ID: 1152515414

View in Genome Browser
Species Human (GRCh38)
Location 17:80820704-80820726
Sequence CAGACTGGGGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1251
Summary {0: 1, 1: 2, 2: 4, 3: 139, 4: 1105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152515406_1152515414 17 Left 1152515406 17:80820664-80820686 CCTCCTGCGCACAGTGGACATGC 0: 1
1: 0
2: 1
3: 18
4: 147
Right 1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG 0: 1
1: 2
2: 4
3: 139
4: 1105
1152515403_1152515414 27 Left 1152515403 17:80820654-80820676 CCTGGCCATTCCTCCTGCGCACA 0: 1
1: 0
2: 0
3: 12
4: 198
Right 1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG 0: 1
1: 2
2: 4
3: 139
4: 1105
1152515405_1152515414 22 Left 1152515405 17:80820659-80820681 CCATTCCTCCTGCGCACAGTGGA 0: 1
1: 0
2: 0
3: 33
4: 213
Right 1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG 0: 1
1: 2
2: 4
3: 139
4: 1105
1152515407_1152515414 14 Left 1152515407 17:80820667-80820689 CCTGCGCACAGTGGACATGCTTG 0: 1
1: 0
2: 0
3: 15
4: 111
Right 1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG 0: 1
1: 2
2: 4
3: 139
4: 1105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152515414 Original CRISPR CAGACTGGGGAGAAGGAGGA GGG Intronic
900029296 1:359295-359317 AGGAGTGGGGAGGAGGAGGAGGG - Intergenic
900049898 1:588067-588089 AGGAGTGGGGAGGAGGAGGAGGG - Intergenic
900086073 1:897981-898003 CACACTGATGAGGAGGAGGAAGG - Intergenic
900231396 1:1560390-1560412 CAGCCTGGGGAGACCGAGGCAGG - Intronic
900768061 1:4518776-4518798 CAGCCTGGGCTGAACGAGGAAGG + Intergenic
900799770 1:4729973-4729995 CACAATGGGGAGTAGAAGGAAGG - Intronic
901144098 1:7053625-7053647 CAGAGTGGAGTGAGGGAGGAAGG - Intronic
901646688 1:10720702-10720724 CCATCTGGGGAGAGGGAGGACGG + Intronic
901669965 1:10850331-10850353 CAGACAGGAGACTAGGAGGAAGG - Intergenic
901751693 1:11413915-11413937 GAGAAGGGGGAGAAGGAGGGAGG - Intergenic
901876509 1:12169825-12169847 CTGTCTGGGGAGGAGGATGAGGG + Intronic
902247384 1:15129744-15129766 CTGGCTGTGGAGATGGAGGAAGG + Intergenic
902808061 1:18872999-18873021 CAGCCTGGGCAGAAGGGGAAGGG + Intronic
903034693 1:20486156-20486178 CAGAGGGGGGAGAGGGAGGCAGG + Exonic
903325004 1:22564346-22564368 CGGGCTGGGGAGAAGAAGGGAGG + Intronic
903477953 1:23633274-23633296 GTGACTGGTGAGAAGGAGAATGG - Intronic
903548632 1:24142625-24142647 CTGACAGGGGAGGAGGAGGAAGG - Intronic
903947458 1:26972656-26972678 CAGAAATGGGAGGAGGAGGATGG + Intergenic
904030706 1:27531984-27532006 CAGACTCGGGAGATGGACCAGGG - Intergenic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904233371 1:29096332-29096354 GAGACAGAAGAGAAGGAGGAGGG + Intronic
904335962 1:29798281-29798303 CAGGCTGGGGAAGAGGAGGCAGG - Intergenic
904351461 1:29909828-29909850 CAGCCCGGTGAGAAAGAGGAGGG - Intergenic
905037289 1:34926439-34926461 CAGACTGGGGAGGGGCAGGGTGG + Intronic
905269217 1:36775953-36775975 CAGACTGGGGAGAGGGTCCAAGG - Intergenic
905461941 1:38127831-38127853 CAGAATGGCAAGGAGGAGGAGGG - Intergenic
905518120 1:38577408-38577430 CAGGCTGGGGTCAAGGAGGTAGG - Intergenic
905651929 1:39662375-39662397 CAGGCTAGGGAGCAGGAGAATGG - Intronic
905655467 1:39683827-39683849 CAGGCTGGGGAGCAGCAGGGAGG + Intronic
905688942 1:39928639-39928661 CAGACTGGGGTGCGGGAGGATGG - Intergenic
905790157 1:40785189-40785211 GAGCCTGGTGAGAGGGAGGAGGG - Intronic
905866510 1:41379775-41379797 GAGACTGGTGGGAAGGAGGCAGG + Intronic
906048423 1:42851058-42851080 CCACCTGGGGAGAAGGAGCATGG + Exonic
906165309 1:43681638-43681660 CAGACTAGGGAAAAAAAGGATGG - Intronic
906493370 1:46285577-46285599 GTGGCTGGCGAGAAGGAGGATGG - Exonic
906943320 1:50275015-50275037 GACACGGGGGAGAAGGAGAAAGG - Intergenic
906961473 1:50421718-50421740 CAGACTGGGGTGAAGGTGCTAGG - Intronic
906994621 1:50778662-50778684 CAAACTGAAGAGAAGGAGGAAGG + Intronic
907050404 1:51326241-51326263 GAGGCTGGGCGGAAGGAGGATGG + Intronic
907053073 1:51342833-51342855 CAGGCTGAGGAGAAGGTGTAGGG - Intronic
907388240 1:54139659-54139681 CAAACTGGTGGGATGGAGGAAGG + Exonic
907521166 1:55024258-55024280 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
907543982 1:55243219-55243241 AACATTGGGGAGAAGGGGGAAGG + Intergenic
907576987 1:55535358-55535380 AAGACTGGGGAGAAAAAGAAAGG - Intergenic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
907849978 1:58247151-58247173 CAGAATGGGGGCAAGGAGGCTGG + Intronic
908023524 1:59923171-59923193 CAAGCTGGGGAAAAGGAAGATGG - Intronic
908089096 1:60667859-60667881 CAGAGTGGGGAGAGGCAGGGGGG + Intergenic
908318839 1:62961628-62961650 CAGAATGGGGAGGAGGGGGGTGG - Intergenic
908792703 1:67798582-67798604 TAGGCTGAGGAGAAGGAGGAAGG - Intronic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
909142555 1:71887229-71887251 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
909629719 1:77759297-77759319 CTGAGTGGGGAGACCGAGGAAGG + Intronic
909975472 1:82041732-82041754 CAGACTCATGAGAGGGAGGAAGG + Intergenic
910180916 1:84481565-84481587 GAGAATGGGGAGTGGGAGGACGG + Intronic
910286120 1:85556141-85556163 GAGAAGGAGGAGAAGGAGGAAGG - Intronic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
911257294 1:95647069-95647091 CAGACTGGGGAAGAGAAGGCAGG + Intergenic
911260588 1:95680645-95680667 CCGAAAGGGGAGAGGGAGGAAGG - Intergenic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911719052 1:101170051-101170073 CAGACTGGTGAAGAGTAGGAGGG - Intergenic
911735718 1:101334625-101334647 CAGAAGGGGGAGAGGGAGGGAGG - Intergenic
911983757 1:104597621-104597643 CAGTCTGGGGAGGAGGGGAAAGG - Intergenic
912386144 1:109272205-109272227 CAGGCTGGGAAGAAGGAGGGTGG - Intronic
912509089 1:110176294-110176316 GAGACATGGGAGAATGAGGAGGG + Intronic
913114667 1:115685126-115685148 CAGAGAGTGGAGAGGGAGGAAGG - Intronic
913137633 1:115908264-115908286 CAGCCTTGGGATAAGGAGGATGG - Intergenic
913547548 1:119884474-119884496 CAGCCTGGGGTGGAGAAGGAAGG - Intergenic
914320238 1:146552094-146552116 GAGACTGGAGAGTAGGAAGAAGG + Intergenic
914700217 1:150125633-150125655 CACACTGGGGGGAGGGGGGAGGG + Intronic
914835698 1:151205109-151205131 CAAACTGGGGAGAGGGAAGGTGG + Intronic
914999998 1:152580230-152580252 CAGCCTGAGTAGAAAGAGGATGG + Intronic
915240990 1:154521578-154521600 CTGACTGTGGAGAAGAAGGCAGG + Intronic
915342516 1:155184306-155184328 CAGACACGGGAGAAGGAGCAGGG - Exonic
915347211 1:155203593-155203615 CTGGTTGGTGAGAAGGAGGAAGG + Intronic
915580162 1:156808673-156808695 AGGGCTGGGGAGAAGGAAGAGGG + Intronic
915824779 1:159063868-159063890 TAGACTGAGGAGGAAGAGGAGGG - Intronic
916024734 1:160823819-160823841 TAGACATGGGAGGAGGAGGAAGG - Intronic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
916714551 1:167438382-167438404 CAGAATGGAGCCAAGGAGGAAGG + Intronic
916818089 1:168372604-168372626 CTGACTGAGGAAATGGAGGAGGG + Intergenic
917002040 1:170370986-170371008 CAGGGTGGGGGGAGGGAGGAGGG - Intergenic
917090803 1:171351347-171351369 GTGACAGAGGAGAAGGAGGAGGG + Intergenic
917473704 1:175349817-175349839 CTGGCTGTGGAGAAGGAGGTAGG - Intronic
917608723 1:176664368-176664390 CAGGCTTTGAAGAAGGAGGAAGG - Intronic
917808503 1:178635544-178635566 CAGACTGGGGAGGCTGAGGCGGG + Intergenic
918095700 1:181332214-181332236 AAGACTGGGGAGTGGGAGAAGGG + Intergenic
918096854 1:181343172-181343194 AAGACTGGGGTGGAGGAGGCTGG + Intergenic
918148943 1:181781610-181781632 CAGGCTGGGGAGGTGGAGGAGGG + Intronic
918372281 1:183872831-183872853 AAAAATGGGGAAAAGGAGGAGGG + Intronic
919417984 1:197335179-197335201 GTGACTGGAGTGAAGGAGGAAGG + Intronic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920122449 1:203668881-203668903 TAGATTGGGGAGAAGGAGGTAGG + Intronic
920244339 1:204576516-204576538 CAGAGCCGGGAGCAGGAGGATGG + Intergenic
920251149 1:204623340-204623362 CAGTCTGGGGTGAAGGGGAAAGG - Intronic
920427432 1:205889320-205889342 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
920910933 1:210215683-210215705 TAGAGTAGGGAGGAGGAGGAGGG + Intergenic
920951817 1:210579128-210579150 CAGACACGGGAGATGGAGGGTGG + Intronic
920987053 1:210900834-210900856 TAGGTTGAGGAGAAGGAGGATGG - Intronic
921484311 1:215697968-215697990 GGGGCTGGGGAGAAAGAGGAGGG - Intronic
921771885 1:219050405-219050427 AAGAAGGGAGAGAAGGAGGAAGG + Intergenic
922056094 1:222043818-222043840 CAGGCTGGGCAGGAGGGGGAAGG + Intergenic
922162968 1:223091660-223091682 CAGACTTGGCAGAAGGTGGAAGG + Intergenic
922386339 1:225087616-225087638 CAGACCTTGGAGAAGGAAGATGG + Intronic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
923010304 1:230083163-230083185 CAGAGTGGGGAGCAGGATGATGG + Intronic
923538547 1:234871522-234871544 AGGGCTGGGGAGAAGCAGGATGG - Intergenic
923549734 1:234954036-234954058 CAGAAAGGAGGGAAGGAGGACGG + Intergenic
923663919 1:235982120-235982142 CAGCCTGGGGAGAACAGGGAGGG + Intronic
924044193 1:240011152-240011174 CAGTCTGGAGGGGAGGAGGAGGG - Intergenic
924256910 1:242191842-242191864 CAGACTGGGGCGAAATAGGAGGG + Intronic
924441823 1:244092610-244092632 GAGACTGGGTAGATGGAGGTAGG - Intergenic
924493035 1:244558735-244558757 CAGAGTGGGCAGGAGGAGAAGGG - Intronic
924611979 1:245580856-245580878 CAGCATGGGCAGAACGAGGAAGG - Intronic
1063225759 10:4013414-4013436 CAAAGTGGGGAGGAGAAGGAAGG - Intergenic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1063430954 10:5987871-5987893 CAGAGTGGGGAGAAGGCGGGTGG + Intergenic
1063457934 10:6197722-6197744 TAGACTGGGAAGGAGGAAGAGGG + Intronic
1063832982 10:9977886-9977908 TAGACACTGGAGAAGGAGGAAGG + Intergenic
1064565555 10:16635622-16635644 CAGAGTGGGGACAATGAGGTAGG - Intronic
1064823413 10:19366054-19366076 CATACTGGGGAGTAGGGGGAAGG + Intronic
1065478759 10:26171139-26171161 TACACTGGGGGCAAGGAGGAGGG + Intronic
1066075843 10:31875841-31875863 GGGACTGGGGAGAGGGAGGATGG - Intronic
1066103492 10:32137741-32137763 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1066414595 10:35209059-35209081 CAAACTGGGCAGAACCAGGATGG + Intronic
1067249351 10:44574181-44574203 CAGACTTGGGAGAGGCAGAAGGG + Intergenic
1067487816 10:46668491-46668513 CTGGCTGGGGAGGAGGAGCAGGG - Intergenic
1067575156 10:47404167-47404189 CAGGCTGGGGAGCTGGAGGAAGG + Intergenic
1067606991 10:47673518-47673540 CTGGCTGGGGAGGAGGAGCAGGG + Intergenic
1067673331 10:48346536-48346558 CAGACTGGGAAGCAGGGGGGAGG + Intronic
1068122116 10:52791764-52791786 GAGGAGGGGGAGAAGGAGGAAGG + Intergenic
1068331450 10:55576358-55576380 CAGGCTGAGGAGAAAGAGGAAGG + Intronic
1069248465 10:66239374-66239396 CAGACTGGGGAGCAGAAGATTGG - Intronic
1069667026 10:70169859-70169881 CAGACAGGGGAAAAGGGGAAGGG + Intronic
1069774179 10:70917291-70917313 GAGACTGAGGAGGAAGAGGAGGG - Intergenic
1069829491 10:71273826-71273848 CAGACTTGCCAGAAGCAGGAAGG + Intronic
1070107430 10:73448122-73448144 TAGACTGGGGATAAGCAGTAGGG + Intronic
1070712651 10:78693929-78693951 GAGTCAGGGGAGAAGGAGGCTGG + Intergenic
1070894897 10:79975356-79975378 CACACTGATGAGGAGGAGGAAGG - Intronic
1071160687 10:82742109-82742131 CAGACGAGAGAGAGGGAGGAAGG - Intronic
1071227143 10:83543821-83543843 GAGACTGGGGTGAGGGAGGGAGG - Intergenic
