ID: 1152513007

View in Genome Browser
Species Human (GRCh38)
Location 17:80803082-80803104
Sequence CAGGATAAACAGATCCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152513007_1152513013 15 Left 1152513007 17:80803082-80803104 CCTCCTTGGATCTGTTTATCCTG 0: 1
1: 0
2: 1
3: 17
4: 220
Right 1152513013 17:80803120-80803142 TGCCGTTGTTCCTATGTGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152513007 Original CRISPR CAGGATAAACAGATCCAAGG AGG (reversed) Intronic
900821433 1:4892347-4892369 CAGGATGAACACACACAAGGTGG + Intergenic
901752463 1:11419153-11419175 CAGGAAGAACAGGTTCAAGGAGG - Intergenic
903517393 1:23920823-23920845 CAGGACATACACATCAAAGGTGG - Intergenic
906137714 1:43511396-43511418 TAGGACAAACAGATGGAAGGTGG - Intergenic
909125709 1:71666471-71666493 CTGCAGTAACAGATCCAAGGTGG - Intronic
909962545 1:81864631-81864653 CAGAAAAATCAAATCCAAGGAGG - Intronic
911118623 1:94272447-94272469 CTGGATAACCAGGTGCAAGGAGG + Intronic
915483595 1:156204435-156204457 CAGAATAGACAGGCCCAAGGAGG + Intronic
915506665 1:156361345-156361367 CAGGATCACCAGAGCCCAGGAGG + Intronic
918480285 1:184970735-184970757 TGGGATAAACAGATCCTAGTGGG - Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
919266154 1:195269115-195269137 AATAATAAACAGATCCAAGTAGG - Intergenic
919614140 1:199784297-199784319 CAGGAAATACAGATCAAAGCAGG + Intergenic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
920384044 1:205555174-205555196 CAGGAAAAAGAGAGCAAAGGAGG + Intergenic
923783466 1:237045514-237045536 AAAGATAAACAGACCCAAGTGGG - Intronic
1062773571 10:125583-125605 CAGGAGAGAGAGAGCCAAGGGGG - Intergenic
1067541692 10:47159672-47159694 CAGGATAGAGAGTTCCAATGCGG - Intergenic
1067664770 10:48267934-48267956 CAGAATAAACAAATCCATAGAGG + Intronic
1069239120 10:66116819-66116841 CAGGAGAGACAGAGCCAAGGGGG + Intronic
1070485693 10:76928910-76928932 CAGGCAAAACAGCTCCAAGAGGG + Intronic
1070912500 10:80130921-80130943 CAGGAGAATCAGAACCCAGGAGG - Intergenic
1071320386 10:84449386-84449408 CAGAATAGACAATTCCAAGGTGG + Intronic
1071981947 10:91012351-91012373 CAGGACAGACAGATTGAAGGAGG - Intergenic
1072298244 10:94033722-94033744 CAGGATAAAAAAATCCAAGATGG - Intronic
1072943572 10:99789223-99789245 CTGAATAAATAGATCCACGGAGG + Intronic
1073687496 10:105771350-105771372 CAGGAAAAACAGAACAAAAGAGG + Intergenic
1074878317 10:117631842-117631864 CTGGATAGGCAGGTCCAAGGGGG + Intergenic
1075414199 10:122250293-122250315 CTTGAGAAACACATCCAAGGAGG - Intronic
1075839919 10:125492738-125492760 CTGAATAAAGAGATCAAAGGAGG + Intergenic
1075989359 10:126821688-126821710 AAGGATAATCAGATACAAAGAGG + Intergenic
1076642622 10:131929153-131929175 CAGGAGACAGAAATCCAAGGGGG - Intronic
1079367459 11:19821733-19821755 CAGGACTAACAGACCCAAGAGGG - Intronic
1079707262 11:23636805-23636827 CAGGATAGAGAGATCAAAGTGGG + Intergenic
1079845834 11:25466616-25466638 CAGCAAAAACAGAACCAAGAGGG + Intergenic
