ID: 1152526364

View in Genome Browser
Species Human (GRCh38)
Location 17:80890321-80890343
Sequence TTCCCTGGAAGGGGCCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 409}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152526364 Original CRISPR TTCCCTGGAAGGGGCCCAGT GGG Intronic
900289936 1:1919536-1919558 TGCACTGGGCGGGGCCCAGTGGG - Intergenic
900297769 1:1960480-1960502 TTCCCTGAAAGGGGCTGAGAGGG - Intronic
900422102 1:2560131-2560153 TGTCCTGGAAGCAGCCCAGTGGG + Intronic
900964481 1:5948248-5948270 ATCCCTGGAAGAGGCACAGAAGG + Exonic
901229366 1:7633420-7633442 TCCCCCAGAAGGGGCCCAGGAGG - Intronic
902247862 1:15133438-15133460 TGCCATGGGAGGGACCCAGTGGG + Intergenic
902262438 1:15236875-15236897 TGTCGTGGAAGGGACCCAGTGGG + Intergenic
902580735 1:17405954-17405976 TGCCCTGGAAGAGCCCCCGTGGG - Intergenic
903557326 1:24203223-24203245 GGCCCTGGAAAGGGCCCAGCAGG + Intergenic
904375442 1:30078725-30078747 TTCCATGAATGGGTCCCAGTGGG - Intergenic
905202590 1:36324051-36324073 TTGCCTGGAAGGGGCCTCCTAGG - Exonic
905892011 1:41523640-41523662 TGCTCTGGAGGGGGCCCAGCAGG - Intronic
906093608 1:43204322-43204344 TGCCTTTGAAGGGGCCCAGATGG - Intronic
906685595 1:47761277-47761299 CTCCCTGGAAAGAGCCAAGTAGG + Exonic
907237326 1:53061661-53061683 TTTCCGGGAAGAGGCCCAGCAGG + Intergenic
907564895 1:55425545-55425567 TTGCCTGGATGGGCCCCAGAAGG + Intergenic
911543241 1:99184345-99184367 TGCCATGGGAGGGACCCAGTGGG - Intergenic
911554914 1:99331860-99331882 TGCCCTGGGAGGGACCCAGTGGG + Intergenic
911951773 1:104182364-104182386 TGTCCTGGGAGGGGCCCTGTGGG + Intergenic
913084501 1:115424335-115424357 CTGCCTGGAAGGTGCCCAGATGG + Intergenic
914681710 1:149943559-149943581 GTCCCTGGATGGGACCCAGGAGG + Exonic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
915818228 1:158992833-158992855 TGTCATGGAAGGGACCCAGTGGG + Intergenic
915855860 1:159385941-159385963 TCCCATGGGAGGGACCCAGTAGG + Intergenic
915911472 1:159918245-159918267 TTCCCTGGCAGGGGCCCTCGTGG - Exonic
916422165 1:164647502-164647524 ATACCTGGGAGGGGCCCAGGGGG - Intronic
916524073 1:165592778-165592800 GTCCCTGGTAGGGGCCTAGGAGG - Intergenic
918735523 1:188057719-188057741 TGCCATGGGAGGGACCCAGTGGG - Intergenic
919129116 1:193432171-193432193 TGTCCTGGAAGGGACCCAGTGGG - Intergenic
919748955 1:201024747-201024769 TCCCCTGGAAAGGGCCCAAGAGG + Intergenic
919803578 1:201367680-201367702 TTCCCTGGAAAGAGCACTGTGGG + Intronic
921512918 1:216054226-216054248 TTCCCTGGAAGGGGCGTGGTGGG - Intronic
922146433 1:222950120-222950142 TCCCCTGGAAGGATCCCTGTAGG + Intronic
922274460 1:224064324-224064346 TTCCCTAGCGGGTGCCCAGTGGG - Intergenic
923179051 1:231498591-231498613 TGCCATGGGAGGGACCCAGTGGG - Intergenic
923518797 1:234720371-234720393 TGCCCTGGAAAGGCCACAGTTGG + Intergenic
1063095101 10:2902220-2902242 TGCCATGGAAGGGACCCGGTGGG - Intergenic
1064500240 10:15963561-15963583 TGTCATGGAAGGGACCCAGTGGG - Intergenic
