ID: 1152516513

View in Genome Browser
Species Human (GRCh38)
Location 17:80827935-80827957
Sequence ACAGCCTGGCCCTACCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152516513_1152516519 22 Left 1152516513 17:80827935-80827957 CCTGCATGGTAGGGCCAGGCTGT 0: 1
1: 0
2: 1
3: 23
4: 221
Right 1152516519 17:80827980-80828002 CCTGCCCCATGCTGACTTAGCGG 0: 1
1: 0
2: 1
3: 18
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152516513 Original CRISPR ACAGCCTGGCCCTACCATGC AGG (reversed) Intronic
901363142 1:8721219-8721241 ACAGCCTGGGACTTCCCTGCAGG + Intronic
901399203 1:9004643-9004665 AGAGCCTGTCCCCACCTTGCTGG + Intronic
901462463 1:9399889-9399911 TCAGCCTGGCCCAGCCCTGCTGG + Intergenic
901936142 1:12628484-12628506 CGAGACTGGCCATACCATGCAGG - Intergenic
904774444 1:32898111-32898133 CCAGCCTGGCCATACCACGATGG + Exonic
905212183 1:36381957-36381979 AGAGGCAGGCCCTACCATGGAGG - Intronic
906138171 1:43515122-43515144 ACAGCCTCTCCCTGCCAGGCTGG + Intergenic
906204901 1:43981479-43981501 ACAGGCAGGCCCTACCCTCCAGG - Intronic
906240347 1:44238797-44238819 ACAGCCTGCATCTACCCTGCAGG + Intronic
918438133 1:184537790-184537812 ACAGGCATGCGCTACCATGCCGG + Intronic
919239166 1:194889476-194889498 ACGGCCTGGCACTAGCCTGCAGG + Intergenic
920369950 1:205472649-205472671 ACAGCAAGTGCCTACCATGCAGG + Intergenic
922364662 1:224852321-224852343 ACCGTCTGTCCGTACCATGCTGG - Intergenic
922751825 1:228073648-228073670 CCAGCCTTGCCCTCCCATGGTGG + Intergenic
923832635 1:237574880-237574902 AGAACCCAGCCCTACCATGCTGG + Intronic
924389910 1:243543153-243543175 ACAGCCAGGAGCTACCATGTGGG - Intronic
1064538542 10:16383013-16383035 AAAGCCTCTCCCTACCATGCAGG - Intergenic
1064630719 10:17308182-17308204 ACAGACTTGCACCACCATGCCGG + Intergenic
1069715083 10:70515436-70515458 CCAGCCTGGCTCTGCCCTGCTGG + Intronic
1070206815 10:74272415-74272437 ACAGGCGCGCACTACCATGCCGG + Intronic
1073456801 10:103641787-103641809 CCTGCCTCGCCCTACCATGTGGG - Intronic
1074774007 10:116753153-116753175 ACAGCCTGGCGCTGGCATGCTGG + Intergenic
1075747742 10:124739675-124739697 ACAGCTTGGCCAGACCACGCTGG - Intronic
1075962877 10:126584580-126584602 CCAGCCTGGCCTTCCCATTCAGG + Intronic
1076601150 10:131657852-131657874 CCCGCCTGGCCCTAGGATGCGGG - Intergenic
1076871140 10:133195727-133195749 ACAAGCTGGCCCTGCCACGCAGG + Exonic
1077118410 11:895850-895872 ACTGCCTGCCCCTGCCATGCTGG + Intronic
1077156282 11:1093140-1093162 ACAGCCTGGCTGCACCAGGCCGG - Intergenic
1077350323 11:2090257-2090279 TCTGCCTGGCCCTGCCATGCGGG - Intergenic
1080852015 11:36078346-36078368 ACAGCTTGGCACTGCCCTGCAGG - Intronic
1081986102 11:47305596-47305618 ACAGCCAAGCCCCACCATCCTGG - Intronic
1082905293 11:58301238-58301260 AGAGCCTGGTCTTCCCATGCAGG - Intergenic
1086420508 11:86633095-86633117 TCAGCCTGGCCACACAATGCTGG - Intronic
1087807074 11:102566503-102566525 CGAGGCTGGCCCTGCCATGCAGG - Intergenic
1089527532 11:119107261-119107283 ACAGCCTGGCGCTCCCTCGCTGG - Exonic