1080496456 11:32825185-32825207 GAGGATAAACAGATCCTGGTTGG + Intergenic
1080898285 11:36463764-36463786 CAGGATAAAGAGATCCATGGTGG + Exonic
1084114141 11:67031961-67031983 CATGACAAAGAGATCCATGGAGG - Intronic
1084854082 11:71969650-71969672 GAGGATCAACAGAGCCCAGGAGG - Intronic
1085016051 11:73174702-73174724 CTGGATAATCAGAACCAAAGGGG + Intergenic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1086955803 11:92933659-92933681 CATGAAAAAGAAATCCAAGGTGG + Intergenic
1088740799 11:112765365-112765387 CAGGAGACACATCTCCAAGGTGG + Intergenic
1089841341 11:121420724-121420746 CAGGATAAACCCATGCAATGTGG + Intergenic
1090334282 11:125952134-125952156 CAGGATAAAGAGATCTTAGGGGG + Intergenic
1091445391 12:541933-541955 TAGGAGATACAGATCCCAGGAGG - Intronic
1092355665 12:7792965-7792987 CTGAATAAGCAGATCCATGGAGG - Exonic
1095212241 12:39507852-39507874 CATGATTAGCAGAGCCAAGGTGG - Intergenic
1095541678 12:43316361-43316383 CAGGATAAACAAAACCAATATGG + Intergenic
1097783942 12:63738316-63738338 CAGCAGAACGAGATCCAAGGAGG + Intergenic
1098207129 12:68123000-68123022 CAGCAAAAACAGTTCCAAGAGGG - Intergenic
1099073390 12:78075047-78075069 CAGGATTACAGGATCCAAGGAGG - Intronic
1099830257 12:87833125-87833147 CAGGAGAGACAGAGCAAAGGGGG - Intergenic
1101853795 12:108425532-108425554 CAGGACAAACAGACTCAGGGAGG + Intergenic
1102487440 12:113267850-113267872 CAGGGCAAACAGCTCCAGGGTGG - Exonic
1102995757 12:117349165-117349187 CAGAATAGACAAATCCACGGAGG - Intronic
1103601417 12:122057036-122057058 CAGGATAAGCAGACACAAGTAGG + Intronic
1105998076 13:25692132-25692154 CAGGAGAAAGAGATTCACGGAGG + Intronic
1107554058 13:41502173-41502195 CAGGAAAAGAAGATCCCAGGTGG + Intergenic
1108159605 13:47624642-47624664 TAGGAGAAATAGATCAAAGGAGG - Intergenic
1108612553 13:52097993-52098015 CAGGAGAAAGAGAGCAAAGGGGG - Intronic
1110013578 13:70370370-70370392 AAGGATAAAGAGATTTAAGGAGG - Intergenic
1112218455 13:97460950-97460972 CCGGAGAAACTGATCAAAGGAGG - Intronic
1112797704 13:103074752-103074774 TAGGAAATAGAGATCCAAGGAGG - Intergenic
1113773444 13:112927760-112927782 CATGATAAACACCTCCAAGGGGG + Intronic
1114360687 14:21968841-21968863 CAGGAAGAACAGAACCAAGTTGG + Intergenic
1114582505 14:23775407-23775429 AAGGGAAAATAGATCCAAGGAGG + Intergenic
1117169917 14:53083926-53083948 CAGGATGAATGAATCCAAGGTGG - Intronic
1119086911 14:71747478-71747500 CAGTATTAATAGATCCAAGCTGG + Intergenic
1119199085 14:72739966-72739988 GAGGAAAAACAGAGCCAAGGAGG + Intronic
1120230692 14:81837472-81837494 CAGGATAAAGAGAGTTAAGGGGG - Intergenic
1120577987 14:86207768-86207790 CAGGAGAAAGAGAGCGAAGGGGG + Intergenic
1120641519 14:87019167-87019189 CAGGATATACAGAGCAAAGAGGG + Intergenic
1122034919 14:98940974-98940996 CACACTAAACAGAGCCAAGGTGG - Intergenic
1122356101 14:101123892-101123914 CAGGATGCGCAGAGCCAAGGGGG + Intergenic