1064508878 10:16067199-16067221 TGTCATGGAAGGGACCCAGTGGG - Intergenic
1065263141 10:23946901-23946923 TTTCGTGGGAGGGACCCAGTGGG + Intronic
1066013512 10:31215848-31215870 TTCCTAGGAAGGTGCCCAGTGGG - Intergenic
1066221017 10:33336091-33336113 CTCCCTGGGAGGTGCCCCGTGGG - Intronic
1068570331 10:58621083-58621105 TTCCCTGGAAGGAGCCTTCTTGG - Intronic
1068999361 10:63245868-63245890 TGTCCTGGGAGGGTCCCAGTGGG - Intronic
1069561622 10:69435024-69435046 GTACATGGAAGGAGCCCAGTGGG - Intergenic
1069988327 10:72298848-72298870 TTCCCTGGAAGGGCCCCGCTTGG - Intergenic
1070590672 10:77798488-77798510 TTACCTTCAAGGAGCCCAGTGGG - Intronic
1070647559 10:78212324-78212346 TGTCCTGGCATGGGCCCAGTAGG + Intergenic
1070685259 10:78475853-78475875 CTCCCATGATGGGGCCCAGTGGG - Intergenic
1070952662 10:80443638-80443660 TTCCCCAGAAGGGGCGCAGATGG + Intergenic
1071569670 10:86690099-86690121 TTCCCTGGAATGTGCCCAGGAGG - Intronic
1071746071 10:88420944-88420966 TTCCCAAGAAGGGGCCCTTTGGG - Intronic
1073990828 10:109260910-109260932 TTTCATGGGAGGGACCCAGTGGG - Intergenic
1074965691 10:118489001-118489023 TGTCTTGGGAGGGGCCCAGTGGG + Intergenic
1075629015 10:123988745-123988767 TTTCATGGGAGGGGCCCAGTGGG + Intergenic
1076420138 10:130325715-130325737 TGTCCTGGGAGGGACCCAGTGGG - Intergenic
1077456580 11:2685084-2685106 TTCCAGGGAAGGGGCCCTTTTGG + Intronic
1078135446 11:8648239-8648261 TTCCCTGGAAAAGGCCTAATGGG - Intronic
1080449894 11:32370099-32370121 TGTCATGGGAGGGGCCCAGTGGG - Intergenic
1080497053 11:32830212-32830234 TTACCTGGAAGGGGCCACCTCGG + Intronic
1080959176 11:37137819-37137841 TGTCCTGGGAGGGACCCAGTGGG - Intergenic
1081386751 11:42481028-42481050 TGTCATGGAAGGGACCCAGTGGG + Intergenic
1081853694 11:46290852-46290874 TGCACTGGAAGGGCCCCAGCTGG + Intronic
1081943110 11:46962128-46962150 TGTCATGGAAGGGACCCAGTGGG - Intronic
1082981744 11:59130568-59130590 TGTCCTGGGAGGGACCCAGTGGG + Intergenic
1082982040 11:59132569-59132591 TGTCCTGGGAGGGACCCAGTGGG + Intergenic
1083615404 11:64023681-64023703 GGGCCTGGAATGGGCCCAGTGGG - Intronic
1086519109 11:87650239-87650261 TTTTGTGGAAGGGACCCAGTGGG - Intergenic
1086580500 11:88392993-88393015 TGTCATGGAAGGGACCCAGTGGG - Intergenic
1087908498 11:103726458-103726480 TGTCCTGGGAGGGACCCAGTGGG - Intergenic
1087908761 11:103728406-103728428 TGTCATGGAAGGGACCCAGTGGG - Intergenic
1087923087 11:103889486-103889508 TTCCCTGGGATGGGGCCAGCAGG + Intergenic
1089370296 11:117950773-117950795 TTCCCTGGATGGATTCCAGTGGG - Intergenic
1091700138 12:2653767-2653789 TCCCTGGGAAGGGGCCCAGCTGG + Intronic
1091752191 12:3029963-3029985 TTCCCTGGAAGGGACATACTTGG + Intronic
1093220257 12:16412586-16412608 TGTCCTGGGAGGGACCCAGTGGG + Intronic
1093585942 12:20836159-20836181 TGTCATGGAAGGGACCCAGTGGG - Intronic
1093629290 12:21388364-21388386 TGTCATGGAAGGGACCCAGTGGG + Intronic
1094007887 12:25774732-25774754 TTCCCTGGAAGGGGCTCCTCAGG - Intergenic
1094282612 12:28756150-28756172 TGTCATGGAAGGGACCCAGTGGG - Intergenic
