ID: 1152526212

View in Genome Browser
Species Human (GRCh38)
Location 17:80889650-80889672
Sequence CACACGCACTGGCCTTCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152526212_1152526219 18 Left 1152526212 17:80889650-80889672 CCTAAAGAAGGCCAGTGCGTGTG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1152526219 17:80889691-80889713 CAGCTCCATTCAGGAAGGGCAGG 0: 1
1: 0
2: 4
3: 26
4: 268
1152526212_1152526216 14 Left 1152526212 17:80889650-80889672 CCTAAAGAAGGCCAGTGCGTGTG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1152526216 17:80889687-80889709 AGCCCAGCTCCATTCAGGAAGGG 0: 1
1: 0
2: 0
3: 21
4: 160
1152526212_1152526220 22 Left 1152526212 17:80889650-80889672 CCTAAAGAAGGCCAGTGCGTGTG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1152526220 17:80889695-80889717 TCCATTCAGGAAGGGCAGGAAGG 0: 1
1: 0
2: 3
3: 25
4: 295
1152526212_1152526215 13 Left 1152526212 17:80889650-80889672 CCTAAAGAAGGCCAGTGCGTGTG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1152526215 17:80889686-80889708 GAGCCCAGCTCCATTCAGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 209
1152526212_1152526214 9 Left 1152526212 17:80889650-80889672 CCTAAAGAAGGCCAGTGCGTGTG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1152526214 17:80889682-80889704 GTCAGAGCCCAGCTCCATTCAGG 0: 1
1: 0
2: 0
3: 13
4: 131
1152526212_1152526222 23 Left 1152526212 17:80889650-80889672 CCTAAAGAAGGCCAGTGCGTGTG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1152526222 17:80889696-80889718 CCATTCAGGAAGGGCAGGAAGGG 0: 1
1: 0
2: 2
3: 26
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152526212 Original CRISPR CACACGCACTGGCCTTCTTT AGG (reversed) Intronic
900978130 1:6029866-6029888 CACATGCTCTGATCTTCTTTGGG - Intronic
901754859 1:11435348-11435370 CACCCAAACTGGCCTTCTTCGGG - Intergenic
904955843 1:34283279-34283301 CAGCCACACTGGCCTTCTTGGGG + Intergenic
908411747 1:63872934-63872956 CCCTCTCACTGTCCTTCTTTGGG - Intronic
913328305 1:117646752-117646774 CACACCCACTGGTCTTCTGTAGG - Intergenic
917166041 1:172114313-172114335 CAGCCGCACTGGCTATCTTTTGG - Intronic
917977712 1:180250970-180250992 CCCAAGCCCTGGCCCTCTTTTGG + Intronic
921310238 1:213835224-213835246 CAGCCACACTGGCTTTCTTTTGG - Intergenic
921480490 1:215659326-215659348 CAGCCACACTGGCCTTCTTGAGG - Intronic
922355142 1:224768296-224768318 CACACACAGTTGCCTTCATTTGG + Intergenic
1062991090 10:1819106-1819128 CAAATGCACTGGTCTTCTTGGGG + Intergenic
1063031844 10:2243625-2243647 CATACGCACTGGCCTATTTGGGG - Intergenic
1064742215 10:18445413-18445435 CACACGTACTGGCCATATTTTGG + Intronic
1070651259 10:78238413-78238435 CACAAACACAGGCCATCTTTTGG + Intergenic
1072728263 10:97828079-97828101 CCCAGGCACTGGACTGCTTTGGG - Intergenic
1074824754 10:117206657-117206679 TAGACACACTGGCCTTCTCTTGG + Intronic
1080744647 11:35097911-35097933 CACACACACCGGCCTTTTTCTGG - Intergenic