1089813987 11:121156314-121156336 ACAGGCATGCACTACCATGCTGG + Intronic
1090947966 11:131448449-131448471 GCAGCCTGGCCCTTCCAGGGAGG + Intronic
1091272274 11:134325814-134325836 ACAGCCATGCTCCACCATGCCGG + Intergenic
1092264197 12:6968693-6968715 ACAGCCTGGCACTACCCTGGGGG + Intronic
1095158833 12:38891587-38891609 ACAGGCAGGCGCCACCATGCCGG + Intronic
1095205279 12:39432634-39432656 AGAGCCTGGCTCTATCACGCAGG + Intronic
1095526966 12:43138246-43138268 ACAGTCTGGCTCTACCACCCAGG - Intergenic
1099947750 12:89264229-89264251 ACAGCCAGACACTACCATGTTGG - Intergenic
1102242237 12:111331800-111331822 ACAGGCTTGAACTACCATGCCGG - Intronic
1103450585 12:121025938-121025960 ACAGCCTGGCACTTTCAGGCAGG - Intronic
1103669440 12:122600239-122600261 ACAGGCACGCACTACCATGCCGG + Intronic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1104924964 12:132309232-132309254 ACAGCCTGGATCTGCCATGCGGG + Intronic
1106974327 13:35189058-35189080 ACAGGCACGCCCCACCATGCTGG + Intronic
1108152641 13:47552352-47552374 CCAGCCAGGCCCTACATTGCGGG - Intergenic
1113790910 13:113027660-113027682 GCAGCCTTGCCCCACCAAGCCGG - Intronic
1115261887 14:31462694-31462716 ACAGTCTTGCCCTGTCATGCAGG - Intergenic
1118767275 14:68918234-68918256 CAAGCCTGCCCCTGCCATGCTGG - Intronic
1119211241 14:72833686-72833708 ACAGGCTGGTCACACCATGCTGG + Intronic
1119764665 14:77181054-77181076 ACAGCCTCTCCCTCCCAGGCAGG - Intronic
1121611722 14:95285464-95285486 ACATGCAGGCCCTACCTTGCTGG - Intronic
1121732300 14:96195110-96195132 CCAGCCAGGCCCTGCCAGGCAGG - Intergenic
1122389611 14:101371213-101371235 AGAGCTTTGCCCTACCCTGCTGG - Intergenic
1124619846 15:31267385-31267407 ACTTCCTGGCCCTGCCATGGAGG - Intergenic
1125730239 15:41888921-41888943 CCAGCCTGGCCCCACCATGCAGG - Intronic
1127506643 15:59604318-59604340 CAAGGCTGGCCATACCATGCAGG + Intronic
1128001467 15:64196591-64196613 ACAGGCGGGCACCACCATGCCGG + Intronic
1128819487 15:70639006-70639028 CCTGTCTGGCCTTACCATGCAGG - Intergenic
1129066314 15:72907213-72907235 AAAGTCTGGCTCTATCATGCAGG - Intergenic
1132063790 15:98713913-98713935 ACAGCCCGGCCCTGCCTTCCTGG - Intronic
1132394655 15:101463928-101463950 ACACCCTGGGGCTACCATGGGGG - Intronic
1132573167 16:652852-652874 ACAGCCTGGCCCCACACTGCTGG - Intronic
1132805821 16:1774632-1774654 ACAGCCTGGCCCCTGCCTGCGGG + Intronic
1132994439 16:2815603-2815625 ACAGCCTGGCCTTGGCCTGCTGG - Intergenic
1133553764 16:6884870-6884892 AGAGCCTTGCTCTGCCATGCAGG - Intronic
1133647953 16:7781961-7781983 ACAGCCAGGTGCCACCATGCCGG + Intergenic
1134058061 16:11182541-11182563 ACAGCCAAGCCCTACCTCGCAGG + Intergenic
1136034280 16:27527063-27527085 ACAGGCAAACCCTACCATGCTGG - Intronic
1136115744 16:28093251-28093273 ACACCGTGGCCTTACCTTGCTGG - Intergenic
1137009778 16:35310988-35311010 AGAGCCTGGCCCAATCAGGCTGG + Intergenic
1141082792 16:81067692-81067714 ACAGGCGTGCGCTACCATGCAGG + Intronic
1141465970 16:84206103-84206125 ACTGCCAGGCCCTACCCTGCTGG + Intergenic