1094801073 12:34036541-34036563 TGTCGTGGAAGGGACCCAGTGGG - Intergenic
1096845146 12:54402327-54402349 CTCCCTGGAAGGGACACAGAGGG + Exonic
1098578346 12:72070218-72070240 TGCCATGGGAGGGACCCAGTGGG - Intronic
1098879046 12:75897878-75897900 TTCCCTGGGATGTGCCCAGCTGG + Intergenic
1099117404 12:78644666-78644688 TGTCCTGGGAGGGACCCAGTGGG + Intergenic
1099156319 12:79180874-79180896 TTTCATGGGAGGGACCCAGTGGG + Intronic
1099768955 12:87028141-87028163 CTCCATGGGAGGGACCCAGTGGG - Intergenic
1101836428 12:108298889-108298911 TTCCCTGGGACGGTCCCAGGAGG + Intronic
1102592719 12:113969203-113969225 TGTCCTGGGAGGGACCCAGTGGG - Intergenic
1102638974 12:114349505-114349527 TGTCCTGGGAGGGACCCAGTGGG + Intergenic
1102701653 12:114844563-114844585 TTCCCTTCAAATGGCCCAGTTGG - Intergenic
1103023392 12:117554541-117554563 TGTCATGGGAGGGGCCCAGTGGG + Intronic
1103237039 12:119382073-119382095 TTGCCTGGATGGGGTCAAGTAGG - Intronic
1104119976 12:125789695-125789717 TGTCATGGGAGGGGCCCAGTGGG + Intergenic
1104465577 12:128987633-128987655 TTCCCTTGAAGGGTCCCTGGTGG + Intergenic
1104897979 12:132173550-132173572 TTCACTGGGAGGGGCACTGTGGG + Intergenic
1106314244 13:28579276-28579298 ATCCCTGGTGGGGGCCCAGGAGG - Intergenic
1108015823 13:46074746-46074768 TTCCATGGATGGGGCAGAGTTGG + Intronic
1109835286 13:67849205-67849227 CCCACTGGAAGGGACCCAGTGGG - Intergenic
1110274810 13:73631603-73631625 GTCACTGGAAGGGGTCCAGATGG + Intergenic
1111310324 13:86475726-86475748 TGTCCTGGGAGGGACCCAGTGGG - Intergenic
1111649467 13:91071526-91071548 TGTCATGGGAGGGGCCCAGTGGG + Intergenic
1112860393 13:103823687-103823709 TGTCATGGAAGGGACCCAGTGGG + Intergenic
1112872635 13:103993793-103993815 TTCCATGAGAGGAGCCCAGTGGG + Intergenic
1113048802 13:106185837-106185859 TGCTCTGGGAGGGACCCAGTGGG + Intergenic
1113091113 13:106618327-106618349 TTTCCAGGAAGGGACCCAGTGGG + Intergenic
1113284798 13:108835182-108835204 TTCCCTGGGAGGGACCTGGTGGG + Intronic
1115010457 14:28539225-28539247 TTTTGTGGAAGGGACCCAGTGGG + Intergenic
1115113802 14:29855705-29855727 TGCTGTGGAAGGGACCCAGTGGG + Intronic
1115134664 14:30094495-30094517 TGTCATGGAAGGGACCCAGTTGG + Intronic
1116706730 14:48312049-48312071 TGTCCTGGGAGGGACCCAGTGGG - Intergenic
1117438065 14:55736308-55736330 TGCCATGGGTGGGGCCCAGTGGG + Intergenic
1117451791 14:55858277-55858299 TGTTCTGGGAGGGGCCCAGTGGG + Intergenic
1117673055 14:58127265-58127287 TGCCATGGGAGGGACCCAGTGGG + Intronic
1120460073 14:84783927-84783949 TGCCTTTGTAGGGGCCCAGTAGG + Intergenic
1120745274 14:88146406-88146428 TTCCCTGGAGTTGGGCCAGTTGG - Intergenic
1121864751 14:97352300-97352322 TGTCATGGGAGGGGCCCAGTTGG + Intergenic
1121895520 14:97643440-97643462 TTTCATGGGAGGGACCCAGTGGG + Intergenic
1122954930 14:105066128-105066150 TTCTCTGTGAGGGGCCCTGTGGG + Intergenic
1124616410 15:31245428-31245450 GTCACTGGAAGGGGCCAGGTAGG + Intergenic
1125612576 15:40981846-40981868 TTCCATGGAAGAGGAGCAGTAGG - Intronic
