ID: 1152521765

View in Genome Browser
Species Human (GRCh38)
Location 17:80860533-80860555
Sequence AAGTAGTACGTGAGGACTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 93}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152521765_1152521773 2 Left 1152521765 17:80860533-80860555 CCCCAAGTCCTCACGTACTACTT 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1152521773 17:80860558-80860580 GTGTCACAGCTGAAGTCAGGGGG 0: 1
1: 1
2: 0
3: 13
4: 212
1152521765_1152521777 13 Left 1152521765 17:80860533-80860555 CCCCAAGTCCTCACGTACTACTT 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1152521777 17:80860569-80860591 GAAGTCAGGGGGCAGTGGGGAGG 0: 1
1: 0
2: 8
3: 65
4: 655
1152521765_1152521775 9 Left 1152521765 17:80860533-80860555 CCCCAAGTCCTCACGTACTACTT 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1152521775 17:80860565-80860587 AGCTGAAGTCAGGGGGCAGTGGG 0: 1
1: 0
2: 1
3: 36
4: 357
1152521765_1152521770 -1 Left 1152521765 17:80860533-80860555 CCCCAAGTCCTCACGTACTACTT 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1152521770 17:80860555-80860577 TTGGTGTCACAGCTGAAGTCAGG 0: 1
1: 0
2: 33
3: 27
4: 199
1152521765_1152521772 1 Left 1152521765 17:80860533-80860555 CCCCAAGTCCTCACGTACTACTT 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1152521772 17:80860557-80860579 GGTGTCACAGCTGAAGTCAGGGG 0: 1
1: 0
2: 1
3: 26
4: 317
1152521765_1152521771 0 Left 1152521765 17:80860533-80860555 CCCCAAGTCCTCACGTACTACTT 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1152521771 17:80860556-80860578 TGGTGTCACAGCTGAAGTCAGGG 0: 1
1: 0
2: 0
3: 16
4: 212
1152521765_1152521774 8 Left 1152521765 17:80860533-80860555 CCCCAAGTCCTCACGTACTACTT 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1152521774 17:80860564-80860586 CAGCTGAAGTCAGGGGGCAGTGG 0: 1
1: 0
2: 7
3: 110
4: 2139
1152521765_1152521778 28 Left 1152521765 17:80860533-80860555 CCCCAAGTCCTCACGTACTACTT 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1152521778 17:80860584-80860606 TGGGGAGGCTGCTGCCGAAGCGG 0: 1
1: 0
2: 1
3: 25
4: 334
1152521765_1152521776 10 Left 1152521765 17:80860533-80860555 CCCCAAGTCCTCACGTACTACTT 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1152521776 17:80860566-80860588 GCTGAAGTCAGGGGGCAGTGGGG 0: 1
1: 0
2: 8
3: 44
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152521765 Original CRISPR AAGTAGTACGTGAGGACTTG GGG (reversed) Intronic
900034724 1:397586-397608 AGGTAGTAAGCGAGGACCTGGGG - Intergenic
900055555 1:627468-627490 AGGTAGTAAGCGAGGACCTGGGG - Intergenic
902936871 1:19770730-19770752 AAGAAATACATGAGGACTTCAGG + Intronic
903499469 1:23793458-23793480 AGGTAGTCGGTGAGTACTTGGGG - Intronic
906075301 1:43047767-43047789 AAGTGGTAGGGGAGGATTTGGGG + Intergenic
919725675 1:200881551-200881573 AAGCAGTAGCTGTGGACTTGTGG + Intergenic
921093908 1:211870453-211870475 AAGTAGTATGTGATGACATTAGG + Intergenic
922181992 1:223242911-223242933 AAGTGGGACGTGAGGAATTTGGG - Intronic
923056873 1:230433134-230433156 AGGAAGCAAGTGAGGACTTGGGG + Intergenic