1142123644 16:88399539-88399561 CCAGCCTGGCCCTCCCATGAAGG - Intergenic
1143205542 17:5137606-5137628 AGAACCTGGCCCTTCCAGGCTGG - Intronic
1144060972 17:11583223-11583245 ACAGCCTGGCACTGGCCTGCAGG - Intergenic
1144456956 17:15426649-15426671 ACAGCATGGCCTCCCCATGCAGG - Intergenic
1144876586 17:18400298-18400320 ACAACCTGGCCCTTCCAGGCTGG - Intergenic
1145005043 17:19332892-19332914 CCAGGCTGGCCCCACCATGTAGG + Intronic
1145155640 17:20544122-20544144 ACAACCTGGCCCTTCCAGGCTGG + Intergenic
1145763653 17:27443188-27443210 ACAGCCTGGCACCATCAGGCTGG + Intergenic
1146278561 17:31530595-31530617 ACAGCCTTGCCCTGTCATGTGGG - Intronic
1146937791 17:36823503-36823525 CCAGCCTGGCCCTACCCTGGTGG + Intergenic
1147205687 17:38835763-38835785 CCAGCCTGGCTCCACCATCCTGG - Intronic
1147318592 17:39632834-39632856 CCAGCCTGGCCCTACCCCTCTGG + Intronic
1147472854 17:40680114-40680136 ACAGGCATGCCCCACCATGCTGG + Intergenic
1148158986 17:45439402-45439424 ACAGCCTGGCCCAAGCACGCAGG - Intronic
1149349651 17:55773936-55773958 TCAGCCTGGCCCTCCCGTGGGGG - Intronic
1150052754 17:61980882-61980904 ACAGGCACGCCCCACCATGCTGG + Intronic
1150202249 17:63369742-63369764 ACAGGCATGCCCCACCATGCCGG + Intronic
1150390342 17:64786492-64786514 ACAGCCTGGCCCAAGCACGCAGG - Intergenic
1151193501 17:72415589-72415611 ACAGCCTGGCCCCATCGTGATGG - Intergenic
1152233381 17:79125901-79125923 ACAGCCTGTGCCACCCATGCAGG + Intronic
1152516513 17:80827935-80827957 ACAGCCTGGCCCTACCATGCAGG - Intronic
1153825814 18:8873826-8873848 ACAGCCAGGCCATGCCCTGCTGG - Intergenic
1158404716 18:57151135-57151157 ACAGGCAGGCCCTCCCCTGCAGG - Intergenic
1160765798 19:807115-807137 CCAGCCTGGCCCTCCCTCGCGGG + Intronic
1160860735 19:1236408-1236430 AGGGCCTGGCGCTACCTTGCAGG - Intronic
1161087687 19:2342816-2342838 CCATCCTGGCCCCACCATCCGGG + Intronic
1162546944 19:11336448-11336470 ACAGGCGGGAGCTACCATGCTGG + Intronic
1163300395 19:16441817-16441839 ACAGGCTGGCCCTGACCTGCGGG + Intronic
1163648946 19:18506005-18506027 GCAGCCTGGGCCCCCCATGCTGG + Intronic
1166953745 19:46448000-46448022 GCAGCCTGGCCTGGCCATGCTGG - Intergenic
1167166587 19:47803302-47803324 ACAGCCTGGGCCGATCATGTGGG + Intronic
1167175252 19:47860462-47860484 ACAGCCTGGGCCGATCATGTGGG - Intergenic
1167404916 19:49300056-49300078 GCATCCTGGCCCTTCCATGAGGG - Intronic
1168639573 19:58021730-58021752 ACAGGCTGGAGCCACCATGCCGG + Intergenic
925292206 2:2755489-2755511 ACTGCCTGCCTCCACCATGCAGG + Intergenic
929106538 2:38370810-38370832 ACAGGCTTGCACTACCCTGCTGG - Intronic
930728834 2:54708998-54709020 TCGGCCTGGCCCCACCATGGGGG - Intergenic
933731327 2:85458479-85458501 CCATCCTGGCCCTAGCATGGAGG + Intergenic
934972590 2:98775057-98775079 ACAGAACGGCCCTTCCATGCAGG - Intergenic
935925838 2:108067386-108067408 ACATCCTGCCTCTAGCATGCTGG - Intergenic
938240482 2:129739088-129739110 ACAGCCTGGCACTACCCCTCCGG - Intergenic
938656065 2:133435471-133435493 ACAGACTGGCTCTACCAGGTTGG + Intronic