1125032300 15:35084922-35084944 CTGAATAAGCAGATCCATGGAGG + Intergenic
1125623387 15:41084827-41084849 CAGGATAGATAGAGCCCAGGAGG - Intronic
1127682584 15:61311982-61312004 CAGGATTAAGAGAACCAAGTAGG + Intergenic
1127916678 15:63460655-63460677 CAGGAACCACAGATCCAGGGAGG - Intergenic
1129678993 15:77647342-77647364 CAGGAAGATCTGATCCAAGGTGG + Intronic
1134444159 16:14318204-14318226 CAGAATAAACAAATCCACAGGGG - Intergenic
1136665846 16:31811568-31811590 CAGCAAAAACACATCCCAGGAGG - Intergenic
1137693964 16:50448860-50448882 CAGGATTAGCAGATCAAGGGAGG - Intergenic
1137887274 16:52118786-52118808 CAGGATAAATGGAGCCAAAGTGG + Intergenic
1138472912 16:57252422-57252444 CAGGATAAATAGGTCCAGGAGGG - Exonic
1138783532 16:59817585-59817607 CAGCAAAAACAGTTCTAAGGGGG + Intergenic
1139699858 16:68701508-68701530 CAGGAGAAACAGATCCTGGAAGG - Intronic
1140869846 16:79096372-79096394 CAGGAAGAACAGAGCCAATGGGG - Intronic
1143323415 17:6082513-6082535 CAGCATAAACAGCTCCAACCCGG - Intronic
1143902405 17:10184118-10184140 CAGGAAAAACATATGCAACGGGG - Intronic
1147268776 17:39251876-39251898 CAGAATAAACAGATGTAAAGTGG + Intergenic
1148197932 17:45728223-45728245 CAGGATAGACAGACACAGGGAGG - Intergenic
1152513007 17:80803082-80803104 CAGGATAAACAGATCCAAGGAGG - Intronic
1152584450 17:81182764-81182786 CAGGACAAACAGCTCCAGCGTGG + Intergenic
1152846038 17:82600260-82600282 CCAGAGAAACAGAGCCAAGGCGG + Intronic
1154411207 18:14143185-14143207 CAGGGTACCCAGATCCCAGGTGG + Intergenic
1155875398 18:31080665-31080687 CAGGAGAGACAGAGCAAAGGGGG - Intronic
1156759817 18:40574892-40574914 CAGGAGAGACAGAGCAAAGGGGG + Intergenic
1157615569 18:48985558-48985580 CAGGAGAAAAAGGTGCAAGGAGG - Intergenic
1159703195 18:71655453-71655475 CATGATCAACAACTCCAAGGAGG + Intergenic
1161836057 19:6647435-6647457 CCAGAGAAACAGAACCAAGGAGG - Intergenic
1164642685 19:29837992-29838014 CTGGAGAGAGAGATCCAAGGTGG + Intergenic
1166854067 19:45774044-45774066 CAGGAGAATCAGAACCCAGGAGG - Intronic
926880058 2:17535697-17535719 GGGGAAGAACAGATCCAAGGAGG + Intergenic
928239235 2:29572197-29572219 CAGGATAAACAAATCCAAAATGG - Intronic
928795028 2:35007773-35007795 CAGGATAAACAGGTGAAAGGAGG + Intergenic
930540750 2:52703569-52703591 CAGAATAAAAAGATCACAGGAGG - Intergenic
931415825 2:62079305-62079327 CAGGATAAAAAGATCATGGGGGG + Intronic
933469414 2:82702261-82702283 CAGGATACACAGTTCCAAAAGGG + Intergenic
934523669 2:95035333-95035355 CAGGATAAACAGAAACCAAGAGG - Intronic
935115975 2:100136597-100136619 ATGGATAAACAGATCAATGGGGG - Intronic
940051027 2:149464927-149464949 GAAGATAAAAAGATGCAAGGGGG + Intronic
941597993 2:167502592-167502614 CAGGAGAAAGAGAGCAAAGGGGG + Intergenic
946369138 2:219270044-219270066 CAGCACAAACACATCCAAGCAGG + Intronic
948108017 2:235430611-235430633 TAGGTAAAACAGGTCCAAGGCGG - Intergenic
1171721242 20:28565195-28565217 AAGGACACACAGATACAAGGAGG - Intergenic