924198074 1:241630238-241630260 AAGTAGTACATGGGGAGATGGGG - Exonic
1068603000 10:58975182-58975204 AAGTACTGCCTGAGGAATTGAGG - Intergenic
1071177639 10:82945013-82945035 AATTAGTCCATGGGGACTTGTGG - Intronic
1072579433 10:96726958-96726980 AAGTACTCCCTGAGGACATGTGG + Intergenic
1079692673 11:23439264-23439286 AAGTAGGAAGTGAGGAATTGGGG + Intergenic
1084761369 11:71273561-71273583 CAGGAGTAAGTGAGGACTGGTGG - Intergenic
1086334616 11:85787600-85787622 ATGTAGTGGGAGAGGACTTGCGG - Intronic
1089653628 11:119931618-119931640 AGGTAGAAAGTGAGGCCTTGGGG - Intergenic
1097905920 12:64919645-64919667 AATTAGGAGGTGAGGATTTGGGG - Intergenic
1098773125 12:74580129-74580151 AAGTATTAAGTGAGCACCTGAGG - Intergenic
1102305010 12:111798234-111798256 AAGGAGGAGGTGAGCACTTGGGG + Exonic
1102654445 12:114469686-114469708 ATGTAGGACGTGATGGCTTGTGG + Intergenic
1104547902 12:129728847-129728869 AAGGAGTACATGAAGACATGAGG - Intronic
1105986026 13:25567940-25567962 AAGAAGTATTTGAGGATTTGCGG + Intronic
1117058181 14:51934162-51934184 AAGCAGCACGTGAGGGCATGAGG + Intronic
1118263396 14:64269626-64269648 AAGAAGAACGTGGGGACATGTGG + Intronic
1122726573 14:103758764-103758786 AAGTAGAACGTGGGAGCTTGAGG - Intronic
1124129085 15:26969200-26969222 AGCTAGTAGGTGAGGACTGGGGG - Intergenic
1126969774 15:54097661-54097683 ATGAATTACATGAGGACTTGAGG - Intronic
1127572897 15:60261580-60261602 AAGTAGTTGGTAGGGACTTGGGG - Intergenic
1128079911 15:64850782-64850804 AAGATGTAGGTGAAGACTTGAGG + Intronic
1134062495 16:11207596-11207618 AAGTCGAACCTGTGGACTTGGGG + Intergenic
1141592423 16:85077628-85077650 AACGAGTACGTGTGGCCTTGGGG + Exonic
1142075111 16:88113517-88113539 ACGCAGGACGTGAGGACCTGTGG + Intronic
1146533727 17:33632031-33632053 AAGTTATAAGTGAGGGCTTGAGG + Intronic
1151593123 17:75059772-75059794 TAGTGGTGCGTGAGGAGTTGGGG + Intronic
1152430926 17:80247988-80248010 AAGCAGCCCCTGAGGACTTGGGG - Intronic
1152521765 17:80860533-80860555 AAGTAGTACGTGAGGACTTGGGG - Intronic
1153888606 18:9491360-9491382 ATGTGGTACCAGAGGACTTGGGG - Intronic
1156505713 18:37590282-37590304 AAGTGGGAGGTGATGACTTGAGG + Intergenic
1157744312 18:50121274-50121296 AAGAAATAAGTGAGGCCTTGAGG - Intronic
1159799386 18:72878776-72878798 AAGTAGGACGTTAAGACCTGGGG + Intergenic
1163938253 19:20470272-20470294 AAGCAGTTGGTGAGGACATGTGG + Intergenic
1164929080 19:32160123-32160145 AAGTTGTAAGTGAGAACATGTGG - Intergenic
944617357 2:201475220-201475242 AAGTACTACGTGAGCACCTGGGG - Intronic
1169592549 20:7161671-7161693 CAGTAATCTGTGAGGACTTGGGG - Intergenic
1170980269 20:21206029-21206051 AAGTAGTAAGTGAGGTTTTGTGG + Intronic
1171949708 20:31410274-31410296 AACTTGTAAGTGAGGACATGTGG - Intronic
949729061 3:7086457-7086479 AAGTAGTAAGTGAGAACATTGGG + Intronic
955819182 3:62877338-62877360 AAGGAGTATGTGATGATTTGGGG + Intergenic
959150779 3:102605067-102605089 AAGTACTACTTGAGGTGTTGGGG + Intergenic
959770993 3:110095952-110095974 AAGTAGTAGGTGAAGGTTTGAGG + Intergenic
961177897 3:124851024-124851046 AAGTTGTAGGTGGGAACTTGGGG - Intronic
964218436 3:154316457-154316479 AATTAGTATGTGAGGGTTTGGGG - Intronic