939068093 2:137507894-137507916 AAAGCCTGGTTCTACAATGCTGG - Intronic
942764729 2:179441387-179441409 ACAGCCCGGCCAAACCCTGCTGG + Intergenic
946195980 2:218033356-218033378 CCAGCCTGTCCCCACCATCCTGG + Intergenic
947748337 2:232520688-232520710 CCAGCCTGGACTTACCTTGCAGG - Exonic
948599314 2:239099461-239099483 ACAGGCAGCCCCTCCCATGCTGG + Intronic
948990718 2:241552528-241552550 CCTGCCTGGCCCTACCACTCCGG - Intergenic
1170230191 20:14037871-14037893 ACAGGCTCGCACCACCATGCTGG - Intronic
1171385284 20:24765707-24765729 ACTGGCTGGGCCTCCCATGCAGG - Intergenic
1172308418 20:33898477-33898499 ACACCCTGGGCATCCCATGCTGG - Intergenic
1173514488 20:43655540-43655562 ACAGGCATGCACTACCATGCCGG + Intergenic
1174696133 20:52560752-52560774 ACAGCCTGGCCATTCCACCCAGG - Intergenic
1174864784 20:54125269-54125291 ACAGGCAGGAGCTACCATGCTGG - Intergenic
1175234745 20:57502126-57502148 ACAGCCAGGCCCTGCCTGGCAGG - Intronic
1176023197 20:62973000-62973022 GCAGCCCGGCCCTGCCCTGCTGG - Intergenic
1176377133 21:6092269-6092291 ACAGCCTGGCCCCTCCACTCCGG - Intergenic
1179746342 21:43445975-43445997 ACAGCCTGGCCCCTCCACTCCGG + Intergenic
1179910895 21:44448096-44448118 ACAGACACGCACTACCATGCAGG - Intergenic
1179971952 21:44840979-44841001 ACAGCCGGGCCTGACCATCCAGG - Intergenic
1180836471 22:18932135-18932157 ACACCCCTGCCCTACCCTGCAGG - Intronic
1181107080 22:20581919-20581941 AGAGCCTGGTTCTGCCATGCAGG - Intronic
1182079770 22:27520703-27520725 ACAGTCTCGTCCCACCATGCTGG + Intergenic
1182597882 22:31436202-31436224 AGAGCCTGCCCCAACCCTGCAGG + Intronic
1183344381 22:37299032-37299054 ACACCCTTGTCCTCCCATGCAGG - Intronic
1184294591 22:43515549-43515571 ACAGCCTGGCACTGCCAGTCAGG + Intergenic
1185328138 22:50237658-50237680 ACCGCCAGGCCCCACCGTGCCGG + Intronic
1185328153 22:50237701-50237723 ACCGCCGGGCCCCACCGTGCGGG + Intronic
1203286563 22_KI270734v1_random:157434-157456 ACACCCCTGCCCTACCCTGCAGG - Intergenic
949541874 3:5038885-5038907 ACAGGCAGGCACCACCATGCTGG - Intergenic
950633191 3:14297831-14297853 GCAGCCTGGCCCGACCCTCCTGG + Intergenic
952267456 3:31800426-31800448 CCAGCCTGGCCCTGGCATGATGG + Intronic
952539604 3:34353822-34353844 ACAGCCTGTCCATCCCATTCTGG - Intergenic
954417632 3:50401426-50401448 ACAGCCTGCCCCTTCCAGGCTGG - Intronic
955839775 3:63099458-63099480 ACAGCTTGGACCTGCTATGCTGG + Intergenic
960928780 3:122823061-122823083 TCAGCCTTGCCCTTCCATGTGGG + Intronic
961015851 3:123467720-123467742 ACAGACCAGTCCTACCATGCTGG - Intergenic
961525811 3:127496663-127496685 ACAGCCTGGCCCCACACTTCAGG - Intergenic
961649221 3:128409098-128409120 ACAGCCTGGGGCTACAAGGCAGG - Intergenic
962393786 3:134996461-134996483 ACAGCCATGCGCCACCATGCTGG + Intronic
962790377 3:138805869-138805891 ACAGGCATGCCCCACCATGCCGG + Intronic
963805108 3:149714598-149714620 ACAGCCTGGCGCTGGCCTGCAGG + Intronic
965702484 3:171472380-171472402 GCAGCCTGGCCACACCGTGCTGG + Intergenic
968762367 4:2449359-2449381 CCACCCTGGCCATCCCATGCTGG + Intronic