1171756826 20:29118368-29118390 AAGGACACACAGATACAAGGAGG + Intergenic
1171862874 20:30417631-30417653 AAGGACACACAGATACAAGGAGG + Intergenic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1173561084 20:44006221-44006243 CAGGAAAGATGGATCCAAGGTGG + Intronic
1174193366 20:48756015-48756037 AGGGATACACATATCCAAGGAGG - Intronic
1175913964 20:62417104-62417126 CAGGATAAACTGAACCAGGAAGG - Intronic
1176861849 21:14015232-14015254 CAGGGTACCCAGATCCCAGGCGG - Intergenic
1177846960 21:26300713-26300735 CAGGAGAAAGAGAGCAAAGGGGG + Intergenic
1179111340 21:38448420-38448442 CAGGATAAACACTTCAAAAGAGG + Intronic
1179719560 21:43307462-43307484 CAGGAGAACCAGCTCCGAGGTGG - Intergenic
1181402987 22:22662636-22662658 CAGGATATACAGATTGGAGGTGG - Intergenic
1182247295 22:28969314-28969336 CAAGATAAACATATCTACGGGGG - Intronic
1184632201 22:45790790-45790812 CAGGATAAAAAGATATAAAGAGG - Intronic
1185367012 22:50441408-50441430 CAGGGTACCCAGATCCCAGGCGG - Intronic
950245970 3:11418874-11418896 CAGGAGAAAGAGAGCAAAGGGGG + Intronic
951455795 3:22890846-22890868 AAAGATAAACAGATCCAAAGAGG + Intergenic
952255337 3:31690259-31690281 CAGGAGAAAGAGAGCAAAGGGGG - Intronic
952574710 3:34760383-34760405 CATGAAAAACAGAACCAAGTTGG + Intergenic
956020516 3:64928679-64928701 CAGGAAAAAAAAATCCAACGTGG + Intergenic
956441770 3:69287776-69287798 CAGGAAAAACAGCTCCACGGTGG + Exonic
956561482 3:70581126-70581148 CATGATAAACAAATGCAATGTGG + Intergenic
957360905 3:79156191-79156213 AAGGACAAACAGTTCCAAGAGGG - Intronic
959279083 3:104315657-104315679 CAGGAGAGAGAGATCTAAGGAGG + Intergenic
959433263 3:106282012-106282034 TTGAATAAACAGATCCAAGTGGG - Intergenic
959934107 3:112012093-112012115 CAGGAGAAACAGAACCTGGGTGG - Intronic
961186196 3:124917434-124917456 CAGGATAAGCTGAGCCCAGGAGG - Intronic
961348196 3:126278548-126278570 TAGGATATAGGGATCCAAGGGGG + Intergenic
961738323 3:129016083-129016105 CAGAATAAACTGAGCCCAGGCGG + Intronic
962635072 3:137322875-137322897 CAGGAGAAAGAGAGCAAAGGGGG + Intergenic
966972949 3:185061873-185061895 CAGGAGAGAAAGATCAAAGGGGG - Intergenic
967935642 3:194725394-194725416 CAAGATAAAGAGATCCAGAGAGG + Intergenic
968343215 3:197976920-197976942 CAAGATAAACAGGGGCAAGGAGG - Intronic
974177477 4:58343280-58343302 GAGCATAAACAGATGTAAGGAGG + Intergenic
975301232 4:72793557-72793579 CAGGAAATACATAACCAAGGAGG + Intergenic
975682683 4:76892452-76892474 CAGGACAAACACCTCCAAGCTGG - Intergenic
976636124 4:87287754-87287776 CAGGAGAGACAGAGCAAAGGGGG - Intergenic
977175103 4:93810047-93810069 GAGAATAGACAGATCCAAGCTGG + Intergenic
981490174 4:145331212-145331234 CAGGAGGAGCAGGTCCAAGGTGG - Intergenic
982353461 4:154442355-154442377 CAGGATATACAGAGCCATGTAGG - Intronic
982416985 4:155145520-155145542 CAGGAAAAAAAGAGCCATGGAGG + Intergenic
983128867 4:163989047-163989069 CAGGATAAACAAAAACAAAGCGG - Intronic
984182790 4:176505964-176505986 CAGTAGAAACAGACCCATGGTGG - Intergenic