965093366 3:164191082-164191104 AAGTTGTACTTGATGACTTTAGG - Intergenic
983394500 4:167176384-167176406 AAGTAGTTGGTGAGAACTTAAGG - Intronic
983674824 4:170280216-170280238 AAGTAATAGTGGAGGACTTGAGG - Intergenic
984504150 4:180595507-180595529 AACTGGTACGTGAGGATGTGAGG + Intergenic
984509554 4:180661900-180661922 AAGTGTTAGGTGAGGATTTGAGG - Intergenic
986760261 5:10873908-10873930 AATTAGTAGGAGAGGACTTTGGG + Intergenic
987246932 5:16058604-16058626 AAGTGGTCCATGAGGACATGCGG + Intergenic
989450380 5:41580162-41580184 TAGTAGTACCTGAGGTGTTGAGG - Intergenic
989509524 5:42268848-42268870 ATGTGGTAAGTGAGAACTTGTGG - Intergenic
989531314 5:42511193-42511215 AAGAAATCCGTGAGGACTTCTGG - Intronic
994205859 5:97034620-97034642 AAGTAGTATGTGAGCACTACAGG + Exonic
996080217 5:119250898-119250920 AAGTAGTACTTCATGACTTTGGG + Intergenic
1000116438 5:158158332-158158354 AAGTAGTATTTGAAGACATGGGG - Intergenic
1002739095 5:181421285-181421307 AGGTAGTAAGCGAGGACCTGGGG + Intergenic
1003689381 6:8337559-8337581 AAATATTCCCTGAGGACTTGGGG + Intergenic
1008044408 6:46837069-46837091 AATTAGTGTGTGAGGATTTGAGG - Intronic
1010153889 6:72769038-72769060 GAGTACTACTTGAGGACTTCCGG - Intronic
1014318501 6:119896401-119896423 AAGGAGTGCATGAGCACTTGAGG - Intergenic
1015542669 6:134331702-134331724 AAGTTATACTTAAGGACTTGGGG - Intergenic
1017135023 6:151140391-151140413 AAGTACAACGTGAGGGCTGGTGG - Intergenic
1019244205 6:170696837-170696859 AGGTAGTAAGCGAGGACCTGGGG + Intergenic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1027462800 7:78476564-78476586 AAGTAGTACCTTGGGAATTGTGG + Intronic
1029063739 7:97826825-97826847 AAGAAGTAGGAGAGCACTTGAGG + Intergenic
1029813767 7:103074369-103074391 AAGAAGTACCTGAGGAGTGGAGG - Exonic
1030185244 7:106755304-106755326 AAGTTATAAGTGAGAACTTGTGG - Intergenic
1031956472 7:127947616-127947638 AACTAGTACCTGAGGACTCTGGG + Intronic
1035503918 8:111323-111345 AGGTAGTAAGCGAGGACCTGGGG - Intergenic
1037430958 8:18812733-18812755 AAGTAGGATGTGAGGACACGTGG + Intronic
1045016120 8:98003243-98003265 AAGAAGAACATGAGGACTCGAGG - Intronic
1046419760 8:113964894-113964916 TATTAGAAGGTGAGGACTTGGGG + Intergenic
1046551475 8:115723340-115723362 AAGAAAAATGTGAGGACTTGAGG + Intronic
1048610515 8:136017143-136017165 AAGCTGTAGGAGAGGACTTGTGG + Intergenic
1050452847 9:5802174-5802196 ACAGAGTACCTGAGGACTTGAGG - Intronic
1053653190 9:40189862-40189884 AATTAGCATGTGAGGATTTGAGG + Intergenic
1053903593 9:42819152-42819174 AATTAGCATGTGAGGATTTGAGG + Intergenic
1054531394 9:66186356-66186378 AATTAGCATGTGAGGATTTGAGG - Intergenic
1057069037 9:92080042-92080064 AAGTATGGCGTGGGGACTTGTGG - Exonic
1057262221 9:93591457-93591479 GAGTAGGACGTGTGGACTGGGGG + Intronic
1061455417 9:130693909-130693931 ATGCGGTACGTGGGGACTTGGGG + Exonic
1203604394 Un_KI270748v1:46061-46083 AGGTAGTAAGCGAGGACCTGGGG + Intergenic
1186058862 X:5681727-5681749 AAGAAGTAAGAGAGGAATTGAGG + Intergenic
1187590833 X:20715390-20715412 AAGTAGTACTTCAAGTCTTGTGG + Intergenic
1189226821 X:39420135-39420157 AAGCATTTCGTGGGGACTTGGGG - Intergenic