921510-11921532 CTGGCTTCCCTGGGCCACACTGG - Intergenic
1051123828 9:13781131-13781153 CTGGTTTCCCTGGGCCACACTGG - Intergenic
1051231824 9:14963258-14963280 CTCATTTCCCTAGGCCACACTGG + Intergenic
1052035053 9:23670965-23670987 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1053189425 9:36049433-36049455 TTGGCTTCCCTGGGCCACACTGG + Intronic
1053445214 9:38147302-38147324 TTGGTCTCCCTGGGCTACACTGG - Intergenic
1055110832 9:72557660-72557682 CTGCTGTCCCTGACACACATTGG - Intronic
1055130723 9:72771115-72771137 TGGGTTTCCCTGGGCCACACAGG - Intronic
1055313348 9:75008094-75008116 TTGGCTTCCCTGGGCCACACTGG + Intronic
1055761626 9:79614884-79614906 TTGGCTTCCCTGGGCCACACTGG - Intronic
1056125777 9:83535695-83535717 CTGGCTTCCCTGGGCCACATTGG - Intronic
1056136317 9:83632476-83632498 TTGGCTTCCCTGGGCCACACTGG + Intronic
1056342126 9:85646850-85646872 TTTGTTTCCCTGGGCCACACTGG + Intronic
1056871026 9:90278874-90278896 TTGGTTTCTCTGGGCCACACTGG - Intergenic
1057031906 9:91782501-91782523 TTGGCTTCCCTGGGCCACACTGG + Intronic
1057167446 9:92940258-92940280 TTGCTGCACCAGGGCCACACAGG - Intergenic
1057252986 9:93519000-93519022 TTGGCATCCCTGGGCCACACTGG - Intronic
1057474473 9:95386974-95386996 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1057515577 9:95717580-95717602 GTGGCTTCCCTGGGCCACACTGG + Intergenic
1057741204 9:97712890-97712912 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1058033337 9:100223957-100223979 TTGGCTTCCCTGGGCCACACTGG + Intronic
1058050989 9:100406252-100406274 TTGGTTTCCCTGGGCCACATTGG + Intergenic
1059347707 9:113641430-113641452 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1059521375 9:114945424-114945446 TTGGCTTCCCTGGGCCACACTGG + Intergenic
1060200602 9:121650093-121650115 TTGGCTTCCCTGGGCCACACTGG - Intronic
1060625946 9:125111638-125111660 TTGGCTTCCCTGGGCCACACTGG - Intronic
1060931058 9:127489826-127489848 CTGCTGTCCCTGCTCCAGGCAGG + Intronic
1061034456 9:128105982-128106004 CTGCTGTCCCTGGGGTACCACGG - Intronic
1061358050 9:130121249-130121271 TTGGCTTCCCTGGGCCACACTGG + Intronic
1061443621 9:130624715-130624737 TTGGCTTCCCTGGGCCACACTGG - Intronic
1061505643 9:131030421-131030443 TTGCTGTCTCTGGGCCCCACTGG + Intronic
1061568207 9:131458381-131458403 TTGGCTTCCCTGGGCCACACTGG + Intronic
1061621490 9:131813995-131814017 CTGGGGTCCCTCGGCCTCACGGG - Intergenic
1062132751 9:134908758-134908780 CTGGAGTCCCTGGGCCTTACTGG - Intronic
1062278675 9:135742436-135742458 CTCCTGTGCCTGGGCCAGATGGG - Intronic
1062279498 9:135745668-135745690 CTGCTGTCCTCGGGACACGCCGG + Intronic
1062283576 9:135763013-135763035 CTGCTCTGCCTGCCCCACACGGG - Intronic
1062635407 9:137487921-137487943 CAGCTGAGCCTTGGCCACACGGG + Intronic
1185764009 X:2709916-2709938 CATCTGTCCCTGGGCCTCAGGGG - Intronic
1185804738 X:3046881-3046903 TTGGCTTCCCTGGGCCACACTGG + Intronic
1187027041 X:15446386-15446408 ATGGATTCCCTGGGCCACACTGG + Intronic
1187143185 X:16614019-16614041 TTGGCTTCCCTGGGCCACACTGG + Intronic
1188585479 X:31769521-31769543 TTGGCTTCCCTGGGCCACACTGG + Intronic
1188745704 X:33839931-33839953 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1189113074 X:38313978-38314000 TTGGCTTCCCTGGGCCACACTGG + Intronic
1189156757 X:38765572-38765594 TTGGTTTCCCTGGGTCACACTGG + Intergenic
1189706908 X:43767937-43767959 CTGCTGTGCCTTTGCCACAATGG + Intronic
1189720905 X:43916374-43916396 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1190393308 X:49954417-49954439 TTGGCTTCCCTGGGCCACACTGG - Intronic
1191891651 X:65949710-65949732 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1192482102 X:71494537-71494559 TTGGCTTCCCTGGGCCACACTGG - Intronic
1192759913 X:74086203-74086225 CTGCAGCTACTGGGCCACACTGG + Intergenic
1193121194 X:77824351-77824373 CTGGCTTCCCTGGGCCACATTGG + Intergenic
1193331622 X:80241057-80241079 CTGGGGTCCCTTGGCCACAGTGG - Intergenic
1194206823 X:91019893-91019915 CTGCTATCCATGGGCCAGGCAGG - Intergenic
1195068402 X:101257710-101257732 CTGCAGGCCCTGGGAAACACTGG + Intronic
1196137858 X:112229574-112229596 TTGCCTTCCCTGGGCCACATTGG + Intergenic
1196783775 X:119404740-119404762 TTGGTTTCCCTGGGTCACACTGG + Intronic
1198125412 X:133638739-133638761 TTGGCTTCCCTGGGCCACACTGG + Intronic
1198256433 X:134927808-134927830 TTGGCTTCCCTGGGCCACACTGG - Intergenic
1199084787 X:143616097-143616119 CTGCTGTCGCTCAGCAACACTGG + Intergenic
1200035067 X:153321438-153321460 CTGCGGGCCCTGGGCCGGACCGG + Intergenic
1200166626 X:154040031-154040053 CTACTGTCCCTGGGGCACTGAGG - Intronic
1200552574 Y:4594682-4594704 CTGCTATCCATGGGCCAGGCAGG - Intergenic
1200743091 Y:6876792-6876814 CTGCTGCCACTGGGCCAAAAAGG + Intergenic
1200818113 Y:7554853-7554875 CTTCTCTCCGTGGGTCACACAGG - Intergenic
1202378004 Y:24255636-24255658 CTGCTGCCCCTGGGCCACTCTGG + Intergenic
1202492778 Y:25414485-25414507 CTGCTGCCCCTGGGCCACTCTGG - Intergenic
1202604578 Y:26627677-26627699 TTGGTTTCCCTGGGCCACAATGG + Intergenic