984255411 4:177384384-177384406 GAGGATAAACAGAACTAAGGAGG + Intergenic
985370569 4:189281575-189281597 AAGGACACACAGATACAAGGAGG - Intergenic
988133180 5:27133540-27133562 CATGGGAAACAGATCCAAGTGGG + Intergenic
989336504 5:40323390-40323412 CAGGAGAAAGAGAGCAAAGGGGG + Intergenic
989750922 5:44892592-44892614 CACGTTAAAAAGATCCAAGTGGG - Intergenic
990112398 5:52343684-52343706 CAGGATAGACAGAAACAATGAGG + Intergenic
994747895 5:103701909-103701931 CACAATAAACACATCCAAGGTGG + Intergenic
995042905 5:107609426-107609448 CAGGAGAGAAAGATCAAAGGAGG - Intronic
996017171 5:118552598-118552620 CAGGATAATCAGAGCCACTGGGG + Intergenic
996171084 5:120292532-120292554 CAGTAGAAAAAGATCAAAGGGGG - Intergenic
998277101 5:140766631-140766653 CAGGAGAAAGAGAGCAAAGGGGG + Intergenic
999102755 5:149040361-149040383 CAGGACACACAGATGCTAGGGGG - Intronic
999700527 5:154223828-154223850 GAGGATCACCAGATCCTAGGAGG + Intronic
999729622 5:154466954-154466976 CAATTTAAACAGTTCCAAGGGGG + Intergenic
1000422362 5:161053417-161053439 CAGGAGAAAGAGAGCAAAGGTGG + Intergenic
1001981883 5:176043728-176043750 GAGGATCAAGAGGTCCAAGGTGG - Intergenic
1002235582 5:177800329-177800351 GAGGATCAAGAGGTCCAAGGTGG + Intergenic
1003517326 6:6827800-6827822 GAGGATCAACTGATCCTAGGAGG + Intergenic
1004497283 6:16176328-16176350 CAGGAGAAAGAGAGCAAAGGTGG - Intergenic
1005089761 6:22043876-22043898 CTTGATAAACAGAGTCAAGGTGG + Intergenic
1007018225 6:38490990-38491012 CAGAATAAAAAGATCCAAAAGGG + Intronic
1011016467 6:82761206-82761228 AGGAATAAACAGATCCAAGTTGG + Intergenic
1011111443 6:83841125-83841147 CAGGATAAATTGATCCACTGTGG - Intergenic
1013078552 6:106792227-106792249 CTGGATAAACAGATGCACAGGGG + Intergenic
1013487015 6:110606930-110606952 CAGGAGGAAGAGATCGAAGGGGG + Intergenic
1014097119 6:117472540-117472562 CAGATTAAACAGACCTAAGGTGG + Intronic
1016138775 6:140582318-140582340 CAGGATATATAAAGCCAAGGTGG + Intergenic
1016416766 6:143842019-143842041 TAGAATTAAAAGATCCAAGGGGG - Intronic
1018547470 6:164953329-164953351 CAAGATAAGCCCATCCAAGGTGG + Intergenic
1021734128 7:23626428-23626450 TAGGATAAACAGCTCAAAAGAGG - Intronic
1021790251 7:24197441-24197463 CAGGATAAACGGAAACAAGGAGG - Intergenic
1021874068 7:25032236-25032258 CAGGATGAAAAGAGCCAAGGGGG - Intergenic
1022312728 7:29212466-29212488 CTGAATAAGCAGATCCATGGAGG - Intronic
1031263015 7:119547044-119547066 CAAGATAAACATATCCAGTGCGG + Intergenic
1031522694 7:122785761-122785783 CAGGATAAAGAGCTCCAGAGGGG - Intronic
1032561228 7:132895165-132895187 CAGGTTAAAGAAATCCAATGAGG + Intronic
1033343239 7:140507980-140508002 GAGGATCAACAGATACAAGAAGG + Intergenic
1034109657 7:148524217-148524239 TAGGATAAACTGCTCCAAGTGGG - Intergenic
1034485880 7:151362069-151362091 CAGGATAAAAAGATTGAGGGAGG - Intronic
1034737542 7:153443019-153443041 CAGGAGAGACATATCCAAGGTGG + Intergenic