1128088009 15:64899008-64899030 TCCCCAGGCAGGGGCCCAGTTGG - Intronic
1128731368 15:70023736-70023758 TTCCCTGAGAGGAGCCCAGTGGG + Intergenic
1129596074 15:76965469-76965491 TGCCGTGGAAGGAACCCAGTGGG + Intergenic
1130796021 15:87210238-87210260 TTCCCTGGAAGGGTTGCAGGGGG + Intergenic
1131987030 15:98052816-98052838 TGTCATGGGAGGGGCCCAGTAGG + Intergenic
1132326361 15:100973538-100973560 TGCCCTGGAAGGGCTCCAGGTGG + Intronic
1132426314 15:101720734-101720756 TTTTGTGGAAGGGACCCAGTGGG + Intronic
1132460426 16:51043-51065 TGTCCTGGGAGGGGCCCAGTGGG - Intronic
1132523046 16:400240-400262 CTCCGTGGAGGGGGCCCAGCGGG + Exonic
1133166530 16:3951576-3951598 TGCCCTGGAAGGAACCCAGATGG - Intergenic
1133346005 16:5070858-5070880 TTGTGTGGAAGGGACCCAGTGGG + Intronic
1133872331 16:9701083-9701105 GTCGCTGGAACAGGCCCAGTGGG - Intergenic
1134061719 16:11203193-11203215 TTCCGTGGAAGGGGCCAGGGAGG + Intergenic
1134506818 16:14814488-14814510 TGTCATGGAAGGGACCCAGTGGG + Intronic
1134573743 16:15314333-15314355 TGTCATGGAAGGGACCCAGTGGG - Intergenic
1134728680 16:16441983-16442005 TGTCATGGAAGGGACCCAGTGGG + Intergenic
1134938763 16:18269941-18269963 TGTCATGGAAGGGACCCAGTGGG - Intergenic
1135114381 16:19712845-19712867 GGCCCTGGAAGGGGCTCAGCTGG + Intronic
1136710087 16:32229691-32229713 TGTCATGGAAGGGACCCAGTTGG + Intergenic
1136757822 16:32699720-32699742 TGTCATGGAAGGGACCCAGTTGG - Intergenic
1136810284 16:33170655-33170677 TGTCATGGAAGGGACCCAGTTGG + Intergenic
1136816760 16:33280735-33280757 TGTCATGGAAGGGACCCAGTTGG + Intronic
1139188320 16:64833245-64833267 TTTCATGGGAGGGACCCAGTGGG + Intergenic
1139465165 16:67150509-67150531 TCCCCTGTAAGGGTCGCAGTCGG + Exonic
1139852974 16:69961865-69961887 TTCCCGGGAAGGGCCCAGGTAGG + Intronic
1139881945 16:70184773-70184795 TTCCCGGGAAGGGCCCAGGTAGG + Intronic
1140225034 16:73070320-73070342 TTCTTTGGAAGGGGCTCAGATGG - Intergenic
1140457545 16:75113912-75113934 CTCCCTGGAAGAGGCCCCCTGGG - Intronic
1141214350 16:82009882-82009904 TGTCCTGGGAGGGACCCAGTGGG + Intronic
1142149892 16:88507964-88507986 ATCACAGGAAGGGGCCCAGTGGG + Intronic
1142249348 16:88983969-88983991 TTCCCTGTAAGGAGCCCAGGCGG + Intergenic
1142440078 16:90092218-90092240 TATCGTGGGAGGGGCCCAGTGGG - Intergenic
1203059972 16_KI270728v1_random:960069-960091 TGTCATGGAAGGGACCCAGTTGG - Intergenic
1143121174 17:4607935-4607957 TTTCCTGGCAGTGGCCCAGAGGG - Exonic
1145024908 17:19460969-19460991 TTCCCTAGAGGGAGCCAAGTGGG + Intergenic
1145766123 17:27459341-27459363 TTCCCTAGCAAGGGTCCAGTAGG - Intronic
1147760631 17:42795473-42795495 TCCCCTGGGAGGGGCCGAGCAGG - Exonic
1148801296 17:50228062-50228084 TGTCATGGAAGGGACCCAGTGGG + Intergenic
1149064404 17:52463492-52463514 TTTCATGGAAGGGACTCAGTGGG - Intergenic
1151063642 17:71125761-71125783 TTTCCGAGTAGGGGCCCAGTTGG - Intergenic
1151390401 17:73783255-73783277 AGCTCTGGAAGGGGCCCAGCAGG - Intergenic
