ID: 1152520110

View in Genome Browser
Species Human (GRCh38)
Location 17:80850816-80850838
Sequence GCACCCTGGCCTGCAGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 380}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152520103_1152520110 2 Left 1152520103 17:80850791-80850813 CCGCCCTGCTCATCAGGTGCCCG 0: 1
1: 0
2: 0
3: 8
4: 175
Right 1152520110 17:80850816-80850838 GCACCCTGGCCTGCAGCACCTGG 0: 1
1: 0
2: 5
3: 48
4: 380
1152520100_1152520110 26 Left 1152520100 17:80850767-80850789 CCATGTACATCGGGGACTCCAAA 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1152520110 17:80850816-80850838 GCACCCTGGCCTGCAGCACCTGG 0: 1
1: 0
2: 5
3: 48
4: 380
1152520104_1152520110 -1 Left 1152520104 17:80850794-80850816 CCCTGCTCATCAGGTGCCCGAGG 0: 1
1: 0
2: 0
3: 7
4: 326
Right 1152520110 17:80850816-80850838 GCACCCTGGCCTGCAGCACCTGG 0: 1
1: 0
2: 5
3: 48
4: 380
1152520101_1152520110 8 Left 1152520101 17:80850785-80850807 CCAAAACCGCCCTGCTCATCAGG 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1152520110 17:80850816-80850838 GCACCCTGGCCTGCAGCACCTGG 0: 1
1: 0
2: 5
3: 48
4: 380
1152520106_1152520110 -2 Left 1152520106 17:80850795-80850817 CCTGCTCATCAGGTGCCCGAGGC 0: 1
1: 0
2: 0
3: 116
4: 5694
Right 1152520110 17:80850816-80850838 GCACCCTGGCCTGCAGCACCTGG 0: 1
1: 0
2: 5
3: 48
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152520110 Original CRISPR GCACCCTGGCCTGCAGCACC TGG Intronic
900410745 1:2511417-2511439 GACCCCTGACCTGGAGCACCGGG - Intronic
900431251 1:2604179-2604201 GCACCATGTCCTCCTGCACCAGG + Exonic
900474062 1:2868148-2868170 CCATCCCGGCCTGCAGCCCCAGG + Intergenic
900622091 1:3592185-3592207 GCCCCCAGGCCTGCAGGTCCCGG + Intronic
901525956 1:9823673-9823695 GCAGCCCGGCCAGCAGCAGCCGG + Exonic
902097814 1:13960859-13960881 GCCCCCTGTCCTGAAGCCCCAGG - Intergenic
902334416 1:15746880-15746902 GCACCCCGGCCTGCAGAGCCAGG + Exonic
906095787 1:43223074-43223096 GGACCCTGGCCAGCACCCCCAGG - Intronic
906791026 1:48658976-48658998 GCACCTTGGCATGTAGCAGCAGG + Intronic
907477435 1:54715071-54715093 CTAACCAGGCCTGCAGCACCTGG + Intronic
910760800 1:90729560-90729582 GGACCCGAGCCTGCAGCTCCTGG - Intergenic
911857459 1:102898141-102898163 CCATCTTGGCCTGCAGCTCCAGG + Exonic
912454794 1:109790126-109790148 GCACCTTGGCCAGGAGAACCAGG - Intergenic
912881645 1:113422556-113422578 CCACCCTGCCCCGCAGCAGCTGG - Intronic
913694889 1:121315216-121315238 GCACTATGGCCTGAAGCTCCTGG + Intronic
915300211 1:154947419-154947441 GCAGCTGGGCCTGCAGCAGCCGG + Exonic
915311319 1:155007247-155007269 ACACCCTGCCCTGCTGCCCCTGG + Intronic
915349057 1:155213276-155213298 GCAGCTTTGCCTGCAGCAGCAGG - Exonic
915352244 1:155233903-155233925 GCAGCTTTGCCTGCAGCAGCAGG - Intergenic
915596879 1:156901143-156901165 CCACCCTGGCTTCCAGCCCCTGG + Intronic
917448604 1:175127780-175127802 GCACCCAGGACTGCAGCTTCAGG - Intronic
918002293 1:180508933-180508955 GCCCCCTGCTCCGCAGCACCCGG + Intergenic
918279615 1:182990971-182990993 GCACCCTGGCCTCCAGACTCTGG + Intergenic
919811762 1:201413091-201413113 CCACCTTGGCGTGCAGCTCCCGG + Exonic
919999002 1:202781067-202781089 GCACTTTGGGCTGCAGCAGCAGG + Intronic
920051658 1:203168073-203168095 CCCCTCAGGCCTGCAGCACCTGG + Exonic
920275069 1:204798548-204798570 GCTTCCTAGCCTGCAGTACCTGG - Intergenic
920564265 1:206960998-206961020 GCAACCAGGCCAGCAGCTCCAGG - Exonic
920678737 1:208056958-208056980 CCACCCTGGCCTGCAGGCACTGG - Intronic
920964503 1:210690805-210690827 GCACCCTGGCCTGAAGCTGGAGG + Intronic
922750048 1:228066022-228066044 GCACCCTGGGCTGCGGGCCCAGG + Intergenic
923473372 1:234311776-234311798 GAACCCTGACCTGGAGAACCAGG - Intronic
923517462 1:234709651-234709673 GCATCCTGACCAGCAGCCCCGGG - Intergenic
923616964 1:235546067-235546089 GCACTCTGGCCTGCACAACAGGG + Intergenic
923786058 1:237070657-237070679 CAACCCTGGCCTCCTGCACCTGG - Intronic
1062919595 10:1269918-1269940 CCACCCTGGCCACCAGCAACTGG - Intronic
1063609851 10:7553191-7553213 GCACTCTGCCCTCCAGTACCAGG + Intergenic