1071329916 10:84549032-84549054 GAGACTGGGGAGCTGGAGGATGG - Intergenic
1071379767 10:85046654-85046676 CAGATATGGGAGAAGGAGAAAGG + Intergenic
1071550887 10:86565326-86565348 CAGCCTGGGGAGAAGGGGAAAGG + Intergenic
1071573659 10:86711312-86711334 CAGCCCGGGAAGGAGGAGGAAGG - Intronic
1071796896 10:89017723-89017745 CAGCGAGGGCAGAAGGAGGAAGG - Intergenic
1071824164 10:89307889-89307911 TAGACTGGGAAGGAGGAGGAAGG - Exonic
1071971897 10:90916061-90916083 CGGGTGGGGGAGAAGGAGGAGGG + Intronic
1072009370 10:91290241-91290263 CAGAGTGGGAAGCAGGAGGAGGG + Intergenic
1072209224 10:93231388-93231410 CAGGCTGGGGAGGAGAAGGCAGG + Intergenic
1072249814 10:93572621-93572643 CTGAGTGGGGAGGAGGAGGTGGG + Intronic
1073013786 10:100382284-100382306 CAGCCTGGGGAGAAGGGGGGAGG - Intergenic
1073037492 10:100574584-100574606 GAGAGAGGGGAGAGGGAGGAAGG - Intergenic
1073078883 10:100844107-100844129 TAGGCTGAGGAGAAGGAGGGAGG - Intergenic
1073220125 10:101864743-101864765 CAGGCTGGGGAGAGGGGGAAGGG + Intronic
1073513871 10:104060277-104060299 CAGGCTGGGGAGAAAGAAAATGG + Exonic
1073547393 10:104362577-104362599 GAGATGGGGGAGCAGGAGGAGGG - Intronic
1074042553 10:109806126-109806148 GAGAGTGGAGAGTAGGAGGAGGG + Intergenic
1074065143 10:110007464-110007486 CAGCCTCGGGAGTAGGAGTAGGG + Intronic
1074189043 10:111119974-111119996 CAGACTGGTTAGGAGGAAGAGGG + Intergenic
1074243116 10:111658969-111658991 CAAACTGGGGAGAAGGGAGGAGG - Intergenic
1074322906 10:112420211-112420233 CAGAGTTGGGAGAGAGAGGAAGG - Intronic
1074339504 10:112613473-112613495 CAGAGAGGGGAGAAGGTGAAAGG - Intronic
1075307830 10:121383462-121383484 CAGACTGGGGGCAAGGAAGATGG + Intergenic
1075341265 10:121648440-121648462 CAGACTAGGTAGTAGGAGGCAGG - Intergenic
1075445212 10:122508294-122508316 TAGACATGGGAGAAGCAGGAAGG + Intronic
1075574763 10:123570403-123570425 CAGGCTCTGGGGAAGGAGGAAGG - Intergenic
1075597650 10:123743803-123743825 AGGACTGGAGAGAAGCAGGAGGG + Intronic
1075721818 10:124591978-124592000 CAAGGTGGGGAGAAGGAGGCAGG - Intronic
1075762701 10:124869059-124869081 CAGACGGAGGAAAAGAAGGAAGG - Intergenic
1076358894 10:129872969-129872991 AAGAGTGGGGGCAAGGAGGAGGG - Intronic
1076562452 10:131376048-131376070 CAGCCTGAGGAGAAGAAGGTGGG - Intergenic
1076978743 11:194091-194113 CAGACTGGGGAGGAGGTCTATGG - Intronic
1076980931 11:204328-204350 GAGGCTGGGGACAAGGAGGATGG + Exonic
1077029729 11:459638-459660 CAGACGTGGGAGGAGGAGGCAGG - Intronic
1077174113 11:1180982-1181004 CAGACTGGGGGACAGGAGGCCGG - Intronic
1077412168 11:2408693-2408715 CAGCCTGCGGGGCAGGAGGAGGG + Intronic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1077921861 11:6647340-6647362 CAGAGCTGGAAGAAGGAGGAGGG + Intronic
1078055031 11:8002336-8002358 GAGACTGGGGAGGCTGAGGACGG + Intergenic
1078156640 11:8805627-8805649 TAGGCTGGGAAAAAGGAGGAGGG - Intronic
1078490177 11:11761016-11761038 CTGTCTTGGAAGAAGGAGGAAGG - Intergenic
1078550079 11:12274137-12274159 GACACTGTGGAGAGGGAGGAGGG + Intergenic
1078676060 11:13415496-13415518 TTTACTGGGGAGAAGGAGCAGGG - Intronic
1078746282 11:14118665-14118687 GATAATGGGGAGAAGTAGGATGG - Intronic
1078836140 11:15031877-15031899 TAGGCTGAGGAGGAGGAGGAAGG - Intronic
1079230424 11:18644661-18644683 CAGCCTGGGGAGAAGGAGAGAGG - Intergenic
1080073335 11:28115724-28115746 TAGACTGAGGAAGAGGAGGAGGG + Intronic
1080330285 11:31129690-31129712 CAAACTGGGGAGGGGGATGAGGG - Intronic
1080388576 11:31824829-31824851 CAGACTGGGCAAAAAGAGTAGGG - Intronic
1081238714 11:40678288-40678310 TAGATGGGGGAGAAGGAGGAGGG - Intronic
1081297813 11:41413116-41413138 CAGAATGTAGAGAATGAGGATGG + Intronic
1081340760 11:41924424-41924446 CATTGTGGGGAGAGGGAGGAAGG - Intergenic
1081369985 11:42288470-42288492 GAGACTGGGGAGAGGAAGGAGGG + Intergenic
1081634068 11:44709109-44709131 CAGACTGTGGAGGGGGAGAAGGG + Intergenic
1083609546 11:63998517-63998539 CTGACTGGGGGGAAGGAAGGCGG - Intronic
1084008936 11:66337166-66337188 CAGGCTGGGGAGGGGGAGGTGGG - Intergenic
1084028881 11:66469123-66469145 CAGATGGGGGAGGAGGAAGAGGG - Intronic
1084104869 11:66974969-66974991 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
1084190421 11:67496139-67496161 GATAAAGGGGAGAAGGAGGAGGG - Intronic
1084192403 11:67505017-67505039 CAGTCTGGGGCGCAGGTGGACGG - Intronic
1084472143 11:69368780-69368802 GAGACTGGGGAGGGGGAAGAGGG - Intergenic
1084677670 11:70645734-70645756 CAGACTGGGGAGCTGGGGCAAGG + Intronic
1084891052 11:72237429-72237451 CAGGCTGGGGGGCAGGAAGATGG - Exonic
1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG + Intronic
1084958973 11:72706273-72706295 CAGTCTGGGTAGAAAGATGAAGG - Intronic
1084997572 11:72996969-72996991 GAGACTGGGGAGACAGAGGTTGG + Intronic
1085043333 11:73339667-73339689 CAGATTGGGCAGAAGTAGGGAGG + Intronic
1085099420 11:73788041-73788063 CAGAGAGGGGAGATGGCGGAGGG + Intronic
1085300161 11:75453170-75453192 CAGACTGGGGAGGAGGAGGAAGG + Intronic
1085300322 11:75454600-75454622 CAGACCAGGGAGCAGGAGCAAGG + Intronic
1085534962 11:77212169-77212191 CAGGCTGGGGTAATGGAGGATGG + Intronic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1087575589 11:99985306-99985328 CAGACAGGGGAGCAGGAGAGGGG + Intronic
1088306106 11:108409886-108409908 CAGACTTGGGATGTGGAGGATGG - Intronic
1088413061 11:109556869-109556891 CGGGCTTGGGGGAAGGAGGAGGG + Intergenic
1088497538 11:110446657-110446679 CAGGTTGGGAAGAAAGAGGAAGG - Intronic
1088560617 11:111112104-111112126 AAAAGGGGGGAGAAGGAGGAAGG + Intergenic
1088734705 11:112719130-112719152 GAGACTGGGGAAAAGAATGATGG + Intergenic
1088781357 11:113136900-113136922 CAGACTGGGGACATGGAGAGAGG + Intronic
1089098220 11:115937642-115937664 GAGACTGAGGAAAATGAGGATGG + Intergenic
1089196342 11:116695971-116695993 AAGAAAGGAGAGAAGGAGGAAGG - Intergenic
1089502399 11:118940305-118940327 CAGGCTGGGGAGGAGGTGCAGGG + Intronic
1090213461 11:124939536-124939558 TAGAATGGGAGGAAGGAGGAAGG + Intergenic
1090366504 11:126211306-126211328 GAGAATGGGGAGAAGGCGGAGGG - Intronic
1090570400 11:128038598-128038620 CTGACTTGGAAGAAGGAGGAGGG - Intergenic
1091067568 11:132530531-132530553 CATTCTGGGGTGAAGGAGTAAGG - Intronic
1091295010 11:134467571-134467593 CAGACTGGGAAGCAGCAGGCTGG - Intergenic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1091381714 12:66463-66485 CAGACTGGGAAGTAGGCGAAGGG - Intergenic
1091443989 12:533081-533103 CACTGTGGGGAGGAGGAGGATGG - Intronic
1091596542 12:1882566-1882588 AGGACTGTGGAGGAGGAGGAAGG + Intronic
1091663748 12:2403695-2403717 TGGACTGGAGAGATGGAGGAGGG - Intronic
1092146863 12:6220784-6220806 GAAACTGGGGAGGAGGATGAGGG - Intronic
1092192348 12:6530054-6530076 CCAGCTGGGGATAAGGAGGACGG - Intronic
1092229924 12:6770563-6770585 AAGGCTGGGGAGAAAGAAGAGGG - Exonic
1092279172 12:7086616-7086638 TGGGCTGGGGAGAAGGAAGAAGG - Intronic
1092489136 12:8929381-8929403 CAGGCTGTGGATAAGGAGGTAGG - Intronic
1092833954 12:12470568-12470590 CAGACAGGGAAGCAGGGGGATGG - Intergenic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1093736542 12:22625871-22625893 TGGACTGGGGAGTGGGAGGAGGG - Intronic
1093978841 12:25452893-25452915 CAGACTAGGGAGGAGGAACATGG + Intronic
1094086621 12:26600370-26600392 AAGATTGGGGAGAAAGAGAAGGG - Intronic
1094113111 12:26882349-26882371 CAGGGTGTGGAGAAGAAGGAAGG + Intergenic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1094540982 12:31363047-31363069 AAGACTGAGGAGATGGAGGGAGG + Intergenic
1095185931 12:39200497-39200519 CACACTGATGAGGAGGAGGAAGG - Intergenic
1095493664 12:42762205-42762227 CAGACAGGGAGGAAGGATGATGG - Intergenic
1095854170 12:46842380-46842402 CATAGTGTGGAGGAGGAGGAGGG + Intergenic
1096308259 12:50498111-50498133 CACACTGATGAGGAGGAGGAAGG - Intergenic
1096309660 12:50509529-50509551 CAGACAGGAGAAAGGGAGGATGG - Intronic
1096467042 12:51852289-51852311 CAGACTTGGGAGGAGGAGCTGGG + Intergenic
1096777411 12:53972803-53972825 CAGGATTGGGGGAAGGAGGAGGG - Intergenic
1096874603 12:54617481-54617503 CATACTGGGGAGTAGGGTGATGG + Intergenic
1096979264 12:55719072-55719094 CACACTGGGGGGTTGGAGGAGGG - Exonic
1096982706 12:55737566-55737588 CAGATTGGGGATAAGCAGGAGGG + Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097592294 12:61588518-61588540 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
1097947648 12:65389626-65389648 CAGACTGGGAAGAAAGGGAAGGG - Intronic
1097973511 12:65660556-65660578 AAGACTTGGGAGAATTAGGAAGG - Intergenic
1098222600 12:68285836-68285858 CAGATTTGGGAGAAAGAGGTGGG + Intronic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1098919807 12:76293088-76293110 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
1099064911 12:77963917-77963939 CAGAAGGAGGAGAAGAAGGAAGG - Intronic
1099211816 12:79800302-79800324 CACACTGAGGAGGAAGAGGAGGG - Intronic
1099292190 12:80787131-80787153 CAGACTGGGGAGGAGGGGAGAGG + Intergenic
1100574987 12:95882719-95882741 AAGAATGGGTAGAAGGAGAAGGG - Intronic
1101023992 12:100582894-100582916 CAGGCTGTGAAGACGGAGGAGGG - Intronic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101338929 12:103823943-103823965 CTGACTGGGCAGAAGGAAGTTGG - Intronic
1101515158 12:105428147-105428169 CAAACTGGGGAGAAGGAAAAAGG - Intergenic
1101727091 12:107396796-107396818 CTGCCTGGAGGGAAGGAGGAAGG - Intronic
1102057956 12:109910878-109910900 CAGACTGGGGATAATCACGAGGG - Intronic
1102317873 12:111904668-111904690 CAGCCTGGGGTGAAGGGGGAGGG - Intergenic
1102554987 12:113720884-113720906 CAGAGTTGGGGGGAGGAGGAAGG + Intergenic
1102637290 12:114335593-114335615 CAGGCTGGGAAGGAAGAGGAGGG + Intergenic
1102781208 12:115566383-115566405 GAGAGTGGAGAGGAGGAGGAGGG + Intergenic
1102890201 12:116552799-116552821 CCGCCTGGGGAGAAGGAGAAGGG + Intergenic
1102929599 12:116852140-116852162 CAGACTTGGGAGGAGGAATAGGG - Intronic
1103054622 12:117808938-117808960 TAGACTGGGGAGAAGGGGAGGGG - Intronic
1103338785 12:120210212-120210234 CAGGCTGGGGAGCAGCGGGATGG - Intergenic
1103480116 12:121245312-121245334 GGGGCTGGGGAGAAGGAAGAGGG - Intronic
1103748161 12:123140354-123140376 CAGGTTGGGGAGGAGGAGGCTGG - Intronic
1103858855 12:123995544-123995566 CAGGCTTTGGAGAAGGAGAATGG + Intronic
1104135030 12:125929502-125929524 TAGACTGGGGAAGAAGAGGAGGG - Intergenic
1104759546 12:131288757-131288779 CGCCCTGGGGAGAGGGAGGAGGG + Intergenic
1104821167 12:131678455-131678477 CGCCCTGGGGAGAGGGAGGAGGG - Intergenic
1105546613 13:21355445-21355467 TAGCCTGGGGAGGGGGAGGAGGG + Intergenic
1105669810 13:22600601-22600623 CAGACTGGGCGGAAGGGGTATGG + Intergenic
1105818114 13:24055415-24055437 CTGCCTAGGGAGATGGAGGATGG + Intronic
1106269291 13:28138495-28138517 CCGCCCGGGGAGAAGGGGGAGGG - Exonic
1106418263 13:29564080-29564102 AATAGTGGGGAGAAAGAGGAAGG + Intronic
1106679978 13:31999494-31999516 GAGACTGGGGAGAGGGAGACTGG - Intergenic
1106784897 13:33096901-33096923 TAGACTGAGGAGGAGGAGGAGGG + Intergenic
1107004872 13:35598225-35598247 CAGAAGGGGGAGAATGTGGAAGG + Intronic
1107265279 13:38546117-38546139 CAGAGTCTGGAGAAGGAGCATGG + Intergenic