1080890394 11:36404121-36404143 CACATGGATGGGCCTTCTTTTGG - Intronic
1081813259 11:45924850-45924872 CACAGGCCCTGGCCTGCCTTGGG + Exonic
1087646991 11:100819446-100819468 CACATGCACTGGCATTCACTTGG - Intronic
1089787860 11:120920928-120920950 CACACTCACTGGCCTCCTCTTGG + Intronic
1091600435 12:1914671-1914693 CACCCCCACTGCCCTGCTTTGGG + Intronic
1092141662 12:6188129-6188151 CACACACACTGGCCCTCTAGGGG + Intergenic
1092867726 12:12778667-12778689 CACATCCACTGGCATTCTATTGG - Intronic
1094084383 12:26573749-26573771 CATCCACACTGACCTTCTTTCGG - Intronic
1094208760 12:27868403-27868425 CATACTCACTGGGCTTCATTAGG - Intergenic
1096246542 12:49992228-49992250 CACACGCACCTGCCTACCTTGGG + Exonic
1096780208 12:53987295-53987317 CACATGCACAGGCACTCTTTTGG + Intronic
1099009532 12:77275688-77275710 CAAAAGCACTGTGCTTCTTTGGG - Intergenic
1102885301 12:116517351-116517373 CACACCCACTTCCCTTCTTCTGG + Intergenic
1104379790 12:128297310-128297332 CACAGCCACTGGCCTCCTATCGG - Intronic
1104568863 12:129908034-129908056 CACATGCCCTGGCCTTCCTAAGG + Intergenic
1106421908 13:29592288-29592310 CACACCCAGTGGCTTTCATTGGG - Intronic
1116800486 14:49438653-49438675 CACAGGCACTGTCATTCTGTTGG - Intergenic
1117339394 14:54780768-54780790 CACAGGCACTGACCTTCTGCAGG + Intronic
1120089660 14:80316703-80316725 CCAAAGCACTGGCCTTCTGTAGG + Intronic
1124581192 15:30956611-30956633 TAGCCCCACTGGCCTTCTTTAGG - Intronic
1125505350 15:40264867-40264889 CCCACAAACTTGCCTTCTTTGGG - Exonic
1125741399 15:41967188-41967210 CTCACTCCCTGGCCCTCTTTGGG + Intronic
1127145325 15:56017288-56017310 CAACTGCACTGGCTTTCTTTTGG + Intergenic
1131301946 15:91207446-91207468 CACACACACAGGCCTTTTTCAGG - Intronic
1132586553 16:708079-708101 CAGCCACACTGGCCTTCTTCTGG + Intronic
1132915411 16:2341143-2341165 CTCACGCACTGTCTTTCCTTGGG + Intergenic
1133573937 16:7069361-7069383 CACACACACCGGGCCTCTTTGGG - Intronic
1139198028 16:64944017-64944039 CAGCCACACTGGCCATCTTTCGG - Exonic
1141754014 16:85979278-85979300 CACAGGCCCTGGCGTTCTTCAGG - Intergenic
1144575455 17:16426868-16426890 CTCACGCCCTTGCCTTCTTCAGG - Exonic
1146360846 17:32176377-32176399 CACACCCACGTGCCTTTTTTGGG + Intronic
1150414171 17:64974043-64974065 CACACCCAATTTCCTTCTTTTGG + Intergenic
1152526212 17:80889650-80889672 CACACGCACTGGCCTTCTTTAGG - Intronic
1158238052 18:55341529-55341551 CACACCCAGTGGCCTTGGTTAGG - Intronic
1158395563 18:57076465-57076487 CACTGGCACAGGCCTCCTTTGGG - Intergenic
1159771891 18:72556002-72556024 CACACCCACTGGCAATGTTTGGG + Intronic
1160356701 18:78233053-78233075 CACACACACGGTCCCTCTTTGGG + Intergenic
1160613151 18:80104646-80104668 CTCAGGCGCAGGCCTTCTTTGGG + Intergenic
1160738530 19:675706-675728 CACACGCAGTGGCCTCCCTGGGG + Intergenic
1162820976 19:13223540-13223562 CCCCCACACTGGCCTCCTTTCGG + Intronic
1163288766 19:16365090-16365112 CACAGGCAGTGGCCTTCTCAGGG + Intronic