1064376564 10:14801856-14801878 GCTCCCTGGCCTTCTGCACCTGG + Intergenic
1065554957 10:26905873-26905895 ACCCCCTGCTCTGCAGCACCCGG + Intergenic
1067061410 10:43079793-43079815 CCACCCCTGCCTGAAGCACCAGG + Intronic
1067441280 10:46310364-46310386 GGACCCTGGCCTGGAGCACCAGG - Intronic
1067739395 10:48883055-48883077 GCACCCTGTCCCTCAGCAGCCGG + Intronic
1067852448 10:49762274-49762296 GCCCCCTGACCTGCAGCCTCCGG - Exonic
1069551743 10:69368832-69368854 GCACCCAGGCCTGGAGCAGGGGG + Intronic
1069667167 10:70170466-70170488 GCACACTAACCAGCAGCACCCGG + Exonic
1069753941 10:70761936-70761958 GCACCCTGCCCTGGGGCACTTGG - Exonic
1070172776 10:73944932-73944954 GCCCCCTGCTCTGCGGCACCTGG + Intergenic
1070721174 10:78758232-78758254 GCACCCTGTGCTGCAGGCCCAGG + Intergenic
1070754731 10:78984989-78985011 GCAACCTGGCACACAGCACCGGG - Intergenic
1070783856 10:79151971-79151993 GCCCCCTGGGCTGCTCCACCAGG + Intronic
1072190610 10:93073943-93073965 GCGCACTGGCCAGCAGCGCCGGG - Exonic
1072617787 10:97060778-97060800 TCTCCCTGGCCTGCAGAAACAGG + Exonic
1072709680 10:97707809-97707831 GCCCCCTGCCCTACAGCTCCAGG + Intergenic
1073101087 10:101007075-101007097 GCTCCCGGGCCTCCAGCTCCAGG - Exonic
1073291213 10:102414188-102414210 GCTCCCTGGCCTGCAGGGGCAGG + Exonic
1074496452 10:113983872-113983894 GAACCCTAGCCTGTAGCAACTGG + Intergenic
1075928463 10:126272728-126272750 GCACACAGACCAGCAGCACCCGG - Intronic
1076269133 10:129135268-129135290 AAACTCTGGCCTGCAGCACTGGG - Intergenic
1076371523 10:129959071-129959093 CCAGCCAGGCCTGCAGCGCCCGG - Intronic
1076733671 10:132449723-132449745 CCACTCTGGCCTTCAGCACGTGG + Intergenic
1076882873 10:133248079-133248101 GCTCCCGGGCCAGCAGCCCCCGG - Intergenic
1078139081 11:8678914-8678936 GCACACTTGCCTGCCTCACCAGG + Intergenic
1079116160 11:17641831-17641853 CCGCCCTGGCCTGTAGAACCAGG + Exonic
1079129757 11:17740616-17740638 ACACTCTGGCCTGCAGCACAAGG - Intronic
1079867655 11:25756418-25756440 TCCCCCTGCTCTGCAGCACCTGG + Intergenic
1080205937 11:29729170-29729192 GCACCCAGCACTGGAGCACCCGG - Intergenic
1081046355 11:38278633-38278655 GCCCCCTGCTCTGCAGCACCCGG - Intergenic
1081612427 11:44570600-44570622 GCCCACAGGCCTGAAGCACCAGG - Intronic
1082935744 11:58654818-58654840 GCAACCTGTCCACCAGCACCTGG + Intronic
1083789724 11:64976758-64976780 GCTCCATTTCCTGCAGCACCTGG + Intergenic
1084006973 11:66328313-66328335 GCACACTGGCCCACAGAACCAGG + Intergenic
1084016788 11:66388239-66388261 GCACCCTGGCCTGCTGGCCTGGG + Intergenic
1084023153 11:66430354-66430376 GCACCCTTGCCACCAACACCAGG + Intergenic
1084516662 11:69641388-69641410 TCAGCATGGCCCGCAGCACCCGG - Exonic
1084900794 11:72308436-72308458 TGACCCTGGCCCGCAGCAGCTGG + Intronic
1084909073 11:72373052-72373074 GCTCCAGGGCCTGCAGGACCTGG - Intronic
1085199704 11:74694425-74694447 GCAATTTGGCCTGCAGCATCAGG + Intergenic
1086324556 11:85685335-85685357 GCAGCCTGGCCTGCAGCTCCTGG + Exonic
1086425298 11:86676997-86677019 TCATCCAGCCCTGCAGCACCTGG + Intergenic
1088604251 11:111512912-111512934 GCACCCGCGGCTGCAGCTCCCGG - Intergenic
1088734274 11:112714183-112714205 GCAGCCCTGCCTGCAGCACCTGG - Intergenic
1089587830 11:119521257-119521279 GCACCATCGCCTCCAGCCCCTGG - Intergenic
1090116498 11:123979421-123979443 CCACTCTGACCTGCAGCTCCTGG + Intergenic
1090765851 11:129875598-129875620 GCACTCTGCCCTCCAGCAGCTGG + Intronic
1092249417 12:6884305-6884327 GCACCTTGGCCTGCAGGGCCTGG - Intronic
1092880135 12:12881786-12881808 CCACCCTGGCCTGCGGCAGGGGG - Intergenic
1094142795 12:27198307-27198329 ACTCCCTGGACTGCAGCACTGGG + Intergenic
1095687478 12:45051500-45051522 GGACGCTGGCCTGGAGCGCCCGG + Intergenic
1095925668 12:47576523-47576545 GCAGCCTGGGCTGCACCAACAGG + Intergenic
1099478670 12:83140255-83140277 GCACCCGGGCCAGCAGCTGCGGG + Intergenic
1102041833 12:109805914-109805936 GCACCTGTGCCTTCAGCACCAGG - Intronic
1102490726 12:113288248-113288270 CCACCCTGGCCTGCAGGTCCAGG + Intronic
1103098574 12:118152439-118152461 GCACCCTTGCCTACAGCCCTTGG + Intronic