1107406360 13:40117736-40117758 CTGCCTGGGGAGAGGGAGGCAGG + Intergenic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108339169 13:49479782-49479804 CAGACTGGGGAGATTGATGCCGG - Intronic
1109234017 13:59793306-59793328 CAGACTGGGAGGAATGAGAAAGG - Intronic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1110284443 13:73733104-73733126 AAGACTGGGGGGAAGGAGTAAGG - Intronic
1110515829 13:76411427-76411449 AGGAGGGGGGAGAAGGAGGAGGG + Intergenic
1110515836 13:76411443-76411465 AGGAGGGGGGAGAAGGAGGAGGG + Intergenic
1110515860 13:76411490-76411512 AGGAGGGGGGAGAAGGAGGAGGG + Intergenic
1110696880 13:78501468-78501490 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110696893 13:78501546-78501568 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110803300 13:79725720-79725742 CAGGATGGGGGGCAGGAGGATGG - Intergenic
1110810185 13:79803978-79804000 GTGACTGGGGGGAAGGAGAAGGG + Intergenic
1111813981 13:93127397-93127419 GAGACTGGGGAGAAGGGTGCAGG + Intergenic
1111908944 13:94288421-94288443 GAGACTGGGGACATGGAGGGAGG - Intronic
1112057330 13:95702232-95702254 CAGACTGGGAAGAGGCAGGAGGG - Intronic
1112081452 13:95976086-95976108 GAGGCTGGGGAAAATGAGGAGGG - Intronic
1112247836 13:97750552-97750574 CAGAGAGGGGAGAAAGAGGAGGG - Intergenic
1112785592 13:102947883-102947905 CAGGCAGGGAAGTAGGAGGATGG + Intergenic
1113448595 13:110389360-110389382 CAGATTAGGGAGAAGGGTGATGG - Intronic
1113654763 13:112061177-112061199 GAGACTGGGGAGTGAGAGGAGGG + Intergenic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1114318306 14:21526233-21526255 CAGACTGCGGAGATGGAGATCGG + Intronic
1114675978 14:24440571-24440593 CAGCATGGGGAGAGTGAGGAAGG - Exonic
1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG + Intergenic
1115238576 14:31232397-31232419 ATAACTGGGGAGAAGGAGGGAGG - Intergenic
1116085010 14:40224409-40224431 CAAAAAGGGGTGAAGGAGGAAGG + Intergenic
1116479938 14:45385468-45385490 CATACCCGGAAGAAGGAGGAAGG + Intergenic
1116552377 14:46257845-46257867 CAGATTTGGGAGGAGGAGAAAGG + Intergenic
1116885746 14:50219523-50219545 GAGAGTGGGGAGAAATAGGAGGG + Intronic
1117248738 14:53913954-53913976 CAGAGTGGGGAGCAGGAAGGTGG - Intergenic
1117283115 14:54259853-54259875 GAGTCTGGGGAGAAGGATGGTGG - Intergenic
1117292201 14:54344759-54344781 CAGAGTGGGGAGGAGGAGCATGG - Intergenic
1117460354 14:55939102-55939124 CAGAGTGGGGAGAAGGCAGTAGG + Intergenic
1117762149 14:59040514-59040536 CAGACTGGGAAGAAAGATGAAGG + Intergenic
1117833025 14:59772515-59772537 AATATTGGGGAGAAAGAGGAAGG - Intronic
1118347907 14:64953041-64953063 CAGACTGTGGAGAGAGAGGAGGG + Intronic
1118465098 14:66023671-66023693 GAGACAGAGGAGAAGGAAGATGG - Intergenic
1118607445 14:67514537-67514559 CACCCTGGGGAGAAGGCGGCGGG + Intronic
1118935030 14:70279865-70279887 GAGAGTGGGGGGAGGGAGGAGGG + Intergenic
1118937389 14:70300245-70300267 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
1118970960 14:70637336-70637358 CAGAATGGGGAGAGTGGGGAGGG - Intergenic
1119199540 14:72742464-72742486 AAGAACGGGGAGATGGAGGAAGG - Intronic
1119248496 14:73132722-73132744 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1119317108 14:73705150-73705172 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
1119431034 14:74568027-74568049 CAGACTGGGGGGCAGGGGGTAGG + Intronic
1120306945 14:82782845-82782867 CAGACAGAGGAGGAGGAAGAAGG - Intergenic
1120880800 14:89413941-89413963 GAGAAGGGGGAGGAGGAGGAGGG + Intronic
1121167431 14:91818933-91818955 AAGACTGGGGATAGGGGGGAGGG + Intronic
1121897743 14:97664279-97664301 CAGGCTTGGGAGAAGAAGTATGG - Intergenic
1122143085 14:99674007-99674029 CAGCCTGAGGAGCAGGAGGTGGG + Intronic
1122180802 14:99953240-99953262 TAACCTGGGGAGAAGGTGGAGGG - Intergenic
1122319516 14:100845394-100845416 CAGGCCGGCGAGGAGGAGGAGGG - Intergenic
1122960573 14:105092092-105092114 CAGACTGGGGAGGTGAGGGAAGG - Intergenic
1123789041 15:23701255-23701277 CACACTGATGAGGAGGAGGAAGG - Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124592442 15:31065268-31065290 CAGAGTGGGTAGAATGGGGATGG - Intronic
1125450192 15:39799845-39799867 CAGACTGGGTAGAAGAGGGAGGG - Intronic
1125848994 15:42886175-42886197 CAGCCTGGGGAGAAGGGGAGAGG - Intronic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127388449 15:58486251-58486273 CAGCCTGAGGAGATGGGGGAGGG - Intronic
1127429396 15:58887372-58887394 CAGACAGGCGAGAAGTACGAGGG - Exonic
1127958355 15:63872193-63872215 CTGGCTGGGGAGAGGGAAGAAGG + Intergenic
1128119435 15:65134700-65134722 GAGGCTGGGGCGAAGGCGGAGGG - Intergenic
1128310519 15:66629169-66629191 CAGACCCAGGGGAAGGAGGAGGG + Intronic
1128638396 15:69317779-69317801 CAGCATGGGGAGAAGGGGAAAGG - Intronic
1128647253 15:69386909-69386931 CTGACTCAGGAGAAGGAGTAGGG - Intronic
1128930986 15:71704768-71704790 CAGACCAGGGAGAAGCATGATGG + Intronic
1129115238 15:73361973-73361995 CTGGCTGGGGAGAAGGCGCAGGG - Intronic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129233178 15:74208091-74208113 GACACTGGTGAGGAGGAGGAGGG + Intronic
1129445546 15:75615342-75615364 TAGAGTTGGGAGAAGGAGTATGG - Intronic
1129697363 15:77748253-77748275 CAAGGTGGGGAGGAGGAGGACGG - Intronic
1130243649 15:82221931-82221953 CAGCCTGGGGAAGAGAAGGAAGG - Intronic
1130456826 15:84119350-84119372 CAGCCTGGGGAAGAGAAGGAAGG + Intergenic
1130880477 15:88051293-88051315 TGGAGTGGGGAGAAAGAGGAGGG - Intronic
1130927481 15:88396426-88396448 AAGGAAGGGGAGAAGGAGGAGGG - Intergenic
1130958590 15:88644807-88644829 GAAATTGGGGACAAGGAGGAAGG - Intronic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131271472 15:90950042-90950064 AAGCCTGGGGAGAGGGAGGAAGG + Intronic
1131529522 15:93179838-93179860 CAGACAGGGAAGAGGGAGAAAGG + Intergenic
1131580025 15:93634259-93634281 CTGACTGGGGAGACGGAAGCTGG - Intergenic
1131727180 15:95239414-95239436 CAGGAGGGGGAGAAGAAGGAAGG + Intergenic
1132481787 16:169945-169967 CAGTCAGTGGGGAAGGAGGAAGG + Intergenic
1132482655 16:174202-174224 CAGTCAGTGGGGAAGGAGGAAGG + Intergenic
1132497604 16:271140-271162 CAGCCTGGGGGGACGCAGGAGGG - Intronic
1132645051 16:995118-995140 CAGTCCTGGGAGAAGCAGGATGG + Intergenic
1132934359 16:2473410-2473432 CAGTCTGGGTAGAAGGTGGGAGG - Exonic
1132942052 16:2513354-2513376 GAGACTGGGGACAGGGTGGAGGG + Intronic
1132977095 16:2716332-2716354 CAGAAAGGAGAGGAGGAGGAAGG - Intronic
1132990577 16:2790755-2790777 CAGACTGGGGATGAGGCTGAGGG + Intergenic
1132995315 16:2819574-2819596 CAGACAGGGGAGCAGAGGGAAGG - Intronic
1133158099 16:3889942-3889964 CAGACAGGAAAGAAGGAAGAAGG - Intergenic
1133246854 16:4454855-4454877 GAGGCTGGGGAGGACGAGGAGGG + Exonic
1133392816 16:5422976-5422998 AGGAGTGGGGAGAGGGAGGAGGG + Intergenic
1133869694 16:9675545-9675567 CAGGCTGGGGAGGAGGGGAAAGG + Intronic
1133873825 16:9714272-9714294 CAGAGTGGGGAGAGGGAGATTGG - Intergenic
1133932079 16:10240810-10240832 CACACTGGGGGGAAGGGGGCAGG + Intergenic
1133953979 16:10423752-10423774 CACACTGATGAGGAGGAGGAAGG - Intronic
1134040099 16:11061861-11061883 CAGAGTTGGGAGACGGAGGAAGG - Intronic
1134089771 16:11385214-11385236 CAGACTGGGGTAGAGGATGAGGG + Exonic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134377864 16:13695169-13695191 CAGACTAAGGAAAAAGAGGAGGG + Intergenic
1135025507 16:18996201-18996223 CAGCCTGGGGAGAAGGGGAGAGG + Intronic
1135300133 16:21319659-21319681 CAGGCTGGGGAGACAGAGGATGG - Intergenic
1135516292 16:23138449-23138471 CAGACTAGGGACATGGAGGATGG - Intronic
1135925394 16:26689507-26689529 TTGGCTGGGGAGAAGAAGGATGG + Intergenic
1136139762 16:28281289-28281311 CAGGCTGGGGTGGAGCAGGAGGG - Intergenic
1136153203 16:28365496-28365518 CAGAATGGGGGGATGGAGGGTGG + Intergenic
1136209883 16:28749777-28749799 CAGAATGGGGGGATGGAGGGTGG - Intergenic
1136242279 16:28951573-28951595 CAGACTGGGGTGGTGAAGGAGGG + Intronic
1137430235 16:48412606-48412628 AAGACTGGGGAGAAGGGTGGAGG + Intronic
1137602889 16:49768602-49768624 GAGACTGAGGAGATGGAGAAAGG - Intronic
1137627130 16:49916307-49916329 CAGAGTGGGAACAAGGAGGGTGG - Intergenic
1138234499 16:55370558-55370580 CAGCCGCTGGAGAAGGAGGAAGG - Intergenic
1138598378 16:58041418-58041440 CAGTGTGGGGAGATCGAGGAGGG + Intronic
1138671523 16:58619087-58619109 CTGACTGGGGAGACTGAGGTGGG + Intronic
1138747854 16:59384484-59384506 CAGTTTGGGGACAAGGAGAAAGG + Intergenic
1138777591 16:59742785-59742807 GAAACTGGGGAGAAGGGAGATGG + Intronic
1138804433 16:60077717-60077739 CATAGTTGGGAGATGGAGGAAGG - Intergenic
1138988475 16:62361422-62361444 CAGCCTGGGCAGAAGAAAGAAGG + Intergenic
1139277360 16:65740408-65740430 GAAACTGGGAAGAAGCAGGAAGG - Intergenic
1139340021 16:66262463-66262485 CATACAGGGGAGAAGGCTGAGGG - Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139774932 16:69311202-69311224 CTGACTGGGGACGAGGAGGTGGG - Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139956658 16:70696600-70696622 CACACTGGGGAGAAGCAGGCTGG - Intronic
1140013295 16:71158012-71158034 GAGACTGGAGAGTAGGAAGAAGG - Intronic
1140418131 16:74792239-74792261 GAGGCTGGGGAGAGGGAGAAAGG - Intergenic
1140765752 16:78155215-78155237 AAGAAAGGAGAGAAGGAGGAAGG + Intronic
1140906694 16:79415352-79415374 CAGGCAGGCAAGAAGGAGGAAGG + Intergenic
1141114431 16:81296299-81296321 AAGACTAGGGAAAAGGAAGAAGG - Intergenic
1141517325 16:84554250-84554272 CAGACTGGGGCCCAGGAGGTGGG + Intergenic
1141597801 16:85107944-85107966 CAGCCTGCAGAAAAGGAGGAGGG + Exonic
1141624406 16:85253701-85253723 TAGCCAGGGGAGAAGGAGGGTGG + Intergenic
1141667773 16:85474704-85474726 GGGAGTGGGGAGAGGGAGGAGGG - Intergenic
1141821533 16:86449529-86449551 CAGGCTGTGGCCAAGGAGGAGGG + Intergenic
1141865300 16:86746075-86746097 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
1141909739 16:87050494-87050516 CACTCTGGGGAGAACGAGAAAGG - Intergenic
1142044011 16:87913699-87913721 CAGTGTGGGGTGGAGGAGGAGGG - Intronic
1142325818 16:89413869-89413891 CAGACTGGGGGGAGGCAGGAGGG + Intronic
1142466172 17:138582-138604 CAGACTGGGGAGGAGGTCTATGG - Intronic
1142883965 17:2901365-2901387 CAGAGAAGGGAAAAGGAGGATGG - Intronic
1142885441 17:2909689-2909711 AACACGGGGGAGGAGGAGGAAGG - Intronic
1142980303 17:3667771-3667793 TAGACTAGGCAGAGGGAGGAAGG - Intronic
1143414488 17:6736021-6736043 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1143480454 17:7224938-7224960 CAGCCTGGGGAGAGGGAAGGAGG - Exonic
1143601430 17:7948624-7948646 AAGCCTGGGAGGAAGGAGGAAGG + Exonic
1143659887 17:8318368-8318390 TATTCTGGGGACAAGGAGGAAGG - Exonic
1143949884 17:10624050-10624072 AAGACTGGGGAGAGGGAGCGAGG - Intergenic
1144472797 17:15559759-15559781 CTGACTGGGGAGGTGGAGGAAGG + Intronic
1144668251 17:17116663-17116685 CAGACTGGGGACTGGCAGGACGG - Intronic
1144923682 17:18784946-18784968 CTGACTGGGGAGGTGGAGGAAGG - Intronic
1145046862 17:19625341-19625363 CAAACTGGGAAGAAGCCGGATGG - Intergenic
1145814741 17:27787619-27787641 GAGACAGGAGAGCAGGAGGAAGG + Intronic
1145922937 17:28624819-28624841 TAGACCTGGGAGAAGGAAGAGGG - Intronic
1146175478 17:30663654-30663676 CAGACTGTGGATAAGGATGGAGG - Intergenic
1146348929 17:32079700-32079722 CAGACTGTGGATAAGGATGGAGG - Intergenic
1146373640 17:32280477-32280499 CAGGCTGTGAAGGAGGAGGAAGG + Intronic