1035453366 7:158993395-158993417 CAGCTGAAACAGATCCAAGAAGG - Intergenic
1037083882 8:14822263-14822285 AAGAATAAACTTATCCAAGGAGG + Intronic
1037528578 8:19751766-19751788 CAGGAGAGAGAGAGCCAAGGGGG - Intronic
1043217055 8:77605240-77605262 CAGGAAAAATGGAACCAAGGTGG + Intergenic
1043740726 8:83808277-83808299 CAGGAGAAAAAGATCAAGGGTGG - Intergenic
1045706079 8:104924738-104924760 CAGGAAAAACTTATCCTAGGTGG + Intronic
1045922591 8:107548481-107548503 CAATATAAACAAATACAAGGAGG - Intergenic
1046706386 8:117457112-117457134 AAGGATAAACTTAACCAAGGAGG + Intergenic
1049829406 8:144690732-144690754 GAGGATCACCAGAGCCAAGGAGG - Intergenic
1056115539 9:83437936-83437958 CAGGATAAAAAGAGAGAAGGGGG + Intronic
1057117970 9:92543761-92543783 AAGAATAAACATAACCAAGGAGG - Intronic
1058395348 9:104546627-104546649 CAGGATAAATTTAGCCAAGGAGG + Intergenic
1059221440 9:112624366-112624388 CATGTTAACCAGATCCAAGTGGG - Intronic
1059444026 9:114327229-114327251 CAGGAGAGACAGAGCGAAGGGGG - Intergenic
1059445233 9:114334008-114334030 CAGGAGAGACAGAGCGAAGGGGG - Intergenic
1203394802 Un_KI270512v1:15440-15462 CAGGAGAACCAGAGCCAAGATGG - Intergenic
1203608471 Un_KI270748v1:75537-75559 CAGCTAAACCAGATCCAAGGAGG - Intergenic
1186656200 X:11614441-11614463 CAGGAGAGAGAGAACCAAGGGGG + Intronic
1187054992 X:15734498-15734520 CAGGAAAAACATATCTAAAGAGG + Intronic
1187768162 X:22666200-22666222 CAGGATAAACATATCTCTGGAGG + Intergenic
1188298438 X:28479331-28479353 CAGCAAAAGCAGTTCCAAGGGGG - Intergenic
1189670981 X:43408372-43408394 CTGGATAAGCAGATCCATGGCGG + Intergenic
1190092707 X:47453448-47453470 CAGAATAAACAGATTCAGGGAGG + Intronic
1190923008 X:54874786-54874808 CAGAATAAACTTATCCGAGGTGG - Intergenic
1191029837 X:55957605-55957627 AAGGATAAACCTAACCAAGGAGG - Intergenic
1191771876 X:64769401-64769423 CAGCATATGCAGATCTAAGGTGG - Intergenic
1191873820 X:65773445-65773467 CTGAATAAGCAGATCCATGGAGG + Intergenic
1192260220 X:69501714-69501736 CAGGAAAGACAGTTCCTAGGTGG + Intergenic
1193407238 X:81117168-81117190 CATGAGAAACAGAGCCAAGGAGG + Intronic
1194007732 X:88517746-88517768 CAGGGTAAACAGATATAATGAGG - Intergenic
1194835065 X:98672085-98672107 CAGGATAGAGAGAGCAAAGGGGG + Intergenic
1194930558 X:99882059-99882081 CAGGGAAAACAGAACCAAGCTGG + Intergenic
1197258855 X:124294459-124294481 CAGGAGAGAGAGAACCAAGGGGG - Intronic
1197338394 X:125235647-125235669 CAGGAACAAGAGAGCCAAGGGGG - Intergenic
1197594999 X:128454194-128454216 CAGGAGAAAGAGAGCAAAGGGGG + Intergenic
1199193834 X:145003719-145003741 CAAGATAAAAAAATCTAAGGAGG - Intergenic
1199273953 X:145920963-145920985 CAGGAGAGACAGAGCGAAGGGGG - Intergenic
1199380524 X:147166999-147167021 CAGGAGGAAGAGATCAAAGGGGG - Intergenic
1201274338 Y:12284401-12284423 CTGGGGAAAAAGATCCAAGGAGG + Intergenic
1201394611 Y:13535433-13535455 CAGGAAAAATAGAACCAAGCTGG - Intergenic
1201713738 Y:17020520-17020542 CAGGAGAGAGAGAGCCAAGGGGG - Intergenic