1103146350 12:118598367-118598389 CCACCCTAGCCAGCTGCACCAGG - Intergenic
1103715147 12:122940797-122940819 GCGCCCTCACCTGCAGGACCTGG + Exonic
1103951487 12:124553994-124554016 GCACCCTCCCCTGCAGCTCCTGG + Intronic
1104760712 12:131296304-131296326 GCAACCTGGGCTACTGCACCTGG - Intergenic
1104819063 12:131664488-131664510 GCAACCTGGGCTACTGCACCTGG + Intergenic
1104898417 12:132175417-132175439 GTACCCTGCCCTGGAGCCCCAGG - Intergenic
1104939136 12:132386687-132386709 GGAGCCTGGCCTGCCGCACAGGG + Intergenic
1104942864 12:132403101-132403123 GCACCCGGCCCTGCGGCTCCTGG - Intergenic
1105304589 13:19159805-19159827 GCATCCTCTCCTACAGCACCAGG + Intergenic
1108593937 13:51934604-51934626 TCATCCTGCCCTGCAGCACGCGG - Exonic
1109649668 13:65309839-65309861 GCAGGCTGGCCTTCAACACCTGG + Intergenic
1113657684 13:112078504-112078526 GCTCCCTGGCCCGCAGTCCCAGG - Intergenic
1114648019 14:24266499-24266521 TATCACTGGCCTGCAGCACCTGG + Exonic
1116901010 14:50362225-50362247 GCCCCCTGCTCCGCAGCACCCGG + Intronic
1117790060 14:59331236-59331258 GGACCCTCGCCTGGAGCACCAGG + Exonic
1118765034 14:68903963-68903985 GCATCCTGGCTAGCAGCATCTGG + Intronic
1118839958 14:69502546-69502568 TCCCCCAGGCCTGCTGCACCTGG - Intronic
1120907089 14:89630210-89630232 CCAGCCTGGCCTGGAACACCTGG + Intronic
1121253161 14:92514130-92514152 GCCCCCTGCCCCGCAGAACCAGG - Intronic
1121313129 14:92945853-92945875 CCACCCTGAACTGCAGCGCCGGG - Intronic
1121632830 14:95433391-95433413 GCACCCGAGCCTCCAGCTCCTGG + Exonic
1121654930 14:95588298-95588320 GCACCCAGGCCTGGACCTCCAGG - Intergenic
1122141886 14:99667649-99667671 ACACCCTGGCCTCGAGGACCTGG + Intronic
1122902401 14:104787288-104787310 CCATCCTGGCCTGGAGCCCCAGG + Intronic
1123827591 15:24099281-24099303 GCACCCAGGGCTGCATCTCCAGG - Intergenic
1123842047 15:24258663-24258685 GCACCCGGGGCTGCATCTCCAGG - Intergenic
1123857064 15:24424741-24424763 GCACCCGGGGCTGCATCTCCAGG - Intergenic
1123861696 15:24475269-24475291 GCACCCGGGGCTGCATCTCCAGG - Intergenic
1123943189 15:25226435-25226457 GCACGTGGCCCTGCAGCACCAGG + Intergenic
1123998528 15:25735129-25735151 GCCCTCTCGCCTGCAGCACAAGG - Intronic
1124061540 15:26298096-26298118 GCCCCCTGCTCTGCAGCAGCCGG - Intergenic
1125116984 15:36105717-36105739 TCACTGTGGCCTGCAGCACTGGG + Intergenic
1125676087 15:41503276-41503298 GCACCTGGTCCTGCAGGACCCGG - Exonic
1125759593 15:42087751-42087773 GCAGCCCGGGCTGCAGCTCCAGG - Intronic
1125933831 15:43618012-43618034 GCACCCCTGCCTGGTGCACCAGG + Exonic
1125946928 15:43717474-43717496 GCACCCCTGCCTGGTGCACCAGG + Intergenic
1127161636 15:56193247-56193269 GCACCATGGCTTTCATCACCAGG - Intronic
1127688283 15:61369905-61369927 GCACCCGGTGCTGCAGCAGCTGG + Intergenic
1128737547 15:70061747-70061769 CACTCCTGGCCTGCAGCACCAGG - Intronic
1129189020 15:73927002-73927024 GCGCGCCGGCCAGCAGCACCCGG - Exonic
1129229759 15:74190704-74190726 CCAAGATGGCCTGCAGCACCTGG + Intronic
1129263930 15:74383861-74383883 GGTCCCGGGCCTGCACCACCTGG + Intergenic
1129296115 15:74601028-74601050 GCACCAAGGGCTCCAGCACCAGG - Intronic
1129519683 15:76177918-76177940 CCATCCTGGCCTGCAGAGCCCGG - Intronic
1129743065 15:77999555-77999577 GCAGCCTGGTCTGCAGAGCCAGG - Intronic
1130652497 15:85770003-85770025 TCACCCTGCCCTGCAGAAACTGG + Intronic
1130960695 15:88657010-88657032 GCCCCCGGGCCAGCAGCAGCGGG - Intergenic
1131269827 15:90940317-90940339 CCTCCCTGGCCAGCACCACCAGG - Exonic
1131530550 15:93187694-93187716 GCTCCCTGGCCTGAAGCAGCAGG + Intergenic
1132057142 15:98660941-98660963 CCACCCTGGCCCTCTGCACCAGG - Intronic
1132142502 15:99407280-99407302 CCACCCAGCCCTGCTGCACCTGG - Intergenic
1132544128 16:525334-525356 GGACCCTGGCGTGGAGCACGAGG - Intergenic
1132548505 16:544488-544510 GCAGCCGGGACAGCAGCACCCGG - Intronic
1132590432 16:724067-724089 GCACCCGGGCCTGGAGCTTCTGG + Intronic
1132832055 16:1933231-1933253 GCCCACTGGCCAGCAGCGCCAGG + Intergenic
1132880833 16:2161063-2161085 GTTCCCTGGCCTCCAGCCCCAGG + Intronic