1146505737 17:33403331-33403353 CTGACTGAGGAGAAGGCAGAAGG - Intronic
1146519335 17:33514358-33514380 GAGGATGGGGAGATGGAGGAAGG - Intronic
1146705124 17:34995750-34995772 CTGTCGGGGGAGGAGGAGGAGGG - Intronic
1146908635 17:36633644-36633666 GAGGAAGGGGAGAAGGAGGAGGG + Intergenic
1146954778 17:36931182-36931204 TAGACTGGGGAGAAGAGGCAGGG - Intergenic
1147035314 17:37675574-37675596 CAGTCTGGGGAGGAGGAGGCAGG - Intergenic
1147141785 17:38464567-38464589 CTTCCTGGGGAGAGGGAGGAAGG + Intronic
1147303760 17:39549514-39549536 AAGAATGGAGAGAGGGAGGAAGG - Intronic
1147308374 17:39579070-39579092 CAGATGGGTGAGGAGGAGGAAGG - Intergenic
1147418363 17:40309525-40309547 AAGAGTGGGGAGTAGGGGGAAGG + Intronic
1147445413 17:40472291-40472313 CAGGCTGGGGAGAAGGGTGCTGG - Intergenic
1147459250 17:40557934-40557956 GAGACAGGGGAGAGAGAGGAGGG + Intronic
1147945259 17:44077127-44077149 GGTACTGGGGAGGAGGAGGAAGG + Exonic
1147952426 17:44114547-44114569 CACACTGGGGAGAAGGATCCTGG + Intronic
1148194044 17:45700465-45700487 CAGACTGGGAAGCAGGATAAGGG - Intergenic
1148208127 17:45792270-45792292 CAGAGTTGGCAGAAAGAGGAAGG - Intronic
1148383901 17:47220935-47220957 CAGCCAGAGGAGAAGGGGGACGG - Intronic
1148482618 17:47970083-47970105 AAGACTGGGGACAAGGAGGCTGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148797538 17:50204210-50204232 CAGACTGGGGGGATGGGGGGTGG + Intergenic
1149107083 17:52982591-52982613 GAGGAGGGGGAGAAGGAGGAAGG - Intergenic
1149440971 17:56673571-56673593 CAATCTGGGGAGAAGAAGGAGGG + Intergenic
1149546680 17:57509047-57509069 CAGACTGGGAAGATGGAGGCAGG - Intronic
1149665257 17:58360728-58360750 CAGACTGGGGAGATTGAAGCTGG - Intronic
1150146482 17:62773764-62773786 AAGATTAGGGAGAAGGAAGACGG + Intronic
1150225041 17:63519892-63519914 GAGGCTGGGGGGCAGGAGGAGGG + Intronic
1150445404 17:65224343-65224365 CAGGCTGGGGAGAAGGAAACAGG - Intronic
1150467100 17:65403117-65403139 CAGCCTAGGGAAAAGCAGGAAGG - Intergenic
1151181951 17:72335671-72335693 AAGATTGGGGACAAGGAAGAGGG + Intergenic
1151257673 17:72891508-72891530 CAGACTGGGGAGCAGCAAGTGGG - Intronic
1151355367 17:73555009-73555031 CAGGCTGGGAGGAAGGAGGATGG + Intronic
1151535986 17:74738950-74738972 CATAGTGGGTAGAAGGAGGAGGG - Intronic
1151553852 17:74836841-74836863 CAGACTGGGTGGAAGGTGGGTGG - Exonic
1151622397 17:75254208-75254230 CAGCCTGAGGAGAAGGGGAAAGG - Intronic
1151699895 17:75737519-75737541 CAGTCTGGAGAGGAGGAGGCAGG - Exonic
1151815693 17:76470380-76470402 GAGAGTGGGGAGCAGCAGGATGG + Intergenic
1151888738 17:76939665-76939687 CAGAGTGGGGAGGAGGAAGGGGG - Intronic
1152198993 17:78934307-78934329 CACACGGAGGAGGAGGAGGAAGG - Intergenic
1152289241 17:79429460-79429482 CAGGCTGGGCAGGAGGAGGGAGG + Intronic
1152307170 17:79527925-79527947 CTGACTCGGCAGAAAGAGGAAGG - Intergenic
1152318234 17:79593243-79593265 AAGAGCTGGGAGAAGGAGGAAGG - Intergenic
1152332624 17:79681902-79681924 GAGACAGGGTTGAAGGAGGAAGG + Intergenic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1152698261 17:81806842-81806864 CAGGCGGGGGACAAGGAGGAAGG - Intronic
1152950462 17:83227261-83227283 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1153615893 18:6932786-6932808 GGGACTGGGGAGAATGGGGAAGG - Intergenic
1153641607 18:7162540-7162562 CAGCCTTGGCAGCAGGAGGAAGG - Intergenic
1153922466 18:9803939-9803961 GCGACAGGAGAGAAGGAGGAAGG + Intronic
1154024544 18:10695295-10695317 GAGGCTGGGGAGAAGAAGGCTGG + Intronic
1154101926 18:11483737-11483759 TAGAGTGGGGAGAAGTGGGAAGG + Intergenic
1154151668 18:11910945-11910967 CTGACTCCGGAGATGGAGGAAGG + Intergenic
1154339907 18:13494093-13494115 GAGTTTGGGGAGAAGGAGCAGGG + Intronic
1155089112 18:22488977-22488999 AAGACTGGGAAGTGGGAGGAGGG + Intergenic
1155112265 18:22727761-22727783 CAGACTGGGGTGGAGTAGGGAGG - Intergenic
1155342814 18:24830174-24830196 CAGGTTGGGGTGGAGGAGGAGGG - Intergenic
1155892789 18:31288315-31288337 CAGCCTGGGGAGGAGGAGAGAGG + Intergenic
1155940792 18:31800183-31800205 CAGACTGGGGAAGAGAAGGCAGG - Intergenic
1155941456 18:31805435-31805457 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
1155961851 18:32001904-32001926 CAGCCTGGGGAGAAGGGGAGAGG - Intergenic
1156507578 18:37608063-37608085 GAGACGGGAGAGAAGCAGGAAGG + Intergenic
1156724729 18:40114223-40114245 TGGGCTGGGGAGAAGGGGGAGGG - Intergenic
1156797045 18:41058579-41058601 CAGTCAGGGGAAGAGGAGGAGGG - Intergenic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1157633539 18:49125858-49125880 AAGACTGGCGAGTAGGAGTAGGG - Intronic
1157978510 18:52353434-52353456 CAGACTTGGGACACAGAGGAGGG - Intronic
1158190077 18:54817714-54817736 CTGACTGTGTAGAAGGTGGATGG - Intronic
1158543721 18:58378609-58378631 GAGGCTGGGGAGGATGAGGAAGG + Intronic
1159553949 18:69925704-69925726 GAGACTGGAGTGAAGGAGGCTGG - Intronic
1159620851 18:70636753-70636775 CACACTGGGGAGGCTGAGGAGGG - Intronic
1160480305 18:79233988-79234010 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
1160698160 19:494481-494503 CAGCCTGGGCAGGAGGGGGATGG + Intronic
1160970696 19:1766554-1766576 CAGAGAGGGGAGAGGGAGGGAGG + Intronic
1160982805 19:1823925-1823947 CACACTGGGGGGAAGCAGCAGGG + Intronic
1161012616 19:1967854-1967876 CAGCCTGGGGAGAAGGGAGGAGG - Intronic
1161012637 19:1967915-1967937 CAGCCTGGGGAGAAGGGAGGAGG - Intronic
1161139763 19:2640190-2640212 GAGAAGGGGGAGAGGGAGGAAGG + Intronic
1161218925 19:3108980-3109002 GAGACTGAGGGCAAGGAGGAAGG + Intronic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161370622 19:3908902-3908924 GAGGATGGGGAGGAGGAGGATGG - Intronic
1161370845 19:3910104-3910126 GAGCCTGGGGAGAAGGAATAGGG - Intronic
1161558869 19:4959663-4959685 AAGAAAGGGGAAAAGGAGGAAGG - Intronic
1161574292 19:5047351-5047373 GATACTGGGGTGGAGGAGGATGG + Intronic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161815726 19:6498732-6498754 CAGGCTCGGGAGGAGGAGGGAGG - Intronic
1162053096 19:8046815-8046837 GAGGAGGGGGAGAAGGAGGAGGG - Intronic
1162247157 19:9410906-9410928 CGGGCTGGGGAGAGGGAGGGAGG + Intergenic
1162541110 19:11296503-11296525 CAGACGGAGGAGGAGGAGCAGGG + Intronic
1162642503 19:12022703-12022725 CACACTGATGAGGAGGAGGAAGG + Intronic
1162983488 19:14254257-14254279 CAGACTGTGGATAAGGATGGAGG + Intergenic
1163442689 19:17329629-17329651 CAGACAGGAGAGAAGGATGGAGG + Intronic
1163768779 19:19178355-19178377 CAGGCTGGGGAGCAGGGGCAAGG + Intronic
1163827864 19:19533606-19533628 GAGAATGGGGAGGAGGAGGATGG - Intronic
1163900369 19:20095052-20095074 CAGCCTGGGGAGGAGGGGAAAGG + Intronic
1164216972 19:23159055-23159077 CAGACTGAGGAGAGTCAGGAGGG + Intergenic
1164398701 19:27888118-27888140 CAGAGTGGGGAGATGGTGGTGGG + Intergenic
1164441497 19:28283417-28283439 AGGAGTGGGGAGAAGGAGGTTGG - Intergenic
1164521289 19:28982174-28982196 GAGAGGGAGGAGAAGGAGGAAGG + Intergenic
1164566025 19:29326689-29326711 AAGACAGTGGGGAAGGAGGATGG - Intergenic
1164591833 19:29511743-29511765 GAGACTGGGAATGAGGAGGAAGG + Intergenic
1164592120 19:29512836-29512858 GAGATGGGGGAGGAGGAGGAAGG + Intergenic
1164592187 19:29513117-29513139 GAGAGGGGGGATAAGGAGGAAGG + Intergenic
1164592247 19:29513309-29513331 GAGACAGGGGATGAGGAGGAAGG + Intergenic
1164696574 19:30249337-30249359 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1164800087 19:31068957-31068979 CTGCCAGGGGAGGAGGAGGAAGG - Intergenic
1164816720 19:31209851-31209873 CAGAATGGGGAGAAGGGGTTGGG - Intergenic
1164864436 19:31592231-31592253 TAGACAGGGGTGAAGGAGGATGG - Intergenic
1165906203 19:39196361-39196383 CAGAGTGGGGAGGGGGAGGAGGG + Intergenic
1166009148 19:39928182-39928204 CAGACTGGAGATAAGGAGGCGGG + Exonic
1166840321 19:45693168-45693190 GAGAGAGGGGAGATGGAGGAAGG - Intronic
1167074217 19:47239404-47239426 CAGCCTGGGGAGAGGGAGTTGGG + Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167151655 19:47713620-47713642 CAGACTGGGGACAGGGTGGCAGG - Intronic
1167208415 19:48117847-48117869 AGGGCTGGGGAGAGGGAGGAAGG + Intronic
1167354267 19:48993555-48993577 CAAAGTGGGGAGGAGGAGGAGGG + Exonic
1167642268 19:50688287-50688309 AATACTGGGGACAAGGAGGGAGG - Intronic
1167695713 19:51014706-51014728 CCGACTGGGGAGGAAGAGGATGG + Exonic
1168334735 19:55591410-55591432 AACACTGGGGAGAGGGACGAGGG + Exonic
1168402494 19:56093462-56093484 AACACTGAGGGGAAGGAGGACGG - Intronic
1168646812 19:58064412-58064434 TAGGCTGAGGAGTAGGAGGAGGG - Intronic
925165517 2:1713494-1713516 CAGGCTGGGGAGGAGTAGAAGGG + Intronic
925177670 2:1796752-1796774 CAGACACGGGAGGTGGAGGAGGG - Intronic
925288286 2:2730090-2730112 CAGACTGGAGAGAAAGAGTGAGG + Intergenic
925342774 2:3148466-3148488 CTGACTGTGGGGAAGGATGAGGG - Intergenic
925372358 2:3356025-3356047 CATGTTGGGGTGAAGGAGGAAGG + Intronic
925422952 2:3726514-3726536 CAAACAGGAGAGAAGGCGGAGGG + Intronic
925541440 2:4971989-4972011 GAGAGGGAGGAGAAGGAGGAAGG - Intergenic
925611588 2:5706431-5706453 GAGACTGGGGTGGAGGAGCAGGG + Intergenic
925611626 2:5706541-5706563 GAGACTGGGGTGGAGGAGCAGGG + Intergenic
926079242 2:9970653-9970675 CAGCCTGTGGAGAAGGGGAAGGG + Intronic
926109080 2:10170682-10170704 CAGGTTGGAGAGAAGGAGGAGGG - Intronic
926308812 2:11659755-11659777 CAGCCTGGGAAGAGGGAGCACGG - Intronic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
926717405 2:15935840-15935862 CAGCCTGGGGAGTGGGAGCAGGG - Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927278196 2:21279601-21279623 CAGGCAGGGTAAAAGGAGGAGGG - Intergenic
927307532 2:21590642-21590664 CAGACTGGGGAGCAGAAGAGAGG - Intergenic
927383197 2:22502485-22502507 AAGACAGGGTAGAAGGATGAAGG - Intergenic
927445775 2:23160315-23160337 CAGACTTGGGGGCAGGAGAAAGG + Intergenic
927471974 2:23384191-23384213 CAGACAGGGGTGGAGGAGGAGGG + Intergenic
927842240 2:26453151-26453173 AAGAGTGGGAAGAAGGGGGATGG - Intronic
927868665 2:26609384-26609406 AAGGCTGGGGAGAGGGAGGTGGG - Intronic
928358051 2:30638764-30638786 GAGAATGGGGAGGAGGAGCAGGG - Intronic
928735350 2:34282453-34282475 GAGACTTCGGAGAAGAAGGAAGG - Intergenic
928928475 2:36600695-36600717 CAGCCTGGGGAGGAGGGGAAAGG - Intronic
929237745 2:39624428-39624450 AAGGCAGTGGAGAAGGAGGAGGG + Intergenic
929564887 2:42978137-42978159 GAGAGTGGGAAGAAGGAAGAGGG + Intergenic
929684632 2:44023119-44023141 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
929793153 2:45038486-45038508 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
929960690 2:46494076-46494098 CAGAGAGGGGAGGAGAAGGAGGG + Intronic
930722189 2:54648353-54648375 CACTCTGGGGAGAAGTTGGAGGG + Intronic
930762800 2:55053960-55053982 AAGACTGGAGAGAAGGAGAAGGG + Intronic
931392385 2:61855013-61855035 AGGGCTGGGGAGCAGGAGGAGGG - Intergenic
931470410 2:62533544-62533566 CCGATAGGTGAGAAGGAGGAAGG - Intergenic
931471438 2:62541688-62541710 CAGACAGGAGAGAAGGAGAAGGG + Intergenic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931609023 2:64079253-64079275 CAGACTGGGGAGGAGGGGAGAGG + Intergenic
931671095 2:64648645-64648667 CAGGCTGGGGAGGTTGAGGAAGG - Intronic
932137743 2:69245407-69245429 GAGCCTGGGGAGGAGGGGGAAGG - Exonic
932552975 2:72790941-72790963 CAGAATGGGGAAGGGGAGGATGG + Intronic