1151527863 17:74683273-74683295 TTCCCTGGATGGTCCACAGTTGG - Intronic
1151967107 17:77437187-77437209 TTCCCTCGCAGGGCCCCACTGGG - Intronic
1152158269 17:78649305-78649327 TGTCCTGGGAGGGACCCAGTGGG - Intergenic
1152246394 17:79186882-79186904 TTCCCTGGCAGGGGCCTTGGAGG + Intronic
1152526364 17:80890321-80890343 TTCCCTGGAAGGGGCCCAGTGGG + Intronic
1152723568 17:81934576-81934598 TTCACTGGGAGGAGCCAAGTGGG - Intronic
1152957475 18:51339-51361 TATCGTGGGAGGGGCCCAGTGGG + Intronic
1153699538 18:7678487-7678509 TTGCCTGGACGGGGCCCTGAGGG + Intronic
1155140966 18:23044104-23044126 TGTCATGGAAGGGACCCAGTAGG + Intergenic
1157500679 18:48188483-48188505 TTCTGTGGGAGGGACCCAGTGGG - Intronic
1157781740 18:50445693-50445715 TGTCATGGAAGGGACCCAGTGGG - Intergenic
1158195186 18:54877024-54877046 TTTCATGGGAGGGACCCAGTGGG + Intronic
1158415049 18:57242850-57242872 TTCCATGGGAGGGGCTCAGGTGG + Intergenic
1158786581 18:60720811-60720833 TATCATGGAAGGGACCCAGTGGG - Intergenic
1158879926 18:61768351-61768373 GTTCCTGGGAGGGACCCAGTGGG + Intergenic
1159151908 18:64532797-64532819 TGCCATGGGAGGGACCCAGTGGG + Intergenic
1159521222 18:69527528-69527550 TGTCCTGGGAGGGACCCAGTGGG - Intronic
1160428827 18:78797320-78797342 TGCCCTGGAAGGAGGCCTGTTGG - Intergenic
1160449396 18:78951957-78951979 TGCCATGGGAGGGGCCCGGTGGG - Intergenic
1161957828 19:7506267-7506289 TTCCCGGGACGGGGCTCCGTGGG - Intronic
1163530306 19:17844844-17844866 CTCCCTGGGATGGGCCCAGGAGG + Intronic
1163554647 19:17985085-17985107 TTCCCTGGATGGGGCAGAGAGGG - Intronic
1165143151 19:33714657-33714679 TGTCCTGGGAGGGACCCAGTGGG + Intronic
1167104794 19:47423880-47423902 TTCCCTGGGAGAGGCCGAGGAGG + Intergenic
1167288455 19:48612061-48612083 TTCCCTGTAAGTGGCCGAGTGGG - Intronic
1167794749 19:51702211-51702233 GTCCCGGAAAGGGGCTCAGTTGG - Intergenic
1168210113 19:54884100-54884122 TTCCCTGGAAAGCACCCAGATGG - Intronic
924965937 2:76620-76642 TTTCATGGAAGGGACCCAGTGGG - Intergenic
925244571 2:2369564-2369586 TGTCATGGAAGGGACCCAGTGGG + Intergenic
926300578 2:11599271-11599293 TTCCCTGAAAGAGGCTCCGTGGG + Intronic
926890222 2:17633240-17633262 TGTCCTGGGAGGGACCCAGTGGG - Intronic
928245310 2:29621619-29621641 GACCCTGGAAGGGGCCAAGAAGG + Intronic
929279934 2:40066652-40066674 TTCGGTGGGAGGGACCCAGTGGG - Intergenic
930940157 2:57002549-57002571 TTGCATGGAAAGGGCACAGTTGG - Intergenic
932012701 2:67994127-67994149 TGTCATGGAAGGGACCCAGTCGG + Intergenic
932371425 2:71191802-71191824 TACCGTGGAAGGGACCAAGTGGG + Intronic
933006865 2:77005557-77005579 TGTCATGGAAGGGACCCAGTGGG + Intronic
933038112 2:77426551-77426573 TGCCCTGGGAGGCACCCAGTGGG + Intronic
933038242 2:77427962-77427984 TGCCCTGGGAGGGACCCAGTGGG + Intronic
933464774 2:82638693-82638715 TTACATGGAAGGGACCCAGTGGG + Intergenic
934567282 2:95347695-95347717 TACCATGGAAGGGCCCCAGGGGG - Intronic
934947372 2:98551575-98551597 TTCCCTGGGAAGGGGCCAATGGG + Intronic
935392027 2:102562824-102562846 TGTCCTGGGAGGGACCCAGTGGG - Intergenic