1133022164 16:2971536-2971558 GCACCCTGGCCTGCAGGCCCTGG + Exonic
1133267743 16:4594845-4594867 TCACCCTGCCCAGCAGAACCAGG - Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1134632667 16:15768099-15768121 GAACCCTGGCCTCCAGAACTGGG + Intronic
1135004701 16:18809356-18809378 ACACCATGGCCTGCAACCCCAGG - Exonic
1135087541 16:19487302-19487324 GCACCCTGGCCATCACCATCTGG + Exonic
1135480016 16:22814449-22814471 GCACCCTGGTCAGCAGCCCCCGG + Exonic
1135598902 16:23764867-23764889 GGACTCTGGCCTGCACCAGCTGG + Intergenic
1136029503 16:27492432-27492454 ACAACCTGGCCCGCAGCAGCCGG - Exonic
1136496372 16:30647542-30647564 CCACCCTGCCCTGCAGAAGCAGG + Intergenic
1136737637 16:32477762-32477784 GCACTCTGCCCTGCTGCCCCTGG + Intergenic
1138521683 16:57574887-57574909 GCGCCCAGGCCAGCACCACCAGG - Exonic
1141666282 16:85467112-85467134 GGGCCCTGGCCTCCAGCAGCTGG + Intergenic
1141980117 16:87544996-87545018 GGACCCTGCCCTGCAGCACGTGG - Intergenic
1141980127 16:87545034-87545056 GGACCCTGCCCTGCAGCATGTGG - Intergenic
1142055660 16:87994074-87994096 GCATCCTGGTCTCCAACACCAGG - Intronic
1142197718 16:88746419-88746441 GCAGCCCTGCCTGGAGCACCAGG + Intronic
1142401892 16:89863277-89863299 GAGGCCTGGCCTGCAGCAGCAGG + Intronic
1203015434 16_KI270728v1_random:351815-351837 GCACTCTGCCCTGCTGCCCCTGG - Intergenic
1203033769 16_KI270728v1_random:624973-624995 GCACTCTGCCCTGCTGCCCCTGG - Intergenic
1142682162 17:1556511-1556533 CCAGCCTGTCCTGGAGCACCTGG - Intronic
1143138037 17:4723042-4723064 GCAGCCTCCCCTGCAGAACCTGG + Intergenic
1143562287 17:7703246-7703268 GCACCCTAGCCTGCCTCTCCTGG + Exonic
1143782659 17:9237553-9237575 GCACCCTGGGCTGGGGCTCCAGG - Intronic
1145248674 17:21285586-21285608 GCACCCTGTCCTGCAGCCCTGGG + Intronic
1145403711 17:22568695-22568717 GCAGCCTGGCTTGGAGCAGCTGG + Intergenic
1145715587 17:27017064-27017086 GTCCCCTTGGCTGCAGCACCAGG - Intergenic
1146419619 17:32671043-32671065 CCACTCTGGCCTGCAGCTCCGGG - Intronic
1146909558 17:36639790-36639812 GTTCCCTGGCCAGCAGCATCAGG + Intergenic
1147512609 17:41084346-41084368 GCACTGGGGCCTGCAGCAGCTGG - Exonic
1147514777 17:41105528-41105550 GCACTGGGGCCTGCAGCAGCTGG - Exonic
1147514800 17:41105648-41105670 GCACTGGGGCCTGCAGCAGCTGG - Exonic
1147516006 17:41118154-41118176 GCACTGGGGCCTGCAGCAGCTGG + Exonic
1147516638 17:41123973-41123995 GCACTGGGGCCTGCAGCAGCTGG + Exonic
1147517961 17:41140101-41140123 GCACTGGGACCTGCAGCACCTGG + Exonic
1147519843 17:41160362-41160384 GCACTGGGGCCTGCAGCAGCTGG + Exonic
1147535039 17:41315366-41315388 GCACACAGGCCCACAGCACCCGG + Exonic
1147559360 17:41499477-41499499 GCCCCCTCCTCTGCAGCACCTGG - Intergenic
1147987236 17:44313648-44313670 CCAGCCTGGCCTGCAGTCCCAGG + Intronic
1148695266 17:49555006-49555028 GCATCCCGGCCCGGAGCACCTGG + Intergenic
1148858158 17:50590455-50590477 CCACCCTGCCCTGCAGCCCGAGG + Exonic
1148978282 17:51548532-51548554 CCACCCGTGCCTGCAGCCCCAGG + Intergenic
1151570078 17:74921634-74921656 CCACACTGGCCTGCAGGACTTGG - Intronic
1151881214 17:76895956-76895978 GGGCCCTGGCCTGCACCTCCTGG + Intronic
1152305206 17:79516378-79516400 GCCCCCTGCCCTGGAGAACCAGG + Intergenic
1152307926 17:79531961-79531983 GGACCCTCCCCTGCAGCAGCTGG - Intergenic
1152520110 17:80850816-80850838 GCACCCTGGCCTGCAGCACCTGG + Intronic
1152740203 17:82015406-82015428 GCAGCCAGGCCTGGGGCACCTGG - Intronic
1156464905 18:37342605-37342627 GGACCCTGGCCTGCACTCCCTGG - Intronic
1157947031 18:51991899-51991921 GAAGCCTGGCCTGCATCTCCAGG - Intergenic
1160243125 18:77137023-77137045 GGACCCTCCCCTGCAGCCCCTGG + Intergenic
1160512543 18:79460760-79460782 GCACCCTGGCGTGGAGCCCCCGG + Intronic
1161261590 19:3340776-3340798 GCTCCCTGGCCTGGAGCCCCAGG + Intergenic
1161478891 19:4500974-4500996 CCACACTGGCCTGCAGAACTGGG - Intronic
1162947298 19:14051817-14051839 GCACCCTGGGCTGGGGCATCTGG + Intronic
1163091187 19:15021532-15021554 CCACCCTGGCCCGCAGCCGCAGG - Intronic
1163682749 19:18692701-18692723 TCACCCAGCCCTGCAGCCCCTGG - Intronic