932566744 2:72915784-72915806 GAGGGTGGGGAAAAGGAGGAGGG + Intergenic
932780724 2:74556836-74556858 CAAGCTCGGGTGAAGGAGGAGGG + Exonic
932886587 2:75554429-75554451 CAGGCTGGGGAGAAGGAAAGGGG + Intronic
933053988 2:77638340-77638362 CACTCTTGGGAGAAGGGGGAGGG - Intergenic
933163642 2:79053047-79053069 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
934159197 2:89232067-89232089 GAGACTGTGAGGAAGGAGGAGGG + Intergenic
934208076 2:89950358-89950380 GAGACTGTGAGGAAGGAGGAAGG - Intergenic
934655569 2:96115374-96115396 TCCACTGGGGAGAAGGAGGAGGG - Exonic
934930767 2:98420871-98420893 GAGACTGTGGAGCAGAAGGAAGG - Intergenic
935102979 2:100014515-100014537 GAGAATGGGGAAAAGGAAGAAGG + Intronic
935131654 2:100265292-100265314 AGGGCTGGGGAGAAGGAGAAGGG - Intergenic
935413372 2:102788739-102788761 CACACTGGGCAGAAGGGGGAGGG - Intronic
935675310 2:105590156-105590178 CATACTGGGGAGATTGGGGAGGG - Intergenic
936379439 2:111970828-111970850 GAGAAGGAGGAGAAGGAGGAGGG - Intronic
936516601 2:113185215-113185237 CAGCCTGGGTGGGAGGAGGATGG + Intronic
937005046 2:118503785-118503807 TAGAGTGGGAAGAGGGAGGAAGG + Intergenic
937927613 2:127179228-127179250 CAGACTCTGGAGATGGAGGAAGG - Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938557108 2:132435296-132435318 TAGGCTGAGGAGAACGAGGAAGG - Intronic
938941123 2:136170479-136170501 CAGAAAGGGGAGAAGGAGATTGG + Intergenic
938962377 2:136354996-136355018 CAGACCGGGGAGGAGGAGCCAGG + Intergenic
939397912 2:141655096-141655118 TAAACTGGGGAGGAGGAAGAGGG + Intronic
939427376 2:142056813-142056835 AAGATATGGGAGAAGGAGGAAGG - Intronic
939723325 2:145682112-145682134 CAGACTGGGGTAAAGCAGAAGGG + Intergenic
939783877 2:146484174-146484196 GAGACTGGGAAGAATGAGTAGGG + Intergenic
939820063 2:146946643-146946665 GAGGGTGGAGAGAAGGAGGAGGG + Intergenic
939984179 2:148814021-148814043 CAGGCTGGGCAGGAGGAAGAGGG - Intergenic
940807525 2:158204937-158204959 CAGTCTGGAGAGGAGTAGGAGGG + Intronic
941456279 2:165714546-165714568 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
942451280 2:176109180-176109202 CAGGCTGGTGGGAAGGAGGGTGG - Exonic
942492026 2:176498992-176499014 CAGAGAGGGGAGAAAGTGGAGGG - Intergenic
943070433 2:183134991-183135013 CTGACTGTGAAGATGGAGGAAGG - Intronic
944070604 2:195663946-195663968 AAAACGGGAGAGAAGGAGGAGGG - Intronic
944218568 2:197279655-197279677 CAAACTAGGAAGAAGGAGGAAGG - Intronic
944452568 2:199857772-199857794 AAGATTTGGGGGAAGGAGGAAGG + Intergenic
945108594 2:206341506-206341528 CGGACGGGGGTAAAGGAGGAAGG - Intergenic
945220812 2:207482061-207482083 ATGACTGTGGAGAAGCAGGAAGG + Intergenic
945451272 2:209999398-209999420 CAGACTGGGGAGGTTGAGGATGG - Intergenic
945642211 2:212444104-212444126 CAGGCTGGGGAAGAGGAGGAGGG - Intronic
946021649 2:216644276-216644298 AAGATTGGGGAGAAGGGGGCAGG + Intronic
946029982 2:216695820-216695842 GAGAATGGGGAGGAGGTGGAGGG + Intergenic
946196407 2:218035052-218035074 CAGAATGGTGAGATGGGGGATGG - Intronic
946200665 2:218069106-218069128 CAGAATGGTGAGATGGGGGATGG - Intronic
946427298 2:219606164-219606186 CAGGAAGGGGAGAATGAGGAGGG - Intronic
946482305 2:220068869-220068891 GGGACTGGGGAGATGGAGCATGG + Intergenic
946598285 2:221331015-221331037 CAGATTGGAGAGTGGGAGGAAGG + Intergenic
946683096 2:222238589-222238611 CAGACATGGGAGGAGGTGGAGGG + Intronic
946945754 2:224820359-224820381 CAAAGTGTGGAGCAGGAGGAAGG + Intronic
946987840 2:225292886-225292908 AAGACAGGAGAGAAGGAAGAAGG - Intergenic
947077353 2:226359778-226359800 CAGGCAGGAGAGAGGGAGGAAGG + Intergenic
947353030 2:229266253-229266275 AAAAATGGGGAGAAGGAGGGAGG - Intronic
947702368 2:232245086-232245108 AAGACTGGGGAAAAGGATCAAGG + Intronic
947831028 2:233141819-233141841 GAGACTGGGGAGAAGGGGACTGG + Intronic
947855576 2:233321594-233321616 CAGGCTGGGGGGTTGGAGGATGG + Intronic
948034662 2:234848209-234848231 CAGGTTGGGGAAAAGGAGGAGGG + Intergenic
948134110 2:235622947-235622969 CACACTGGAGGGAAGCAGGAGGG + Intronic
948258158 2:236583620-236583642 CAAAATGGGGAGGGGGAGGAGGG + Intergenic
948320042 2:237061699-237061721 CAAGATGGGGAGATGGAGGAAGG + Intergenic
948672650 2:239578354-239578376 AATACGGGAGAGAAGGAGGAGGG - Exonic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948835527 2:240624349-240624371 CAGCCGGGGAAGCAGGAGGAAGG + Intronic
948857908 2:240738835-240738857 CAGACAGGAGAGAAGGAAGAGGG - Intronic
948995445 2:241576064-241576086 CTGGCAGGGGAGGAGGAGGAGGG - Intergenic
949003001 2:241628129-241628151 CAGAATGGAGAGAAGGGGGCTGG - Intronic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1168776541 20:452811-452833 TAGTCTGAGGAAAAGGAGGAAGG + Intronic
1168953283 20:1817240-1817262 CAGCCTTGGCAGAAGGAGGTGGG + Intergenic
1169082732 20:2807091-2807113 CAGAGTGGTGGGAAGGGGGATGG - Intergenic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1169867236 20:10215266-10215288 CAGTATGGTGAGAAGGAAGAAGG - Intergenic
1169908083 20:10623786-10623808 CAGGCTGAGGAGCAGGGGGATGG - Exonic
1170006457 20:11675132-11675154 CACTCTGAGGAGGAGGAGGAAGG - Intergenic
1170793281 20:19525460-19525482 ACGGCTGGGGAGAAGGAGGCTGG + Intronic
1171040319 20:21756829-21756851 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1171091714 20:22291437-22291459 GGGACTGGGGGGAAAGAGGAGGG + Intergenic
1171161388 20:22927288-22927310 TAGGCTGAGGAGGAGGAGGAAGG - Intergenic
1171322699 20:24260415-24260437 CAGTATGGGGAGAAGAAAGATGG - Intergenic
1171797418 20:29577316-29577338 ATGACTGGGGAGGAAGAGGATGG + Intergenic
1171974924 20:31588154-31588176 CCTTCTGGGGAGAAGCAGGAGGG - Intergenic
1172506550 20:35467075-35467097 CAGTGTGGGGAGAAGAAGGGAGG + Intronic
1172621690 20:36321688-36321710 CAGAGTTGGGAGAACGAGCATGG + Intronic
1172813607 20:37669442-37669464 AAGACAGGGAAAAAGGAGGAAGG - Intergenic
1173227191 20:41168842-41168864 CAGAATGTGGAGAAGCAAGAGGG + Exonic
1173338213 20:42130453-42130475 GAGATTGGAGAGAAGGAGAAAGG - Intronic
1173538983 20:43837603-43837625 TAGGCTGGGGAGGAAGAGGAGGG + Intergenic
1173781586 20:45761076-45761098 CAGCCTGGGGAGGAGGAGAAAGG - Intronic
1173835639 20:46123498-46123520 AAAACTGAGGAGAAGCAGGAGGG - Intronic
1174476842 20:50801820-50801842 GGGACTGAGGGGAAGGAGGATGG + Intronic
1174581702 20:51576855-51576877 CAGACTGGGGAGGAGGGGCCTGG + Intergenic
1174750176 20:53104239-53104261 CAGACTGGGGGGTGGGGGGAAGG + Intronic
1175056275 20:56201496-56201518 CATCATGGGGAGAGGGAGGAAGG + Intergenic
1175260859 20:57673229-57673251 GAGAATGGGCAGCAGGAGGAGGG - Intronic
1175400193 20:58695930-58695952 CAGTCTGGGGAGCAGCGGGAGGG - Intronic
1175954743 20:62603532-62603554 TGGCCTGGGGAGAAGGGGGAAGG + Intergenic
1176160040 20:63643096-63643118 CAGACAGGGAAGCTGGAGGAAGG - Intronic
1176231090 20:64033286-64033308 AAGACTGTGGAGAAGGTGGTAGG + Intronic
1176236153 20:64054458-64054480 CTGGCAGGGGAGAAGGAGGCTGG - Intronic
1176283492 20:64328370-64328392 CAGACTGGGAAGTAGGCGAAGGG + Intergenic
1176549359 21:8214667-8214689 GAGACGGGGGAGGAGGAGGACGG - Intergenic
1176557252 21:8258890-8258912 GAGACGGGGGAGGAGGAGGACGG - Intergenic
1176576194 21:8441925-8441947 GAGACGGGGGAGGAGGAGGACGG - Intergenic
1177351185 21:19944019-19944041 CGGAGTGGGGAGTAGAAGGAGGG - Intergenic
1177833942 21:26170203-26170225 CAGACAGGGGGGAAGGGGGAAGG - Intronic
1178001102 21:28162825-28162847 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
1178165700 21:29973609-29973631 TAGACTATTGAGAAGGAGGAAGG - Intergenic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1178956448 21:37026668-37026690 CAGACTGTGGAGAGTGGGGAAGG - Intergenic
1179171864 21:38979395-38979417 GAGGCTGGGGAGAAAGGGGAAGG - Intergenic
1179399408 21:41070110-41070132 CACTCTGGGGAGAGTGAGGAGGG - Intergenic
1179480932 21:41678250-41678272 CAGGCAGGGGAGAAGAAGGTTGG + Intergenic
1179546886 21:42118606-42118628 CAGTCTGGGGAGAGGTAGGGAGG + Intronic
1179549036 21:42131567-42131589 GAAGCTGGGGAGCAGGAGGAGGG + Intronic
1179562969 21:42228428-42228450 CAGGCAGGGGAGGAGGAGCAGGG - Intronic
1179884984 21:44309996-44310018 CTGGTTGGGGAGAAGGCGGAGGG + Intronic
1180059101 21:45375533-45375555 CAGGCTGGGGGGATGGAGGAGGG + Intergenic
1181100166 22:20533594-20533616 CAGAGTGGGGCCAAGGAGCAAGG - Intronic
1181162851 22:20968016-20968038 GAGACGGGGGAGGAGGAGGCGGG - Intronic
1181182373 22:21077346-21077368 AAACCTGGGGAGAAGGTGGAGGG - Intergenic
1182057300 22:27369661-27369683 CAGAGTGAGGGGGAGGAGGAGGG + Intergenic
1182103750 22:27674534-27674556 AGGAGTGGGGAGAGGGAGGAAGG - Intergenic
1182415859 22:30221124-30221146 CAGACGGGGAATCAGGAGGAGGG + Intergenic
1182522451 22:30892100-30892122 AAGCCTGGGGAGATGGAGGTGGG + Intronic
1182645023 22:31801388-31801410 CACACTGGGGAGCAGGAGAAGGG - Intronic
1182848090 22:33447799-33447821 GAGAGTGGGTGGAAGGAGGAAGG + Intronic
1183023058 22:35042948-35042970 CAGACTGAAGAGAAAGAAGAAGG + Intergenic
1183168640 22:36167130-36167152 AAGAGTGGGAAGGAGGAGGAGGG + Intergenic
1183248546 22:36712032-36712054 CAGGATGGGGAGAGGGCGGAGGG + Intergenic
1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG + Intronic
1183808964 22:40237928-40237950 AAGACTGGGCAAAAGAAGGATGG - Intronic
1184203329 22:42984475-42984497 CAGTCTGGGGAGATGCAAGATGG - Intronic
1184324772 22:43774774-43774796 CAGCCTGGGCAAAAGGGGGATGG + Intronic
1184412335 22:44332379-44332401 GGGAGTGGGGAGGAGGAGGAAGG - Intergenic
1184572772 22:45337051-45337073 CAAACCTGGGAGGAGGAGGAGGG - Intronic
1184988046 22:48148838-48148860 CAGAGTGGGGGGCAGGGGGAAGG - Intergenic
1185295200 22:50049665-50049687 CAGGCAGGGGTGGAGGAGGAGGG + Intronic
1185380174 22:50504334-50504356 CAGCCTGGGGAGCAGGGGTAAGG - Exonic
1203254244 22_KI270733v1_random:130983-131005 GAGACGGGGGAGGAGGAGGACGG - Intergenic
1203262300 22_KI270733v1_random:176062-176084 GAGACGGGGGAGGAGGAGGACGG - Intergenic
949134039 3:540986-541008 CAGAATGGAGGGAAGGAAGAGGG - Intergenic
949372054 3:3346065-3346087 TAGACTGTGGAGAATGAGAAAGG + Intergenic
949628537 3:5895489-5895511 CAGATGGGGAAGTAGGAGGATGG - Intergenic
949754495 3:7393166-7393188 GAGACAGGGGAGAAGGGGCATGG - Intronic
949779854 3:7674011-7674033 CTGACTGGGGAGATGGGGAATGG + Intronic
950163073 3:10774456-10774478 AGGGCTGGGGAGAAGGAGGCAGG + Intergenic
950264310 3:11562969-11562991 CAGGCTGGGGAGAGGGAGACAGG + Intronic
950435374 3:12976236-12976258 GACACTGGGGAAAAGCAGGAGGG + Intronic
950948644 3:16976722-16976744 GAGAGTGGGGAGATGGAGGGAGG + Intronic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
951632577 3:24737626-24737648 CAGAATGGGGTGAAGCGGGACGG + Intergenic
953015938 3:39076129-39076151 CAGACTGTTGTGTAGGAGGAAGG + Intronic
953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
953590577 3:44248877-44248899 CAGATTGGGGAGAATTTGGAAGG + Intronic
953721759 3:45362245-45362267 CAGCCTGGAGATAAAGAGGAGGG - Intergenic
953834560 3:46331489-46331511 CAGCCTGGGGAGGAGGAGAGAGG + Intergenic
954047397 3:47944350-47944372 CAGACTGTGGAGAATGAGAAAGG - Intronic
954421382 3:50420823-50420845 CAGGCTGGGGGCAAGGAGGAAGG - Intronic
954617011 3:51974313-51974335 CAAGCTGGGGATAAGGGGGATGG - Intronic