1165361807 19:35341441-35341463 CAGAAGAACTGGACTTCTTTGGG - Exonic
1165374369 19:35431352-35431374 CAGCCACACTGGCCTCCTTTCGG + Intergenic
1165478661 19:36048036-36048058 CACTTTCACTGGCATTCTTTTGG - Intronic
1165479887 19:36056385-36056407 CAGTCACACTGGCCTGCTTTTGG + Intronic
1165808407 19:38596060-38596082 CACAGGTACTGGCCTTCTGGGGG - Intronic
1167824691 19:51961506-51961528 CTGACACACTGGCCCTCTTTTGG - Intergenic
925525836 2:4800882-4800904 CACACACACAGCCCTTGTTTTGG + Intergenic
926352926 2:12013730-12013752 CACACTCATTGGCCATCCTTGGG - Intergenic
928745600 2:34410884-34410906 CACATGATTTGGCCTTCTTTAGG - Intergenic
930008007 2:46913599-46913621 CCAGCTCACTGGCCTTCTTTAGG + Intronic
936074834 2:109395148-109395170 CGCACGCACTGGCCTGCCTGCGG - Intronic
936480519 2:112880726-112880748 AACAGGCACTGGCCTTATTTTGG - Intergenic
937080321 2:119135787-119135809 CACACTCACTGGCTGTCTTGAGG + Intergenic
943037174 2:182761724-182761746 ACCACGCATTGGCCTGCTTTGGG - Intronic
945020468 2:205566054-205566076 CACACGCAGAGGCCTTGTGTAGG + Intronic
948829034 2:240588576-240588598 CAAACCCACTGGGCTTCTCTTGG - Intronic
948864929 2:240770413-240770435 CACACTCACTGCCCTTCTCAGGG + Intronic
1169683206 20:8240579-8240601 CATAAGTATTGGCCTTCTTTGGG + Intronic
1169833639 20:9853417-9853439 CTGACCCACTGGCCTTCTCTAGG - Intergenic
1170574162 20:17649949-17649971 GACACGCACTGGCCTCCTTCTGG + Intronic
1170833971 20:19868081-19868103 CACACTCACAGGCCTCCTTGGGG - Intergenic
1175493781 20:59398177-59398199 CACACACACTTCCCTTCTTCAGG - Intergenic
1179475136 21:41638257-41638279 CACAAGCACAGTCCTGCTTTAGG - Intergenic
1180185972 21:46139371-46139393 CACAGGCACTGGCCTTTCCTAGG + Intronic
1183710677 22:39501715-39501737 CACACTCACGTGCCTTCTTTGGG - Intronic
952974248 3:38680718-38680740 CCCACTCACTGTCCTTGTTTTGG - Intergenic
955775995 3:62433594-62433616 CATCCGCACTGGCTTTCTTCAGG - Intronic
956670213 3:71682119-71682141 CACAGGCACTTGCCTACATTGGG - Exonic
962623637 3:137203189-137203211 CAGCCACACTGGCCTGCTTTTGG + Intergenic
963660000 3:148113405-148113427 CACACTCACTGGTTTTCCTTTGG - Intergenic
966965299 3:184985670-184985692 CACACTGATTGGCCTTGTTTAGG - Intronic
968957832 4:3728159-3728181 CACCCCCACTGGCCTTCTTGTGG - Intergenic
972931834 4:44081257-44081279 CACAGGCACTCTCCTTCTTATGG - Intergenic
973756062 4:54074623-54074645 CACACACACTGGCCTTACTATGG + Intronic
978653068 4:111031280-111031302 CATACCCTCTGGCCTTCTTAAGG - Intergenic
985909965 5:2871610-2871632 CTCAAACACTGGCTTTCTTTGGG - Intergenic
991002713 5:61798527-61798549 CACCTGCACTGGCCTTCTGGTGG - Intergenic
997725427 5:136116485-136116507 CCTCCACACTGGCCTTCTTTTGG - Intergenic
999617391 5:153438641-153438663 AACACACACTATCCTTCTTTTGG - Intergenic
1002696809 5:181097784-181097806 CACCCACATTGGCCCTCTTTGGG + Intergenic
1002697813 5:181101589-181101611 CACCCACATTGGCCCTCTTTGGG - Intergenic