1164561537 19:29295696-29295718 GCACCAAGGCCTGCAGGACGGGG - Intergenic
1164695654 19:30241678-30241700 GCACTCTGGGCAGCACCACCAGG + Intronic
1164930197 19:32169446-32169468 GCAACCTGGGCAGCAGGACCTGG + Intergenic
1165040622 19:33065217-33065239 GCACCCTGCCCTGGAGCCCGGGG + Intergenic
1165153387 19:33773598-33773620 GCAGTGGGGCCTGCAGCACCTGG - Intergenic
1165383798 19:35498730-35498752 GCAACCTGGCCTGCTGCAGTGGG - Exonic
1165389732 19:35531497-35531519 GCTCCCTCCCCTGCAGCCCCGGG - Intergenic
1165872193 19:38980890-38980912 CCACTCTGGCCTGTAGCTCCAGG - Intergenic
1165878493 19:39026342-39026364 CCACCCTGGCCTGCAGCTCCAGG + Intronic
1166547123 19:43640131-43640153 GCACCCTCGCGCGCAGCACCTGG - Intergenic
1167526754 19:49989069-49989091 GCACCCCTGCCTCCAGCATCGGG - Intronic
1167681183 19:50922501-50922523 TCACCCTGGGCCGCAGCATCCGG + Intergenic
1168104739 19:54159817-54159839 GCCCCCTGGCCTGTAGCGACAGG + Exonic
1168115893 19:54221218-54221240 GCGCCCTGGCCAGCAGCCCCAGG - Exonic
1168118876 19:54240966-54240988 GCGCCCTGGCCAGCAGCCCCAGG - Exonic
1168125194 19:54278947-54278969 GCTCCCTGGCCGGCAGCCCCAGG - Exonic
1168132348 19:54329644-54329666 GCACCATGGCTGGCAGCCCCAGG - Intergenic
1168133816 19:54337535-54337557 GCGCCCTGGCCGGCAGCCCCAGG - Exonic
1168133923 19:54338021-54338043 GCCCCCTGACCTTCAGCAACAGG - Exonic
1168166518 19:54552095-54552117 GCGCCCTGGCCAGCAGCCCGAGG + Intergenic
1168172060 19:54595778-54595800 GCTCCCTGGCCCACAGCCCCAGG + Exonic
1168185592 19:54697788-54697810 GCGCCCTGGCCAGCAGCCCCAGG + Intronic
925189497 2:1871392-1871414 GTTCCCTGGCCTGGAGAACCGGG + Intronic
925731717 2:6923711-6923733 GCACCTGGGCCTGCAGGACCTGG - Intronic
925821020 2:7800060-7800082 CCATCCTGCCCTGCAGCTCCAGG + Intergenic
925994131 2:9278109-9278131 GCACCCTGCCCTACAGCTACTGG - Intronic
926087425 2:10029032-10029054 GCCCCCTGGTCTGGACCACCCGG + Intergenic
927847987 2:26481084-26481106 GGTCCCTGGCCTCCAGCTCCTGG + Intronic
928092174 2:28381731-28381753 TCACTCTGGCCTGGGGCACCTGG - Intergenic
928535843 2:32240474-32240496 CCTCCCTGGCCTGCAGGGCCTGG + Intronic
930015603 2:46968447-46968469 AAACCCAAGCCTGCAGCACCTGG + Intronic
930089225 2:47519842-47519864 GAACCAGGGCCTGCAGCACCAGG - Exonic
931976217 2:67646841-67646863 CCACTCTAGCCTGCAGCTCCTGG + Intergenic
932149314 2:69355028-69355050 GCAAACTGACCTGCAGCCCCAGG + Intronic
933089553 2:78104036-78104058 CCACTCTGGCCTGAGGCACCTGG - Intergenic
934188761 2:89766875-89766897 GCACTCTGCCCTGCTGCCCCTGG + Intergenic
934307831 2:91841078-91841100 GCACTCTGCCCTGCTGCCCCTGG - Intergenic
936077758 2:109412514-109412536 GCACTCTGCTCTGCAGCAGCGGG - Intronic
937789390 2:125942960-125942982 GCCCCCTGCTCTGCAGCATCCGG - Intergenic
938065188 2:128278182-128278204 GCACCATGGGCTGCAGTGCCCGG - Intronic
938066114 2:128282866-128282888 GAGCTGTGGCCTGCAGCACCTGG - Intronic
939084847 2:137707423-137707445 TCAGCCAGGCCTGCAGCTCCTGG + Intergenic
939105862 2:137947821-137947843 GAACACTGGCCTGGAACACCAGG - Intergenic
940211659 2:151261623-151261645 GCACCCTGGCCCGTCGCGCCCGG + Intronic
942368611 2:175257031-175257053 GCCCCCTGCTCTGCAGCACCCGG - Intergenic
942620064 2:177836001-177836023 GCCCCCTGCTCTGCAGCACCCGG + Intronic
943522773 2:188974392-188974414 GTTCCCTGCCCTTCAGCACCGGG - Exonic
944928344 2:204489507-204489529 GCACCATGCTCTGCAGCACATGG - Intergenic
945253247 2:207782377-207782399 GCACTTTGGCCTGCTGCAGCAGG - Intergenic
945302566 2:208227908-208227930 GCACCCAGGCCAGCAGCTGCTGG - Intergenic
946690454 2:222305290-222305312 GCTCCCTGCCCAGCAGCAGCTGG - Intergenic
948084980 2:235239873-235239895 GGAGCCTTCCCTGCAGCACCTGG + Intergenic
948733088 2:239979637-239979659 GCACTCTCACCTGCACCACCAGG + Intronic
948874037 2:240818057-240818079 GCACCCAGGGGGGCAGCACCCGG + Intronic
948880467 2:240854732-240854754 CCACCCTGGCCTGCATCTCAGGG - Intergenic
1168816283 20:739476-739498 GGACCCTGGACTTCAGCTCCTGG - Intergenic
1173920421 20:46740635-46740657 CCACCCTGGCCTGCAGAAAGGGG - Intergenic