954626315 3:52023865-52023887 CAGCCAGGGGAGAAGGAGGGAGG - Intergenic
954713132 3:52514682-52514704 CAGGCTGGGGAGAGGGATGGAGG - Exonic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955514294 3:59711510-59711532 GAGAAGGAGGAGAAGGAGGAGGG - Intergenic
955566225 3:60249715-60249737 CACACACGGGAGAAGGGGGAAGG + Intronic
955683064 3:61522566-61522588 CACACTGTGGAGGAGGGGGAAGG + Intergenic
955850996 3:63219785-63219807 TAGACTGAGGAGGAGGAGGAAGG + Intergenic
956084735 3:65597507-65597529 CAGGCTGGGAGGAAGGGGGAGGG - Intronic
956122059 3:65976381-65976403 CACTGTGGGGAGACGGAGGAGGG + Intronic
956530487 3:70212345-70212367 CAGTTTGGGGAGAAGAATGAGGG - Intergenic
956624322 3:71251949-71251971 CAGCTTGGGGAGTAGGAGGTGGG - Intronic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956847338 3:73195671-73195693 CAGGGTGGGGAGTGGGAGGAAGG - Intergenic
957224435 3:77425582-77425604 AAGACTGGGTATGAGGAGGATGG + Intronic
957377309 3:79375269-79375291 CAGAGTTGGGAAGAGGAGGAAGG + Intronic
957617599 3:82551330-82551352 CAGACTTGGAAGATAGAGGAAGG - Intergenic
957640771 3:82850346-82850368 GACAATGAGGAGAAGGAGGAGGG - Intergenic
958676913 3:97277036-97277058 CAGCCTGGGGAGGAGGGGAAAGG + Intronic
959268749 3:104177321-104177343 GAGAGTGGAGAGCAGGAGGAGGG - Intergenic
959543814 3:107570816-107570838 CAGACAGGAGAGAAAGAAGAAGG + Intronic
959559730 3:107765765-107765787 GAGACTGGGGAATGGGAGGATGG + Intronic
959560323 3:107772341-107772363 AAGACCTGGAAGAAGGAGGAAGG - Intronic
959670469 3:108971575-108971597 TAGACTGGGGAGAGGAAGGTGGG + Intronic
959678551 3:109066012-109066034 AAGACGGGGGAGAGGGAGGCAGG + Intronic
960034578 3:113089376-113089398 CAGACTGGGGAAAATGAAGTGGG - Intergenic
960172557 3:114479095-114479117 CAGGATGGGGGGAAGAAGGAAGG + Intronic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960361413 3:116716368-116716390 CAGTTTGGGGAGGTGGAGGAGGG + Intronic
960530671 3:118760711-118760733 CTAACTGGGGAGAAGGAGCAGGG - Intergenic
960788357 3:121399150-121399172 CACACTGATGAGGAGGAGGAAGG - Intronic
961087786 3:124084055-124084077 CTAAATGGGGAGAAGGAGAAAGG + Intronic
961168285 3:124778653-124778675 GAGATGGGGGACAAGGAGGATGG + Intronic
961311730 3:126006628-126006650 CAGATTGGGGTGGAGCAGGAAGG - Intronic
961508730 3:127388462-127388484 CAGGCTGGGGGGTAGAAGGAAGG - Intergenic
961563697 3:127748364-127748386 CAGAGGTGGGAGAGGGAGGAGGG + Intronic
961834619 3:129646798-129646820 CAGATTGGGGAGGCAGAGGAAGG - Intergenic
962234093 3:133693154-133693176 GCGACTAGGGATAAGGAGGAAGG - Intergenic
962261776 3:133914962-133914984 CAGACTGGGGAGTAGGGAGACGG + Intergenic
962445736 3:135462485-135462507 GAGAGTGGGGAAAAGTAGGATGG + Intergenic
962545472 3:136429776-136429798 TACACTGGGGAGGAGGAAGAGGG - Intronic
962982814 3:140506302-140506324 AAGAATGGGCAGAAGGAGGGAGG - Intronic
963468520 3:145712024-145712046 CAGCCTGGGGAGGAGGGGGGAGG - Intergenic
963677964 3:148337674-148337696 TAGTCAGGGGAAAAGGAGGATGG - Intergenic
964125550 3:153230775-153230797 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
964411776 3:156405295-156405317 AAGACTGGAGAGCAGGAGGTGGG - Intronic
964441716 3:156718169-156718191 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
965210281 3:165777776-165777798 TAGGCTGAGGAGTAGGAGGAGGG - Intronic
965259120 3:166457410-166457432 CAGACTTGGGAGACTGAGGCAGG - Intergenic
965359591 3:167722068-167722090 AAACCTGGGGAAAAGGAGGATGG + Intronic
965626410 3:170687403-170687425 CAGCCTGGGGAGGAGGGGAAAGG + Intronic
966031387 3:175352292-175352314 GAGGCTGAGGAGAAGAAGGAAGG + Intronic
966398554 3:179525081-179525103 CAGACAGGAGAGAAAGAAGAAGG + Intergenic
966533655 3:181007782-181007804 CAGACCGGAGGGAGGGAGGATGG - Intergenic
966616380 3:181917962-181917984 AAGAGAGGGGAGGAGGAGGAAGG + Intergenic
966951228 3:184819992-184820014 TAGGCTGAGGAGGAGGAGGAGGG + Intronic
967005465 3:185378605-185378627 CAGCCTGGGGAGAAGGGGAGAGG + Intronic
967151999 3:186659283-186659305 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
967258905 3:187622414-187622436 CTGTCTAGGGAGATGGAGGATGG - Intergenic
967359444 3:188612888-188612910 CAGGATGGGGAAAAGGAGAAAGG + Intronic
968073277 3:195801507-195801529 CAGGCAGGAGAGAAGGAGAAAGG - Intronic
968078175 3:195828304-195828326 CCAACTGAGGAGGAGGAGGAGGG + Intergenic
968413415 4:407930-407952 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
968446666 4:655568-655590 CAGCCTGGGGAGGAGGAAGAAGG + Intronic
968518682 4:1025393-1025415 CAGACTGGGAGGATGGAGGACGG + Exonic
968557653 4:1255689-1255711 TGCACTGGGGAGAAGGAGGAGGG - Intergenic
968577432 4:1374430-1374452 CAGGCTGTGGTGCAGGAGGAGGG + Intronic
968652499 4:1765842-1765864 CAGAGTGGGGAGAAGGGAGGAGG + Intergenic
968809712 4:2794354-2794376 CAGAGTGGGAAGAACCAGGAGGG - Intronic
968844939 4:3035834-3035856 CACACTGGGGTGACGGGGGAGGG - Intronic
968887840 4:3344813-3344835 CTTACTGGGGCCAAGGAGGATGG + Intronic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
969355206 4:6621020-6621042 CAGTGTGGTGAGAAGGAGGCTGG + Intronic
969418137 4:7074416-7074438 GAGACTGGAGCGACGGAGGAAGG - Intergenic
969429090 4:7143350-7143372 TTGTCTGGGGAGAGGGAGGAAGG + Intergenic
969722058 4:8897613-8897635 CAGACAGGAGAGAAGGAGGAGGG - Intergenic
970006808 4:11418842-11418864 CAGACTGGGGAGAAAGCACATGG + Intronic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970492069 4:16584804-16584826 AGGAGTGGGGAGAAGCAGGAAGG + Intronic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971323359 4:25623307-25623329 CAGCCTCTGGAGGAGGAGGAGGG - Intergenic
972102585 4:35441066-35441088 GAGAGTGGTGAGAAAGAGGAGGG + Intergenic
972217038 4:36909186-36909208 CAGTCTGAGGAGAGGCAGGAGGG - Intergenic
972253519 4:37330448-37330470 CAGACTGGGGAGAAAGCCGGTGG + Intronic
972350955 4:38235880-38235902 CATACTGAGTAGACGGAGGAGGG + Intergenic
972658327 4:41088559-41088581 AAGACTTGGGAGAAGGAAGGAGG + Intronic
972687935 4:41369183-41369205 TAGACTGGGAAGATGGGGGAGGG - Intronic
973973610 4:56240312-56240334 CAGACTGGGGAGGGGGAGTAGGG + Intronic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
975116796 4:70688879-70688901 CAGAGTGGAGACGAGGAGGATGG + Exonic
975151963 4:71032762-71032784 CAGACAGGAGAGAAAGAAGAAGG - Intergenic
975152019 4:71033076-71033098 CAGACAGGAGAGAAAGAAGAAGG - Intergenic
975404192 4:73969803-73969825 CAGAGTGCTGAGAAGGAGCATGG + Intergenic
975634973 4:76439188-76439210 CAGACTTTGAAGATGGAGGAAGG - Intronic
975660340 4:76682202-76682224 CTGACTGGGAAGAAAGATGAAGG + Intronic
975668311 4:76755121-76755143 CAGTGTGGGGAGGAGGTGGAGGG - Exonic
975891137 4:79029140-79029162 CAGGCAGGAGAGAGGGAGGAGGG - Intergenic
976052191 4:81022360-81022382 CAGACAGGGGAGAAGGAAAGAGG + Intergenic
976153863 4:82121299-82121321 CAGGCAGGCGAGAAGGAGGAAGG + Intergenic
976977880 4:91186297-91186319 CACACTGATGAGGAGGAGGAAGG - Intronic
977568532 4:98607151-98607173 CAGAGCGGGGAAAATGAGGAGGG - Intronic
977578142 4:98696458-98696480 CAGGCTGGGGAGTGGGAAGAGGG + Intergenic
977855464 4:101885338-101885360 TAAACTGGAGAGAAGGAGAAGGG - Intronic
978830706 4:113080870-113080892 CAGAATGGAGAGGAAGAGGATGG + Intronic
978875699 4:113637992-113638014 CATATTTGGGAGAAGGAGGATGG - Intronic
978923785 4:114217754-114217776 CTGACAGGTGGGAAGGAGGAGGG + Intergenic
979274828 4:118803411-118803433 AAGACTAGGGAGATGGGGGAGGG - Intronic
980729133 4:136804661-136804683 CAGAGAGGGGAGATGGAGGGAGG - Intergenic
981197744 4:141940893-141940915 CATACTGATGAGGAGGAGGAAGG - Intergenic
981786303 4:148483101-148483123 CAGACTGGGGTGGGGGAGGATGG - Intergenic
981951824 4:150418975-150418997 CAGCCTGGGGGAAAGGAGAAGGG + Intronic
982039776 4:151385251-151385273 CAGACTGGGGTGGAGGTGGGGGG + Intergenic
982086298 4:151840203-151840225 CAGACTGGGGGTGGGGAGGATGG - Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983552558 4:169032417-169032439 AAGAAGGGAGAGAAGGAGGAAGG - Intergenic
983589337 4:169390392-169390414 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
983647895 4:170010512-170010534 TAGACTGAGGAGGAGGGGGAGGG - Intronic
983742184 4:171149656-171149678 CATACTGGCAAGGAGGAGGAAGG - Intergenic
983907742 4:173202449-173202471 CGAAATGGGGAGGAGGAGGAGGG + Intronic
984171326 4:176362744-176362766 TAGAGAGGGGAGAAGGAGAAGGG - Intergenic
984179504 4:176464314-176464336 CAGATGTGGGAGCAGGAGGATGG + Intergenic
984456958 4:179981972-179981994 CAGCCTGGGGTGAAGGAGAGAGG + Intergenic
984847641 4:184121181-184121203 TAGAATAGGGAAAAGGAGGAGGG - Intronic
984948184 4:184986281-184986303 CAGACCTGGGGGAAGAAGGAAGG - Intergenic
985085743 4:186310642-186310664 GAGACTGGGGGGCGGGAGGAGGG - Intergenic
985285753 4:188335131-188335153 CAGCCTGGAGAGCAGGAGGGAGG + Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985582267 5:704446-704468 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
985673969 5:1220841-1220863 CAGAATGGGGGGTTGGAGGAGGG - Intronic
985966805 5:3343846-3343868 GAGACTGGGAAGAAGCAGGGTGG + Intergenic
986062995 5:4209331-4209353 GGGTCTGGGGAGAAGGATGATGG + Intergenic
986251241 5:6060319-6060341 GAGCCTGGGGAGCAGGTGGAAGG + Intergenic
986439174 5:7763574-7763596 GGGGCTGGGGAGAGGGAGGATGG - Intronic
986467151 5:8037285-8037307 CACACTGATGAGGAGGAGGAGGG - Intergenic
986636048 5:9823560-9823582 CAGAAAGGGGGGAAAGAGGAAGG + Intergenic
986779891 5:11055624-11055646 CTAACTGGGGAGATGGAGGTGGG - Intronic
987034130 5:14003498-14003520 CAGAGAGGTGAGAGGGAGGAAGG - Intergenic
987213056 5:15704112-15704134 GAGAGTGCTGAGAAGGAGGAGGG + Intronic
987578313 5:19758043-19758065 CAGACTGGGGAAGAGAAGGCAGG + Intronic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
988288904 5:29258836-29258858 GCAACTGGGGACAAGGAGGAGGG + Intergenic
988553137 5:32215053-32215075 CAGATTGGAGAGAAACAGGAAGG + Intergenic
988824079 5:34916859-34916881 CAGATTGGGGGGCAGGGGGAGGG + Intronic
989068839 5:37489936-37489958 GACACTGGGGGGAAGGGGGAGGG - Intronic
989197203 5:38727158-38727180 AAGACTGGGGAGAAGGGGCCTGG + Intergenic
989231845 5:39095836-39095858 CACACTGGGGTGAGGGAGGGAGG + Intergenic
989664512 5:43838132-43838154 CAGACTGGGGAGCACAAGAATGG + Intergenic
989684922 5:44074428-44074450 CATACTGAGGAAAAGGAAGAAGG + Intergenic
990731078 5:58810144-58810166 GAGACTGGACTGAAGGAGGAGGG - Intronic
991651986 5:68865112-68865134 CAGAGTGGGCAGAAGCAGGGTGG + Intergenic
991946174 5:71900409-71900431 CAGGCTGGGGAAAAGAAGGCAGG - Intergenic
992093327 5:73338844-73338866 CAGAGCGGGGAGAGGGAGGAGGG + Intergenic
992452152 5:76884812-76884834 CAGCCTGGGGAGAAGGGGAGAGG + Intronic
992590168 5:78286433-78286455 CTTACTGGGCAGAAGGTGGAAGG - Intronic
992595225 5:78339925-78339947 CAGACTCAGGAAAAAGAGGAAGG - Intergenic
992680204 5:79145446-79145468 TAGCATGGGGAGAGGGAGGAGGG - Intronic
992761260 5:79952626-79952648 CACACATGGGAGGAGGAGGATGG - Intergenic
993111600 5:83663632-83663654 CAGATTTGGGCGAGGGAGGAGGG - Intronic
993457236 5:88141201-88141223 CAGACGAGGGAAAGGGAGGAAGG - Intergenic
993704700 5:91156265-91156287 AAGTCAGGGGAGAAGAAGGAAGG + Intronic