968887790 4:3344585-3344607 ACAACCTGCCCCTTCCCTGCTGG + Intronic
970322165 4:14885688-14885710 ACAGGCATGCCCCACCATGCTGG - Intergenic
977601590 4:98939221-98939243 ACAGGCGCGCCCCACCATGCCGG + Intergenic
979547093 4:121951337-121951359 ACTGCCTGGCCGTACCATGTGGG + Intronic
980973844 4:139591972-139591994 ACAGGCGTGCCCCACCATGCCGG + Intronic
984264217 4:177477103-177477125 ACAGGCTTGCGCCACCATGCCGG + Intergenic
984697839 4:182797295-182797317 ACAGGCATGCCCCACCATGCCGG - Intronic
984818541 4:183859659-183859681 CCAGCATGGCCCTTGCATGCAGG + Intronic
984864718 4:184271857-184271879 CCAGCCTGGCTTTCCCATGCTGG + Intergenic
985574056 5:665581-665603 ACAGCCAGGCCCCACCCTCCAGG + Intronic
985864506 5:2503744-2503766 ACAGGCTGGCCCTGCACTGCAGG - Intergenic
987600374 5:20060321-20060343 ACACACATGCCCTACCATGCTGG - Intronic
991434604 5:66584715-66584737 ACACCCTGAGACTACCATGCTGG - Intergenic
992648254 5:78832342-78832364 ACAGCCTCTCCCCACCCTGCTGG - Intronic
993719064 5:91304163-91304185 ACAGGCATGCTCTACCATGCTGG + Intergenic
994245440 5:97471321-97471343 ACAGCCTGGCACTGGCCTGCAGG - Intergenic
994730285 5:103483456-103483478 ACAGCCTGGCTCTGCCACCCAGG + Intergenic
997200264 5:132005796-132005818 ACAGCCTGGCCCACCAGTGCAGG - Intronic
997433173 5:133855467-133855489 AGAGCCTGGCCTTACCACACTGG - Intergenic
997482581 5:134198705-134198727 ACAGGCAGGCGCCACCATGCTGG + Intronic
997690496 5:135824707-135824729 CCAGCCTGGCCCTTCCTGGCTGG + Intergenic
997904345 5:137800252-137800274 ACAGCCTGGCCCTAAAATGTAGG + Intergenic
999314512 5:150575269-150575291 CCATCCTGGCCCTGCCATGGAGG + Intergenic
999913920 5:156236973-156236995 ACAGGCAGGCACCACCATGCCGG + Intronic
1000527771 5:162379748-162379770 AAAGCCTCGGCCTACCCTGCTGG - Intergenic
1001870970 5:175155639-175155661 ACAGCCTGGGCAGATCATGCAGG + Intergenic
1002379609 5:178817101-178817123 ACAGGCAGGCGCCACCATGCGGG - Intergenic
1007061828 6:38947639-38947661 ACACCCAGGCCCTGGCATGCAGG + Intronic
1013121147 6:107142388-107142410 ACAGCCATGCGCCACCATGCTGG + Intergenic
1013600756 6:111702731-111702753 ACAGCCAAGCCCTACCATTAAGG + Intronic
1014966241 6:127755883-127755905 ACAGCCATGCACCACCATGCTGG - Intronic
1016924903 6:149334967-149334989 ATAGCCTGACAATACCATGCTGG - Intronic
1017822424 6:158059346-158059368 ACAGCCTGGCCTTACCTTGAAGG - Exonic
1018337420 6:162808730-162808752 ACAGATTGCCCCTACCATTCAGG + Intronic
1019738342 7:2661186-2661208 ACAGCCAGGCCACAGCATGCAGG - Intronic
1023335212 7:39161933-39161955 ACAGCGTTACTCTACCATGCAGG - Intronic
1023703042 7:42911728-42911750 ACAGCCGGGCCCTGCCAGGAGGG + Intronic
1025814648 7:64900266-64900288 ACAGCCTTGTGCCACCATGCCGG + Intronic
1026126307 7:67582709-67582731 ACAGGCATGCACTACCATGCTGG - Intergenic
1027396709 7:77763770-77763792 GCAGCCTGGACCTGCCAGGCTGG + Intronic
1029282893 7:99448095-99448117 ACACCCTGTCCCTATCTTGCCGG + Intronic
1029714530 7:102318740-102318762 CCAGGTTGGCCCCACCATGCAGG + Intronic
1034353904 7:150435629-150435651 ACAGCCAGGCCCTGCCTTCCTGG + Intergenic