1173927513 20:46791958-46791980 GCACACTGGCCAGCAGCCTCTGG + Intergenic
1174913282 20:54629825-54629847 GCTCCTGGGCCTGAAGCACCTGG - Intronic
1175689675 20:61056486-61056508 GCACCATGCCCTGCAGAGCCTGG + Intergenic
1175771887 20:61629213-61629235 GCTCCCTGGCCTGCACCGCCTGG - Intronic
1176043843 20:63082445-63082467 GCTCTCTGGGCTTCAGCACCAGG + Intergenic
1178924411 21:36762804-36762826 CCATCCTGGCCTCCAGCGCCTGG + Intronic
1179355602 21:40655842-40655864 CCACGCTGGCCTGGAGCTCCTGG - Intronic
1179504081 21:41828600-41828622 CCACCCTGCCCCACAGCACCTGG + Intronic
1179813062 21:43884573-43884595 GCACCCCTGCATCCAGCACCAGG - Intronic
1180099739 21:45578970-45578992 CCACCCTGGCCTGCAGTTCCTGG + Intergenic
1180534917 22:16388160-16388182 GCACTCTGCCCTGCTGCCCCTGG - Intergenic
1181099798 22:20531562-20531584 GCACCCTGGCCTCCACTGCCAGG + Intronic
1181177754 22:21047477-21047499 GCACCGTGGCCTGGGGCCCCAGG + Exonic
1183347020 22:37313551-37313573 GTCCCATCGCCTGCAGCACCTGG + Exonic
1183516625 22:38270616-38270638 GCACCAGGCCCTGCAGCCCCGGG - Intronic
1184407367 22:44307846-44307868 GCATCCTGCCCTGCCGAACCTGG - Intronic
1184688968 22:46108879-46108901 GCACCCGGGAAAGCAGCACCAGG + Intronic
1185059218 22:48597366-48597388 GCCACCTGGCCCGCATCACCTGG + Intronic
1185059244 22:48597470-48597492 CCACCATGGCCTGCATCACCTGG + Intronic
1185059270 22:48597574-48597596 CCACCATGGCCCGCATCACCTGG + Intronic
1185345387 22:50308400-50308422 GCACCTTGGGATGCTGCACCCGG + Intergenic
1185362391 22:50416215-50416237 GCCCCCTGGCCCGCAGCAGTGGG - Intronic
949996253 3:9619679-9619701 CCACACTGGACTGCAGCTCCTGG - Intergenic
950536585 3:13582435-13582457 GACCTCTGGCCTGCAGCATCCGG + Intronic
950692805 3:14673683-14673705 ACATCCATGCCTGCAGCACCCGG + Intergenic
951080074 3:18443699-18443721 GCTCCCGGGCCGGCAGAACCGGG - Intronic
954136646 3:48585004-48585026 CCACCCTGACCTGCAGGACAAGG + Intronic
954582238 3:51709148-51709170 GCACCGTGGCATCCAGCGCCTGG + Exonic
955537737 3:59942196-59942218 GCTCTCTGGACTGCAGCCCCTGG + Intronic
956493298 3:69797190-69797212 TCACTCTGACCTTCAGCACCTGG - Intronic
957244148 3:77696808-77696830 ACACCCTGGCCCTCTGCACCAGG + Intergenic
960096591 3:113696192-113696214 GGACCCTTGCGTGCGGCACCTGG - Intronic
960287262 3:115843644-115843666 AAACCCTGCCCTTCAGCACCTGG + Intronic
961700740 3:128742957-128742979 GCCCCCTGCTCTGCAGCGCCTGG - Intronic
961718186 3:128873250-128873272 GCCCCAAGGCCTGCAGGACCTGG + Intergenic
962618604 3:137153233-137153255 TCACTGTGGCCTGCAGCACTGGG - Intergenic
963778634 3:149465027-149465049 AGATCCTGGCCTGCAGCACGCGG + Intergenic
963799025 3:149658462-149658484 GCGCCGAGGCCTGCAGCACCCGG + Intronic
964055979 3:152458164-152458186 ACATCCTGTCCTGCAGCAGCAGG + Intronic
965258251 3:166444634-166444656 CCACTCTGGTCTGCAGCTCCTGG - Intergenic
965648315 3:170908240-170908262 AGAACCTGGCCAGCAGCACCCGG + Intronic
965879808 3:173375037-173375059 GCACCCTAGGCAGAAGCACCTGG + Intergenic
966217286 3:177516852-177516874 GCCCACTGACCTGCAGCCCCAGG - Intergenic
966220016 3:177541989-177542011 GCAGCCCGGCCTGCAGGACTGGG - Intergenic
966851744 3:184169028-184169050 TCACCCTGCCCAGCAGCACTGGG + Intronic
967258098 3:187613695-187613717 GCTGCCTGGCATGCAGCAGCAGG + Intergenic
968570539 4:1338184-1338206 TCACCCCGGCCTCCAGCACCAGG - Intronic
968656842 4:1782394-1782416 CCACCCAGACCTGCAGCCCCGGG + Intergenic
968702218 4:2062498-2062520 GCCCCCTGTCCTGGAGCCCCTGG - Intronic
968944946 4:3658700-3658722 GCACCCTGGTCTCCAGCCCCCGG + Intergenic
969343223 4:6555563-6555585 GCAGCCAGGCCTGCAGCCGCAGG + Intronic
970574530 4:17414335-17414357 GCCCCCTGCTCCGCAGCACCTGG - Intergenic
970601183 4:17642173-17642195 GAACCCTGCCCAGCAGCGCCCGG + Exonic
972431735 4:38989683-38989705 ACACACTGGCCAGCAGAACCAGG + Intronic
977506669 4:97911487-97911509 CCATCCTGGCCTGCAGCTCCTGG + Intronic
981823617 4:148914520-148914542 GCAGCCAGGACTGCAGCAACAGG + Intergenic
984064645 4:175033080-175033102 CCACTCTGGCCTGCAGCTCTTGG + Intergenic