1002707787 5:181174361-181174383 CACCCACATTGGCCCTCTTTGGG + Intergenic
1003067786 6:2918326-2918348 CACTCCCACTGGGCTTCCTTGGG - Intergenic
1003117881 6:3295380-3295402 CTCACACCCTGGCCTTCGTTTGG - Intronic
1005021717 6:21424708-21424730 CACCCGCACTGCCTTTATTTAGG + Intergenic
1007488157 6:42196851-42196873 CAAAGGGACTGGCCTTTTTTGGG - Intergenic
1007615853 6:43179518-43179540 CCCACACACAGGCCTTCTGTGGG + Exonic
1010720990 6:79283191-79283213 CAGAGGAACTGGTCTTCTTTGGG + Intergenic
1013676585 6:112470559-112470581 CATACTCTCTGGCCTTCTTTTGG + Intergenic
1016252140 6:142056481-142056503 CAGCCACACTGGCCTCCTTTTGG + Intergenic
1016437809 6:144055824-144055846 CACAGCCACTGTCTTTCTTTGGG + Intronic
1019031664 6:169018745-169018767 CACCGGTACTGGCCTGCTTTGGG + Intergenic
1019481439 7:1268678-1268700 GACACCCAGTGGCCCTCTTTGGG + Intergenic
1021768189 7:23970089-23970111 CACACACAGTCTCCTTCTTTTGG - Intergenic
1023140838 7:37100760-37100782 CACACACACTGTCCTTCGTGTGG - Intronic
1028932619 7:96430046-96430068 CACACACACTGGCCTTCAAAGGG - Intergenic
1030299346 7:107959768-107959790 CACTGGCACTGGCCTCCGTTGGG + Exonic
1031423822 7:121581802-121581824 CACCCACACTGGCCATCTCTAGG - Intergenic
1033738853 7:144252374-144252396 CACCCGCAGTGGCCTTCTGGAGG - Intergenic
1033744194 7:144298580-144298602 CACCCGCAGTGGCCTTCTGGAGG + Intergenic
1034708014 7:153163913-153163935 CCCTCTCACTTGCCTTCTTTTGG + Intergenic
1034742573 7:153491945-153491967 GAACCACACTGGCCTTCTTTTGG - Intergenic
1037344137 8:17880115-17880137 CAGAGGCACTGGCCATCTTCAGG + Intronic
1037605124 8:20431786-20431808 CAGCCACACTGGCCTTCTTCTGG + Intergenic
1037620010 8:20555406-20555428 CACTCTCACTCCCCTTCTTTTGG + Intergenic
1039416313 8:37397310-37397332 CACACACACTTACCTTCTGTTGG - Intergenic
1041208386 8:55522099-55522121 AAAACACACTGGCCTCCTTTAGG - Intronic
1044234312 8:89812734-89812756 CAATCACACTGGCCTCCTTTTGG + Intergenic
1046417188 8:113932999-113933021 CACACACACACACCTTCTTTAGG + Intergenic
1048351761 8:133622316-133622338 CACAAGCTCTGACCTTATTTCGG - Intergenic
1049207903 8:141371934-141371956 TTCACGCCCTGGCCTTCTTGTGG + Intergenic
1049267892 8:141679120-141679142 CACAGACACTGGCATTCTTCAGG - Intergenic
1054945471 9:70791909-70791931 CCCATCGACTGGCCTTCTTTTGG + Intronic
1057181922 9:93035065-93035087 CAGACTCCATGGCCTTCTTTGGG - Intronic
1057314929 9:93961808-93961830 CACAGGCACTGGGCTTCCCTGGG + Intergenic
1061203684 9:129151105-129151127 CACACTCAGAGGGCTTCTTTCGG - Intergenic
1187142015 X:16602928-16602950 GGCACCCACTGGCCTTATTTTGG - Intronic
1195666728 X:107438273-107438295 CACATTCACTGGACTTTTTTAGG + Intergenic
1196683616 X:118493325-118493347 CAGCCACACTGGCCTTTTTTTGG + Intergenic
1196798940 X:119524865-119524887 CACTGGCACTGCCCTCCTTTTGG + Intergenic
1197891443 X:131274280-131274302 CCCACACTCTGGCCTTCTTTAGG + Intronic
1201385325 Y:13434458-13434480 CAGGCGCACTGGCCTACGTTGGG - Intronic