1034578122 7:152019196-152019218 AAAGTCTGGCCCTGCCATTCAGG - Intronic
1034964040 7:155380735-155380757 CCAGCCTGGCCCCAGCCTGCTGG + Intergenic
1036280684 8:7397927-7397949 ACAGCCTGGCCCGGCCTTGCAGG + Intergenic
1036340782 8:7913646-7913668 ACAGCCTGGCCCGGCCTTGCAGG - Intergenic
1037884382 8:22588730-22588752 CCAGCCTGTCCCTACTCTGCTGG - Intronic
1038854440 8:31315782-31315804 ACAGCATGGCCTTATCATGATGG + Intergenic
1039464025 8:37770717-37770739 ACAGGCACGCCCCACCATGCTGG + Intronic
1040514808 8:48126142-48126164 ACAGTCTGGCTCTTCCTTGCAGG + Intergenic
1041138105 8:54782569-54782591 ACAGCCTGTCCCTAGAGTGCAGG - Intergenic
1042734620 8:71974398-71974420 ACAGGCTTGCACCACCATGCTGG - Intronic
1042923606 8:73943782-73943804 ACAGGCATGCCCTACCATGCCGG - Intronic
1044409503 8:91868039-91868061 ACAGCCTGGCACTGGCCTGCAGG + Intergenic
1046209663 8:111052901-111052923 ACAGCCTCCTGCTACCATGCCGG + Intergenic
1046898131 8:119495202-119495224 ACAGGCATGCACTACCATGCTGG + Intergenic
1049280553 8:141741942-141741964 ACAGCCTGGGCTCACCATGGAGG - Intergenic
1049519765 8:143082114-143082136 ACAGCCTGGACCACCCCTGCCGG - Intronic
1049800039 8:144513441-144513463 ACAGCCGAGGCCTACCACGCGGG - Exonic
1050025464 9:1330355-1330377 ACAGGCAGGCACAACCATGCTGG - Intergenic
1050356868 9:4792371-4792393 ACAGGATGGCTCTACCTTGCAGG + Intergenic
1051689195 9:19691325-19691347 ACAGCCTGGCCCTGTCCTGTGGG - Intronic
1052340277 9:27358143-27358165 ACAGCCTGGCCCTAGTACTCTGG + Intronic
1053028777 9:34756578-34756600 ACAGCATGGCACTACCATAAAGG - Intergenic
1056165882 9:83940489-83940511 ACAGCCAGTGCCTACCTTGCAGG - Intronic
1056265778 9:84895524-84895546 ACAGCCAGGCCCTGCCTTTCTGG - Intronic
1056887428 9:90456966-90456988 AGAGCCTGTCCCTGCAATGCAGG + Intergenic
1056916395 9:90750173-90750195 ACAGGCATGCACTACCATGCCGG - Intergenic
1057211395 9:93202853-93202875 GCAGCCTAGCCCTTCCAAGCCGG - Intronic
1057865175 9:98674698-98674720 GCAGTTTGGCCCCACCATGCTGG - Intronic
1058137059 9:101318630-101318652 ACAGGCATGCGCTACCATGCCGG - Intronic
1060651445 9:125330458-125330480 ACAGACATGCCCCACCATGCCGG + Intronic
1061006705 9:127932229-127932251 ACAGCCGCGTGCTACCATGCTGG + Intergenic
1061855039 9:133437396-133437418 ACAGGCTTGCACTACCATGCCGG + Intronic
1062173929 9:135150519-135150541 GCAGCCTGGACCCACCATGTGGG - Intergenic
1062638743 9:137505968-137505990 ACAGCCAGGGCCTACCTTGCTGG + Exonic
1187276984 X:17824869-17824891 ACAGCCTGCATCTACCGTGCAGG + Intronic
1189512996 X:41682409-41682431 ACAGGCACGCGCTACCATGCTGG - Intronic
1190277132 X:48906075-48906097 ACAGCCTGGCCCCAGAATCCAGG + Intronic
1192527338 X:71858980-71859002 ACTGCCAGGCTCTACCTTGCAGG + Intergenic
1192661006 X:73043009-73043031 ACAGCCTGATCCCACCATGTGGG + Intergenic
1195901990 X:109808609-109808631 ACAGGCATGCACTACCATGCTGG - Intergenic
1197740095 X:129884671-129884693 ACAGGCGTGCGCTACCATGCCGG - Intergenic
1198527143 X:137512800-137512822 ACAGGCATGCCCCACCATGCCGG - Intergenic