984839760 4:184057319-184057341 GCACACTGCTCTGCAGCTCCGGG + Intergenic
985156876 4:186998739-186998761 GCACCATCGCCTCCAGCACAAGG - Intergenic
985175860 4:187200068-187200090 GTCTCCTGGGCTGCAGCACCTGG + Intergenic
985248167 4:187997044-187997066 GGAGCATGGCCTGCAGCCCCCGG + Intronic
985530182 5:429492-429514 GCCCCCTGGCCCTCAGCCCCCGG + Intronic
985682177 5:1261809-1261831 GCAGCCTGGCCTCCTGCTCCGGG - Intronic
985895700 5:2749116-2749138 GCCCCCTGTCCTGCGGCACTGGG + Intronic
986171454 5:5318027-5318049 CCTCACTGGCCTGCAGCAGCAGG + Intronic
986340852 5:6788167-6788189 CCACCCTGCCCTGCAGCCCCTGG - Intergenic
988640153 5:33032899-33032921 GATCTCTGGCCTTCAGCACCCGG - Intergenic
990243290 5:53837259-53837281 GCACCCTGCTCCACAGCACCCGG + Intergenic
990489332 5:56288644-56288666 CCACCCTGGCCTGCAGAATCTGG - Intergenic
995146127 5:108788264-108788286 GCTGCCTGTCCTGCAGCAGCTGG + Intronic
998138770 5:139688375-139688397 GCAGCCTGGCCGGCAGCCTCAGG - Intergenic
998160922 5:139812624-139812646 GCACACTGGCCTCCTGCTCCGGG - Intronic
998333742 5:141352066-141352088 GCTCGCTGGCCTGCAGCACGTGG - Exonic
998334815 5:141361953-141361975 GCTCGCTGGCCTGCAGCACGTGG - Exonic
998337898 5:141389696-141389718 GCTCGCTAGCCTGCAGCACGTGG - Exonic
998339026 5:141399933-141399955 GCTCGCTAGCCTGCAGCACGTGG - Exonic
998340138 5:141410020-141410042 GCTCACTGGCCTGCAGCACGTGG - Exonic
998341235 5:141419677-141419699 GCTCACTGGCCTGCACCACGTGG - Exonic
998342210 5:141428096-141428118 GCTCGATGGCCTGCAGCACGTGG - Intronic
998343732 5:141441936-141441958 GCTTGCTGGCCTGCAGCACGTGG - Intronic
998692142 5:144598807-144598829 GCACCAGGGCCGGCAGCAGCGGG + Intergenic
999093623 5:148958749-148958771 GTACCCAGGCCTGCAGCAGCTGG + Intronic
999255595 5:150208470-150208492 GCACCAGGGCCTCCAGCTCCTGG - Intronic
999432515 5:151536503-151536525 ACACCCTCCCCTGCAGCAGCAGG + Intronic
999764524 5:154729046-154729068 GCACCATGGCCAGCAGCATCTGG - Intronic
999817490 5:155192292-155192314 ACACCCTGGCCTGAAGGATCAGG - Intergenic
1001652222 5:173324087-173324109 GCACCCTGCCTGGCAGCATCTGG + Intronic
1002063566 5:176640988-176641010 GGTCCCTGGCCAGCAGCATCTGG + Intronic
1002261114 5:177994730-177994752 GCACCCAGCCCTGCCCCACCGGG + Intronic
1002381156 5:178831148-178831170 CCAGCCTGGCTTGGAGCACCTGG + Intergenic
1002638630 5:180620106-180620128 GCACTCCGGCCTGCAGCAGGTGG + Intronic
1002641605 5:180633119-180633141 CCACCCTGGGACGCAGCACCAGG + Intronic
1004672778 6:17813628-17813650 GAACCCTGCCCTGCAGCGCAAGG - Intronic
1005928956 6:30466564-30466586 GCAGCCTCGCCTGCAGCACTCGG + Intergenic
1006295233 6:33167280-33167302 CCAGCCTGGCCTGTAGCTCCAGG + Exonic
1006984764 6:38169133-38169155 GCACCCTGCCCTGCTGACCCTGG + Exonic
1007357071 6:41328802-41328824 GCAGACTTGCCTGCAGCCCCAGG + Intergenic
1007498167 6:42276140-42276162 ACCCCCTGGCCTGGGGCACCAGG + Intronic
1007904504 6:45445515-45445537 AAACCCAGGCCTGCAGCATCTGG - Intronic
1009746728 6:67825726-67825748 GCCCCCTGCTCTGCAGCACCTGG + Intergenic
1010191417 6:73201032-73201054 GCACCCTGAGCTGCAGCAAGGGG - Intergenic
1011484518 6:87828277-87828299 CTACCCTGGCCTCCACCACCTGG - Intergenic
1012259881 6:97075699-97075721 CCAACCTTTCCTGCAGCACCAGG + Intronic
1012308415 6:97689205-97689227 GCACACTGGGCTGGAGCATCAGG + Intergenic
1017006538 6:150031668-150031690 CAACCCTGGCCTTCAGCAACAGG + Intergenic
1017681662 6:156870427-156870449 TCTCCCTGGCCTCTAGCACCAGG - Intronic
1017826202 6:158083879-158083901 GCACCCTGCCCTGCAGCTCAGGG - Intronic
1018035066 6:159874736-159874758 GCTTCCTGTCCTGCAGCCCCTGG - Intergenic
1018382230 6:163268858-163268880 CCACCCAGGCCAGCAGCACACGG - Intronic
1018748406 6:166780442-166780464 GGAGCCAGGCCTGCGGCACCTGG + Intronic
1018965745 6:168487545-168487567 GCACACTGCACTCCAGCACCTGG - Intronic
1019086279 6:169480371-169480393 ACCCCCTGCTCTGCAGCACCCGG + Intronic
1019334553 7:476843-476865 GGAGCCTGTCCTGCAACACCAGG + Intergenic
1019504904 7:1385915-1385937 CCACCCTGCCCTGCAGCCTCTGG + Intergenic