993821626 5:92624677-92624699 CTGACTGGGGAGAATAAAGATGG - Intergenic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
994501400 5:100583183-100583205 TAGGCTGAAGAGAAGGAGGAAGG + Intronic
994779090 5:104068590-104068612 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
995001949 5:107143878-107143900 CAGATTGGGGAGCAGCAGGCAGG + Intergenic
995002079 5:107145408-107145430 CAGATTGGGGAGCAGCAGGCAGG + Intergenic
995125299 5:108572874-108572896 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
995550193 5:113273886-113273908 CAGACTTGGGAGATGAAGGAAGG - Intronic
995562258 5:113395604-113395626 CAGCCTGGGGGGAAAGAGGGAGG - Intronic
995915996 5:117245617-117245639 CATACTGGAGAGAATGAAGAAGG + Intergenic
996392173 5:122973517-122973539 CAGGCTGGGGAGGAGAAGGCTGG + Intronic
996407137 5:123116800-123116822 TAGACTGGGGAGAAATAGTAAGG + Intronic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
998387421 5:141765769-141765791 GAGATTGGAGAGCAGGAGGATGG - Intergenic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
999132550 5:149295600-149295622 GAGAATGGAGAGAAAGAGGAAGG + Intronic
999257049 5:150215594-150215616 CAGCCTGGGGAGAAAGAGGCTGG + Intronic
999375976 5:151086865-151086887 AAGACAGTGGAGAAGGAGGCTGG + Intronic
999461600 5:151761436-151761458 CAGGCTTGGGAGAGGGAGCATGG + Intronic
999585536 5:153085740-153085762 GAGAATGGAGAGAAGGAAGAAGG + Intergenic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
1001129580 5:169052869-169052891 CAGAGTGGGGTGAGGGAGGGTGG - Intronic
1001568408 5:172714991-172715013 AGGCCTCGGGAGAAGGAGGAGGG - Intergenic
1001581720 5:172803103-172803125 CAGCCTGGGGACATGGAGGGAGG + Intergenic
1001664941 5:173424759-173424781 CAGGCTGGTGAGAAGGAAGATGG - Intergenic
1001732045 5:173967899-173967921 CACCCTGGGGAGAACGATGAGGG - Intergenic
1002390984 5:178911476-178911498 CAGACGGCAGAGGAGGAGGAAGG - Intronic
1002400554 5:178989409-178989431 CAGACAGGGAAGAAGGGGGAGGG + Intronic
1002531815 5:179851421-179851443 CAGTCTGGGGAGAAACAGAAAGG + Intronic
1002681325 5:180967558-180967580 GAGAATGGGGAAGAGGAGGAGGG - Intergenic
1002744694 5:181461076-181461098 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1002930561 6:1631664-1631686 TGGATTGGGGAGAAGGAGGAAGG - Intronic
1002934744 6:1661953-1661975 TACACTGGGGAGATGGAGGAAGG + Intronic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1003273229 6:4625367-4625389 CAGACTTGGGAGGAGGAGAACGG + Intergenic
1003380675 6:5621892-5621914 CAGACTGGCCAGCAGAAGGAAGG - Intronic
1003405079 6:5821316-5821338 CAGCCTGGGGATGGGGAGGAGGG - Intergenic
1003418286 6:5932826-5932848 GAGGCTGGGAAGAATGAGGAAGG + Intergenic
1003584683 6:7376686-7376708 CAGAGTTGGAGGAAGGAGGAGGG - Intronic
1003661556 6:8067024-8067046 CAGGGTGGGGACAGGGAGGAAGG - Intronic
1004120363 6:12815747-12815769 TAGACTGGGGAAAAGGACAAAGG - Intronic
1004943285 6:20584497-20584519 CAGTGTGGGGAGAGGAAGGAAGG + Intronic
1005385242 6:25279272-25279294 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1005704314 6:28436223-28436245 CAGACTGCAGAGATGCAGGAAGG - Exonic
1005786677 6:29251297-29251319 CAGCCTGGGGAGGAGGGGCAAGG + Intergenic
1005940725 6:30557417-30557439 GAGACTGGAGATGAGGAGGATGG + Exonic
1006518096 6:34555734-34555756 CAGTCTGGGGAGCATGAGGAGGG + Intronic
1006574131 6:35031530-35031552 CAAAATGGGGAGGAGGAGGAAGG - Intronic
1006719605 6:36141809-36141831 CAGACTGGCGTGAAGAGGGAAGG - Intronic
1006817498 6:36862350-36862372 CAGGCTGTGGAGGAGGAGGCTGG - Intronic
1006964987 6:37974308-37974330 CAGTCTGGGGAGGCCGAGGAGGG - Intronic
1007377440 6:41466538-41466560 AAGAGAGGGAAGAAGGAGGAAGG + Intergenic
1007725829 6:43915071-43915093 CAGCCTGGGCACATGGAGGAGGG + Intergenic
1007937029 6:45741584-45741606 CAGAGTGGGCAGAAACAGGAGGG - Intergenic
1008016420 6:46525596-46525618 CAGACTGAGGATGAGGAAGAAGG + Intergenic
1008246135 6:49175926-49175948 GAGAAAGGGGAGTAGGAGGAAGG + Intergenic
1008252511 6:49257690-49257712 CATGCTGGGGAGAAGGTGAAGGG - Intergenic
1008321837 6:50123691-50123713 CAGGCTGTGGATCAGGAGGATGG - Intergenic
1008651976 6:53573321-53573343 CAGCCTGGGGAGAAGAACCATGG - Intronic
1008673971 6:53799850-53799872 CAAAATGGAGAGAAGAAGGAAGG - Intronic
1010046230 6:71447304-71447326 CTGTCTGGGGAGAAGGGGCAGGG + Intergenic
1011114657 6:83876943-83876965 CAGACTGGGGAGGCTGAGGCAGG - Intronic
1012512201 6:100014831-100014853 CAGGCTGGAGAGAAAGAGGAGGG + Intergenic
1012750001 6:103147848-103147870 CAGATTGGGGATAAGGATGGGGG + Intergenic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1013760420 6:113511327-113511349 CAGACAGAGGAAAAGGAGCATGG - Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014115449 6:117663774-117663796 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1014754488 6:125288267-125288289 CAGACAGGGGAGGGGGAGAAAGG + Intronic
1014820395 6:125982795-125982817 CTGCCTGAGGAAAAGGAGGATGG - Intergenic
1015514911 6:134073954-134073976 GAGAATGGTGAGAAGGAAGAGGG + Intergenic
1015881369 6:137873323-137873345 GAGACTGCGGTGAATGAGGAAGG + Intronic
1016003555 6:139066911-139066933 GAAAATGGAGAGAAGGAGGAAGG - Intergenic
1016058916 6:139607950-139607972 GAGAATTGGGAAAAGGAGGAAGG - Intergenic
1016126907 6:140414929-140414951 AGGACTGGGGAGAAGGAGGGAGG - Intergenic
1016622290 6:146125693-146125715 CAGAATGGAGAAAAGGAGGGGGG - Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016924478 6:149329226-149329248 CAGACTTGGGAGGAAGAGGCAGG + Intronic
1016985356 6:149890772-149890794 CTGGCTGAGGACAAGGAGGAGGG - Intronic
1017058144 6:150456234-150456256 AGGACTGAGGAGAAGGAAGAGGG - Intergenic
1017068279 6:150549815-150549837 TAGAGTGGAGAGAGGGAGGAAGG + Intergenic
1017516143 6:155157240-155157262 TAGACGGGGGTGAAGCAGGAAGG - Intronic
1017609361 6:156168059-156168081 CAGGCTGGAGGGAGGGAGGAAGG + Intergenic
1017810727 6:157981791-157981813 GCGAGTGGGGAGGAGGAGGAAGG + Intergenic
1018053254 6:160030053-160030075 CAGACTGGGAAGAGAGAGGGAGG - Intronic
1018700165 6:166420046-166420068 CAAGCTGGGGACCAGGAGGAGGG + Intronic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1019249605 6:170734617-170734639 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1019536699 7:1533206-1533228 CACAGTGCGGAGAAGCAGGAAGG - Intronic
1019650455 7:2154907-2154929 CAGCCTGTGGAGAAGGACGGAGG + Intronic
1019778375 7:2925684-2925706 CAGGATGGGGAGAAGTAGGGAGG - Intronic
1020367640 7:7397249-7397271 CAGACTGGAGTGCAGGAAGATGG - Intronic
1020530171 7:9323159-9323181 AAGAATGGGGAGAAGGAAGGAGG + Intergenic
1020684601 7:11277945-11277967 AAGACTTGGGAGAAATAGGAGGG - Intergenic
1021146345 7:17093805-17093827 CAGCTTGGGGAGAAGGGGTAGGG - Intergenic
1021301643 7:18980799-18980821 GAGACGGAGGAGAAGGAAGAAGG - Intronic
1021660520 7:22914765-22914787 CAGACTGGGGAGGAGGGGAGAGG - Intergenic
1021785865 7:24152079-24152101 CAGACTGGGGAGAAGGAGAAGGG - Intergenic
1022102386 7:27176110-27176132 CAGGGTGCGGAGGAGGAGGATGG + Intronic
1022103713 7:27184119-27184141 CAGGCTGGGGAGCCGGAGGTGGG - Intronic
1022141992 7:27500676-27500698 CAAACCAGGGAGAAGGAGGAGGG + Intergenic
1022342955 7:29486020-29486042 CAGGCTGGGCAGGAGGTGGAAGG - Intronic
1022451582 7:30520811-30520833 CAGAGTGGAGAGAGGCAGGAAGG + Intronic
1022537439 7:31106807-31106829 CTGAGGGGGGAGAAGGAGGCAGG + Exonic
1022756678 7:33300229-33300251 GAGACTGGAGAGAGGGAGGAAGG - Intronic
1022786133 7:33639232-33639254 ATGGCTGGGGAGAGGGAGGAGGG + Intergenic
1022846073 7:34211165-34211187 CTGACCAGGGAAAAGGAGGAAGG - Intergenic
1022955167 7:35374067-35374089 AAGACAGAGGAGAAGGAAGAGGG - Intergenic
1023525257 7:41095846-41095868 CAGGCTGGGGAGAAGACAGAGGG + Intergenic
1023727902 7:43163444-43163466 AAGACTGGGGAGATGGAGGCAGG + Intronic
1023754893 7:43407406-43407428 CAGGCTGGGGTGAAGGAGTGAGG - Intronic
1024168259 7:46756739-46756761 GAGAAGGGAGAGAAGGAGGAAGG + Intronic
1024266825 7:47613133-47613155 AACACTGGGGAGAGGGAGGGAGG - Intergenic
1024376242 7:48641907-48641929 CATACTGCTGAGAAGGGGGATGG + Intronic
1024820309 7:53321880-53321902 CAGACTGGGGAGACCCAGCAAGG + Intergenic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1025827742 7:65024319-65024341 CACCCTGGTGAGAAGGAGCATGG - Intergenic
1025915277 7:65860773-65860795 CACCCTGGTGAGAAGGAGCATGG - Intergenic
1026176324 7:68000981-68001003 GAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1026401827 7:70021682-70021704 CAGATTGAGGAGCAGCAGGAAGG - Intronic
1026662088 7:72311113-72311135 TAGACTGAAGAGGAGGAGGAGGG - Intronic
1026809568 7:73451529-73451551 CAGACTGGGGAGAGGGATGAGGG + Intronic
1027464509 7:78498740-78498762 CAAACTGGGGGTAAGGTGGAGGG + Intronic
1027464935 7:78503593-78503615 AAGGAGGGGGAGAAGGAGGAGGG - Intronic
1027900667 7:84110265-84110287 AAAACTAGGGAGCAGGAGGAAGG - Intronic
1028249357 7:88522781-88522803 CAGGCTGTGGAGAAGGAGCAGGG + Intergenic
1028382164 7:90211832-90211854 CAGCCAGGGGAGAAGGAAGGAGG - Exonic
1028985714 7:97006731-97006753 CAGCCTGGAGGGAAGGAGCAAGG - Intronic
1029086922 7:98019042-98019064 GAGCCTGGGGATAAGGGGGATGG - Intergenic
1029536365 7:101160115-101160137 CAGAGTGGGGAAAAGGCAGAGGG - Intronic
1029628291 7:101734115-101734137 CAGATGGGTGAGAAGGGGGATGG - Intergenic
1029955211 7:104631517-104631539 AAGACTGGGTTGGAGGAGGAGGG + Intronic
1029996655 7:105013718-105013740 CAGACTGGGCTGGGGGAGGAGGG + Intergenic
1030035518 7:105405310-105405332 AGGGCAGGGGAGAAGGAGGAGGG + Intergenic
1030253911 7:107484900-107484922 CAGACTGTGTAGAAAGAGGAGGG + Intronic
1030829119 7:114198785-114198807 AAGAGTGGGGAGAAGGAGAGAGG + Intronic
1031296505 7:120010444-120010466 GGGACTGGGGAGAGGCAGGAGGG - Intergenic
1031564194 7:123274650-123274672 CTGAATGGGCACAAGGAGGAAGG - Intergenic
1032123581 7:129174564-129174586 CAGGCTTGGAAGATGGAGGATGG - Intergenic
1032475607 7:132209536-132209558 CAGCCAGGGGAGGAGGGGGATGG + Intronic
1032529329 7:132607314-132607336 CAGGAGGGGGAGAAGGTGGAAGG - Intronic
1032536265 7:132667152-132667174 GAGCCTGGGGAGAAGGAGACAGG + Intronic
1032616816 7:133481830-133481852 CAGAAAGGAGTGAAGGAGGAGGG + Intronic
1032675868 7:134129269-134129291 CAGAGTGGAGGGAGGGAGGAAGG - Intronic
1033084613 7:138330651-138330673 CAGCCTGGGGAGAAGGGGAGAGG - Intergenic
1033256581 7:139806748-139806770 CAGACAGATGAGAGGGAGGATGG - Intronic
1033537890 7:142328839-142328861 GAGTCTGGGGTGAGGGAGGAGGG - Intergenic
1033590191 7:142802342-142802364 CAGACTGGGGAGAAAATGCAGGG + Intergenic
1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG + Intronic
1033625483 7:143106471-143106493 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
1034242212 7:149619294-149619316 TAGACTGAGGAGGAAGAGGAGGG - Intergenic
1034422130 7:150995801-150995823 GGGACGGGGGAGAGGGAGGAGGG - Intronic
1034422173 7:150995900-150995922 GGGACAGGGGAGAGGGAGGAGGG - Intronic
1034422236 7:150996065-150996087 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034422264 7:150996131-150996153 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034649647 7:152679752-152679774 CAGACTGGAGGGTGGGAGGAGGG + Intergenic