1019714049 7:2530234-2530256 ACCCCCTGACCTCCAGCACCCGG - Intergenic
1019917483 7:4143176-4143198 GCACCCTGTCCTGGAGCTGCAGG + Intronic
1020134738 7:5580914-5580936 GCACCCAGGTCTCCCGCACCTGG + Intergenic
1021989598 7:26129111-26129133 GCTGCCTGGCCTGTCGCACCAGG - Intergenic
1022113121 7:27243410-27243432 GCACCCCGGACTGCGCCACCGGG + Exonic
1022967613 7:35487970-35487992 GCCCACTGGGCTGCAGAACCAGG - Intergenic
1023860730 7:44216432-44216454 GCCCACAGGCCTGTAGCACCTGG + Intergenic
1023881747 7:44324977-44324999 GCCCCCGGGCCTGGAGCGCCGGG - Intronic
1023966168 7:44964075-44964097 GGACCCTGACCGGCAGTACCGGG - Exonic
1024315218 7:48009818-48009840 GCACTCTGGTCTGCAGTACCGGG + Intronic
1024797274 7:53035511-53035533 GCAAACTTGCCGGCAGCACCTGG + Intergenic
1027057695 7:75061367-75061389 GCACCATCGCCTGCCGCTCCTGG + Intronic
1029356687 7:100057300-100057322 GCACCCAGGCCTGGAGCTCCTGG - Exonic
1029595506 7:101535563-101535585 GCTCCATGGCCTCCAGCAGCAGG + Intronic
1030274861 7:107709619-107709641 GCAGCCTGGCCCACAGCAGCAGG + Intronic
1031919188 7:127588748-127588770 CCACCCAGGCCCGCAGCTCCGGG - Intronic
1032092711 7:128919362-128919384 GCATCCGGTCCTGCAGGACCTGG + Intergenic
1034048041 7:147950603-147950625 GCACCCCAGCCTGCAATACCTGG + Intronic
1034313769 7:150111665-150111687 GCTCTCTGGTGTGCAGCACCGGG - Intergenic
1034421379 7:150992879-150992901 GCACTCTGGCCTGAAGTGCCTGG + Intronic
1034684568 7:152958905-152958927 CCACTCTGTGCTGCAGCACCTGG - Intergenic
1034793129 7:153989127-153989149 GCTCTCTGGTGTGCAGCACCGGG + Intronic
1035388656 7:158490604-158490626 GCACCCTGGACACCAGAACCGGG + Intronic
1035459200 7:159028952-159028974 GCACCCTGTCCTGCACACCCTGG - Exonic
1036762298 8:11517779-11517801 AGAGCTTGGCCTGCAGCACCAGG - Intronic
1037949058 8:23007052-23007074 GCACCCGCTCCTGCAGCACCAGG - Exonic
1039400350 8:37263737-37263759 GGACCCGGGACTGCAGCAACAGG - Intergenic
1039791845 8:40882557-40882579 GCCCCCTGGCCTGGCACACCGGG + Intronic
1040284250 8:46091914-46091936 GCACCCTGGGCTGGAGCCCGTGG - Intergenic
1040543127 8:48377091-48377113 GCACCCTGGCCAGGGTCACCCGG + Intergenic
1041351065 8:56948005-56948027 GCACAATGGCCTGCAGCACCTGG - Intergenic
1042971752 8:74416468-74416490 TCATCATTGCCTGCAGCACCCGG + Intronic
1045663177 8:104459217-104459239 TCACAGTGGCCTGCATCACCTGG - Intronic
1049006815 8:139860870-139860892 GCACCCTCACCTTCACCACCTGG + Intronic
1050266296 9:3893705-3893727 GCACCTGGACCAGCAGCACCTGG + Intronic
1051345177 9:16144925-16144947 GCACCCTGGCTTCCAGTTCCTGG - Intergenic
1054777041 9:69132468-69132490 CCACCTTCTCCTGCAGCACCAGG - Intronic
1056543021 9:87590660-87590682 TCACTGTGGCCTGTAGCACCCGG + Intronic
1056825446 9:89873537-89873559 GCCCCCAGACCTGCAGCATCAGG - Intergenic
1057248531 9:93480434-93480456 GCTCCCTGTTCTGCAGGACCTGG - Intronic
1057375201 9:94514943-94514965 GCAACCTGGCCTGCCACAACAGG + Intergenic
1057443280 9:95097026-95097048 GCATCCTGGCCTCCACCACTAGG - Intergenic
1057611152 9:96544960-96544982 GTCCCCAGGCCAGCAGCACCAGG + Intronic
1061231022 9:129315868-129315890 CCACCCTGGCCTCCTGCACCGGG - Intergenic
1061744226 9:132727946-132727968 ACACCATGCCCTGCAGGACCTGG - Intronic
1061816829 9:133202354-133202376 CCGCCCTGCCCTGCAGCAGCGGG + Intergenic
1061975409 9:134065886-134065908 GCAGCCAGGCCTGCTGCAGCCGG - Intronic
1062024409 9:134333649-134333671 GCATTCTGGGCTGCAGCACCAGG - Intronic
1062039868 9:134399502-134399524 TCTCCCTGGCCTTCTGCACCTGG + Intronic
1062230951 9:135480851-135480873 TCTCCCTGGCCTGCAGACCCTGG + Intronic
1189316736 X:40062096-40062118 GCCCCCCAGCCTGCAGCCCCAGG + Intronic
1190050792 X:47147010-47147032 CCACCCTGGGATGCAGCCCCAGG + Intronic
1194499743 X:94667219-94667241 GCACCCCCGCCTGCACCGCCCGG + Intergenic
1195321420 X:103724679-103724701 GTGCCCTGGCCTGCAGCTCAGGG - Intronic
1195370301 X:104166621-104166643 GCACCCCGGCAAGCAGCAGCGGG + Exonic
1198480178 X:137033755-137033777 GCTCCGTGGCCCCCAGCACCCGG - Intergenic
1200161575 X:154012510-154012532 CCAGCCTGGGCGGCAGCACCTGG + Exonic