1034704439 7:153127822-153127844 AAGACTGGAGGGCAGGAGGAAGG + Intergenic
1034732552 7:153400553-153400575 TAGAGGGGAGAGAAGGAGGAAGG + Intergenic
1034779366 7:153863729-153863751 TGGTCTGGGGAGTAGGAGGAAGG - Intergenic
1034840518 7:154391329-154391351 CAGACTGGGAAGACTGGGGATGG - Intronic
1034888790 7:154820739-154820761 GAGATTGGGGAGAAGGAAGGGGG + Intronic
1034923385 7:155101808-155101830 CCGGCTTGGGAGATGGAGGAAGG - Intergenic
1035239566 7:157520929-157520951 GAGACTGGGGAGGAGGAGGGTGG + Intergenic
1035304661 7:157924079-157924101 CACGCTGGGGAGCTGGAGGAGGG + Intronic
1035498491 8:73039-73061 AGGAGTGGGGAGGAGGAGGAGGG - Intronic
1036517227 8:9455513-9455535 ACTACTGGGGAGAGGGAGGAGGG + Intergenic
1036975389 8:13405291-13405313 CACAGAGGGGAGAAGGAGGGAGG - Intronic
1037297105 8:17413209-17413231 GAGATGGGGGAGGAGGAGGAGGG - Intronic
1037498445 8:19462966-19462988 CAGGGTGGAGAGTAGGAGGAGGG - Intronic
1037691100 8:21182335-21182357 GAGAGTGGGGAGAAGGGGAAGGG + Intergenic
1037716812 8:21407904-21407926 CAGAGTGGGGAGGAGGAAGGTGG - Intergenic
1037870402 8:22489379-22489401 TATACTGGGGAGAGGGAGTAAGG - Intronic
1038400331 8:27279656-27279678 TAGACAGGGGAGAGGGAGGAAGG + Intergenic
1038609734 8:29049305-29049327 CGCAATGGGGAGGAGGAGGAGGG + Intronic
1038900842 8:31841994-31842016 TAGAATGGGGAGGAGGAGGAGGG - Intronic
1039499102 8:38002766-38002788 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
1040521519 8:48180196-48180218 GAGAGTGAGGAGAAGGAGAAGGG + Intergenic
1041080942 8:54214350-54214372 CACACTGGGAAGAATGATGATGG - Intergenic
1041237956 8:55823775-55823797 AAACCTGGGGAGGAGGAGGAAGG + Intronic
1041241876 8:55855159-55855181 GAGAAGGGGGAGAAGAAGGAAGG - Intergenic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1041917644 8:63152392-63152414 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1042084053 8:65088708-65088730 GAGCCTGGGGGCAAGGAGGAAGG + Intergenic
1042188393 8:66160146-66160168 GAGACTTGGGAGAAAGAGTAGGG - Intronic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1043296382 8:78668151-78668173 GGGAGAGGGGAGAAGGAGGAAGG - Intronic
1044184602 8:89236505-89236527 CAGTCTGGGGAGAGTCAGGAGGG + Intergenic
1044221074 8:89670166-89670188 CAGACAGGGGAGAGGGAGAGAGG - Intergenic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045949021 8:107830539-107830561 CAGAATTGGGAGAAGGGGAAAGG - Intergenic
1046711173 8:117513203-117513225 CAGAATGGTGAGGAGGAGGAGGG - Intergenic
1046789702 8:118307866-118307888 AAGACTGGAAAGAAGGAGAAAGG + Intronic
1047011027 8:120672912-120672934 GAGACTGGAGGGCAGGAGGAAGG + Intronic
1047298870 8:123596002-123596024 CAGCCAGTGAAGAAGGAGGAGGG + Intergenic
1047671706 8:127155073-127155095 CGGAATGGTGAGAAGGAAGATGG + Intergenic
1047762649 8:127965598-127965620 CAGAGTGGAGAGAACAAGGAAGG - Intergenic
1047961285 8:130013871-130013893 CAGAATGGGCAGAAGAATGATGG - Intronic
1048303433 8:133267467-133267489 CAGAGAGGGGAGAAGGGAGATGG - Intronic
1048462384 8:134632148-134632170 TAGGCTGAGGAGAAAGAGGAGGG - Intronic
1048550904 8:135432917-135432939 CAGCCTTGGGAGAGGGAGGGAGG + Intergenic
1049361883 8:142215883-142215905 CAGCCTGGGGTGCAGGCGGAGGG - Intronic
1049415251 8:142492072-142492094 CAGACAGAGGAGAGGGTGGATGG - Intronic
1049529502 8:143147331-143147353 GAGTTTGGAGAGAAGGAGGATGG + Intergenic
1049659102 8:143811763-143811785 CTCACTGGGGAGATGGAGAAAGG - Intronic
1050140373 9:2511044-2511066 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
1050345351 9:4680167-4680189 CAGGAAGGGGAGATGGAGGAAGG - Intronic
1050474066 9:6021605-6021627 CAGCCTGGGGAGGAGGAGAGAGG - Intergenic
1051052531 9:12949976-12949998 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
1051105732 9:13577893-13577915 GAGAATGGGAAAAAGGAGGAGGG + Intergenic
1051284909 9:15486005-15486027 CAGAAGGGGGAGAAAGAGAAAGG - Exonic
1051414585 9:16825608-16825630 CTTCCTGGGGAGGAGGAGGAGGG + Intronic
1052872468 9:33521662-33521684 GAGACTGGGGAGAGGGAGCAAGG - Intergenic
1053196465 9:36122987-36123009 CAAGCTGAGGGGAAGGAGGAGGG - Exonic
1053594810 9:39548973-39548995 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1053852595 9:42304006-42304028 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1054571443 9:66815994-66816016 CTGACTGTGAAGATGGAGGAAGG - Intergenic
1054975779 9:71143330-71143352 GAGAGTGGGGAGTGGGAGGAGGG - Intronic
1055266071 9:74497565-74497587 TGGACTGAGGAGGAGGAGGAAGG - Exonic
1055455206 9:76465649-76465671 CACCCTGGGGAGGAGGAGGGTGG + Intronic
1055489659 9:76791926-76791948 GGGGCTGGGGAGAAGGAGGGAGG + Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1055766330 9:79667332-79667354 CAGCCTGGCGAGAAGGAGAAGGG - Intronic
1056367274 9:85918263-85918285 GAGAGAGGGGAGAGGGAGGAAGG - Intergenic
1056809710 9:89754762-89754784 CGGCCTGGTGAGAAGGAGGTGGG - Intergenic
1057231581 9:93324662-93324684 GAGGCTGGGGAGAGGGAAGAGGG + Intronic
1057236508 9:93365955-93365977 GAGGCTGGGGAGAGGGAAGAGGG - Intergenic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057815548 9:98291461-98291483 CAGACGGGAGAGAGGAAGGATGG - Intronic
1057884779 9:98822070-98822092 CAAACTAGGCAGGAGGAGGAGGG - Intronic
1058026302 9:100144758-100144780 CAGCCTGGGGAGGAGGGGAAAGG + Intronic
1058078559 9:100676171-100676193 CAGAGTTGGAAGAAGGAGGTGGG + Intergenic
1058203339 9:102070907-102070929 GTGACTGGGGAAATGGAGGATGG - Intergenic
1058419414 9:104820066-104820088 CAGCCTGGGGACAGGGAGGCAGG + Exonic
1058803573 9:108568051-108568073 CAGACAGGGGAGAAAGATGGGGG - Intergenic
1059353802 9:113684580-113684602 CAAACCGGGGGGAAGGAGGATGG + Intergenic
1059431215 9:114251436-114251458 CAGAAGGGGAAGGAGGAGGAGGG - Intronic
1059465026 9:114463344-114463366 GAGACTGGGGAGAAGGAAAATGG - Intronic
1059662061 9:116411531-116411553 CAGCCTGAGGAGAAGGAGTTTGG - Intergenic
1059671652 9:116497714-116497736 CAGGCTGGGGAGAAGGGGGAGGG + Intronic
1059679467 9:116572195-116572217 CAGCCTGGGGAGGAGAAGGCAGG - Intronic
1059722988 9:116979730-116979752 CAGGCTGGGGTGGATGAGGAGGG + Intronic
1060005019 9:119992192-119992214 CTGACTGGGAGGGAGGAGGAGGG - Intergenic
1060135322 9:121147921-121147943 CAGACTGAGAAGGAGAAGGAGGG + Intronic
1060504763 9:124189496-124189518 TAGGCTGGGGAGGAGGAGGAGGG + Intergenic
1060590031 9:124810813-124810835 GAGACCGGGGAGATGGGGGAGGG - Exonic
1060610941 9:124963881-124963903 TAGGCTGTGGAGGAGGAGGAGGG + Intronic
1060620122 9:125057666-125057688 CCGAGTGTGGAGGAGGAGGAGGG + Intronic
1060686878 9:125622821-125622843 GAGACTGGGGAGACGGAGAGGGG - Intronic
1060716118 9:125930796-125930818 CAGACAAGGGATATGGAGGATGG - Intronic
1061011278 9:127956043-127956065 AAGACTGGGGACAAGCAGAAAGG + Intronic
1061218378 9:129235086-129235108 CAGATTGGGGGAAAGGAGGCCGG - Intergenic
1061394625 9:130337250-130337272 CAGACTGGGGAGGACAACGATGG + Intronic
1061418168 9:130459287-130459309 CAGCTTGGGAAGATGGAGGACGG - Intronic
1061446061 9:130638824-130638846 GAGGCTGGGGACAAGGAGGTGGG - Intergenic
1061507664 9:131040691-131040713 CAGGCTGGGGAGAGGGGGCAGGG - Intronic
1061577035 9:131513816-131513838 CAGTCAGGGAGGAAGGAGGAGGG - Intronic
1061623660 9:131827769-131827791 CAGCCTGGGGAGCAGGAGCGGGG + Intergenic
1061637119 9:131919102-131919124 GGGAGTAGGGAGAAGGAGGATGG + Intronic
1061702369 9:132425413-132425435 CAGCATGGGGATAAGGAGGGGGG - Intronic
1061836909 9:133335610-133335632 CGGTGTGGGGAGGAGGAGGATGG - Intronic
1061929530 9:133825257-133825279 GAGACTGGAGAGACGGAAGACGG - Intronic
1061954641 9:133955420-133955442 GAGAGTGGGGAGAAGCAGGGGGG - Intronic
1061989194 9:134149013-134149035 GTCACTGGGGAGGAGGAGGACGG + Intronic
1062255831 9:135620123-135620145 GAGAAGGGGGAGAAGGAGTAGGG - Intergenic
1062542910 9:137049423-137049445 CAGACTGGGGTGAGGGAGGTGGG - Intronic
1062578968 9:137221407-137221429 CAGTCCTGGGAGGAGGAGGAAGG + Intronic
1062676969 9:137752367-137752389 GACACCGGGGAGGAGGAGGAAGG + Exonic
1062708807 9:137960394-137960416 CTGACTGGGGGGGAGGGGGAGGG + Intronic
1203470645 Un_GL000220v1:114127-114149 GAGACGGGGGAGGAGGAGGACGG - Intergenic
1203478466 Un_GL000220v1:158099-158121 GAGACGGGGGAGGAGGAGGACGG - Intergenic
1203610505 Un_KI270748v1:91555-91577 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1186006726 X:5080270-5080292 CAGACTGGGGCCATGGGGGAGGG + Intergenic
1186162548 X:6792932-6792954 CAGCCTGGGGAGAAAGTTGAGGG + Intergenic
1186417588 X:9397356-9397378 CAGCCTGGGCAGCAGAAGGAGGG - Intergenic
1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG + Intronic
1187110294 X:16291810-16291832 CAACCTTGGGAGAAGGAGGAAGG - Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1188000312 X:24974245-24974267 CAAGTTGGGGAGAAGCAGGAGGG + Intronic
1188026562 X:25216328-25216350 GAAAGGGGGGAGAAGGAGGAAGG - Intergenic
1189197098 X:39162060-39162082 GAGAAAGGGGAGGAGGAGGAAGG - Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190002724 X:46705151-46705173 CACACAGGGGAGAAAGGGGAAGG + Intronic
1190153038 X:47964568-47964590 CAGAAGGGGGAGAGGGAAGAGGG + Intronic
1190635297 X:52426956-52426978 CAGGCTGGGGCACAGGAGGAAGG + Intergenic
1190881320 X:54494876-54494898 CAGACAGAGGAGAAGGGGGTTGG + Intronic
1190885760 X:54530034-54530056 CGGAGGAGGGAGAAGGAGGACGG - Intergenic
1191580832 X:62758996-62759018 CACACTGGTGAGGAGGAGGAAGG - Intergenic
1191853176 X:65601402-65601424 GAGTCAGGGGAGAGGGAGGAAGG - Intronic
1192105816 X:68315270-68315292 AAGAGGGGGGAGAAGGAGGTAGG + Intronic
1192180272 X:68911971-68911993 AGGTCTGGGGAGGAGGAGGATGG - Intergenic
1192359926 X:70433015-70433037 AAGCCTGGGGAGGAGGGGGAGGG - Exonic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1193536957 X:82728174-82728196 CAGCCTGGGGAGAAGGGGAGAGG - Intergenic
1193908760 X:87277024-87277046 CAGGGTGGGGAGAAGGCGAAGGG - Intergenic
1194399192 X:93421953-93421975 CAGACTTGGGATAGGGAGAAGGG - Intergenic
1194764104 X:97829300-97829322 GAGATCAGGGAGAAGGAGGAAGG - Intergenic
1194792992 X:98174105-98174127 GAGACTGGGAAGAAAGAGAAGGG - Intergenic
1195496874 X:105546430-105546452 TAAAATGGAGAGAAGGAGGAAGG + Intronic
1195580619 X:106497001-106497023 CTGGCTGGGGACAAGGAGAATGG - Intergenic
1196811952 X:119635949-119635971 CAGGATGGAGTGAAGGAGGAGGG + Intronic
1197625877 X:128801955-128801977 CTTTCTGGGGAGAATGAGGATGG - Intergenic
1197707727 X:129646548-129646570 CGGAGAGGGGAGAAGAAGGAAGG - Exonic
1197868373 X:131042439-131042461 CAGAGTCTGGAGAAAGAGGATGG + Intergenic
1198965823 X:142228168-142228190 CAGCCTGGGGAGAAGGGGAGAGG - Intergenic
1199665200 X:150090944-150090966 GAGAATGTGGAGAAGGTGGATGG + Intergenic
1200744093 Y:6888130-6888152 GAGACTGTGGAGAAATAGGAAGG - Intergenic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic
1201540766 Y:15102675-15102697 CAGTCTGGGGAGGAGGAGAGAGG + Intergenic
1201672862 Y:16543828-16543850 CAGAGTGAGGGGTAGGAGGAAGG - Intergenic
1202270966 Y:23073652-23073674 CAGAAAGGGAAGAAGGGGGATGG + Intergenic
1202295060 Y:23347030-23347052 CAGAAAGGGAAGAAGGGGGATGG - Intergenic
1202423961 Y:24707396-24707418 CAGAAAGGGAAGAAGGGGGATGG + Intergenic
1202446828 Y:24962689-24962711 CAGAAAGGGAAGAAGGGGGATGG - Intergenic