935563802 2:104585684-104585706 TTCCCTGGAATGTGCCCTCTTGG + Intergenic
936499427 2:113054377-113054399 TGTCATGGAAGGGACCCAGTGGG - Intergenic
936936956 2:117847983-117848005 TTCCCAGAAAGGGACCCAGGGGG + Intergenic
936969434 2:118163276-118163298 TTCCATGGCAGGAACCCAGTGGG + Intergenic
937553932 2:123131235-123131257 TGTCATGGGAGGGGCCCAGTGGG + Intergenic
937932837 2:127219561-127219583 TCCCCTGGAGGGGCCCCAGCCGG - Intronic
938307561 2:130265742-130265764 ATCCCTAGTAGGGGCCCAGCCGG - Intergenic
938869006 2:135454173-135454195 CTTCCTGGAAGGGACCCAGTGGG - Intronic
939781959 2:146459996-146460018 TTTCCAGGTAGGGACCCAGTGGG - Intergenic
941351165 2:164438672-164438694 TGCCCTGGAAGGGGCACTGTAGG + Intergenic
942215620 2:173716646-173716668 TTTCGTGGAAGGTGCCCAGGTGG - Intergenic
942733517 2:179083894-179083916 TGTCCTGGAAGAGACCCAGTGGG - Intergenic
943488966 2:188525638-188525660 TTCCCTGGGAGATACCCAGTGGG + Intronic
944701976 2:202253869-202253891 TGCTCTGGGAGGGACCCAGTGGG - Intergenic
944957867 2:204833534-204833556 TTTCCTGGAAGGGACCTGGTGGG + Intronic
945019107 2:205553324-205553346 GTGCCTGGAAGGGGTCCAGATGG + Exonic
946185673 2:217979092-217979114 GCCCCTGGCAGGGGTCCAGTGGG - Intronic
946389524 2:219407107-219407129 AAACCTGGAAGGGGCCCAGGAGG + Intergenic
948332215 2:237178502-237178524 TCCCTTGGAAGGGCCACAGTGGG + Intergenic
948789845 2:240371578-240371600 TCCCCTGGAAGGGGCCCTGCAGG + Intergenic
949063022 2:241972341-241972363 GTGTCTGGGAGGGGCCCAGTGGG + Intergenic
1168800642 20:642032-642054 TTGCCTGGGGGGGGCCCAGCGGG + Intergenic
1168800671 20:642095-642117 TTGCCTGGGGGGGGCCCAGCGGG + Intergenic
1168800737 20:642225-642247 TTGCCTGGGGGGGGCCCAGCGGG + Intergenic
1170779263 20:19409233-19409255 TTCCCAGGAAGAGGCGCAGCAGG + Intronic
1171767668 20:29299021-29299043 TTTCTTGGAAGCTGCCCAGTGGG + Intergenic
1172435801 20:34928213-34928235 GTCCCTGGCAGGAGCCCAGGAGG - Intergenic
1174537590 20:51264097-51264119 TTTCGTGGGAGGGACCCAGTGGG - Intergenic
1176951131 21:15047647-15047669 TGTCCTGGGAGGGACCCAGTGGG - Intronic
1177654759 21:24003406-24003428 TGTCATGGGAGGGGCCCAGTGGG - Intergenic
1178157575 21:29872830-29872852 TGTCATGGAAGGGACCCAGTGGG - Intronic
1178471281 21:32895184-32895206 TTTCATGGGAGGGACCCAGTGGG - Intergenic
1179321982 21:40300920-40300942 TTCCTTAGAAGGCTCCCAGTAGG + Intronic
1180218232 21:46340266-46340288 TGTCATGGGAGGGGCCCAGTGGG - Intronic
1180594509 22:16964475-16964497 TGCCCTGGAAGAGGCAGAGTTGG - Intronic
1182358931 22:29735365-29735387 TCCCCTGGAAGGGGCCAGGCTGG + Intronic
1184593805 22:45502683-45502705 TTCCCCGGAGGGGGCACAGAGGG - Intronic
1184888974 22:47368036-47368058 TGCCATGGGAGGGACCCAGTGGG - Intergenic
1185296217 22:50056634-50056656 TTCCCAGGAAGCTGGCCAGTGGG + Intronic
1185302072 22:50087039-50087061 TGTCGTGGAAGGGGCCCGGTGGG + Intergenic
1185349517 22:50327189-50327211 TTCCCCGGAAGTCCCCCAGTGGG - Intergenic
949905101 3:8852543-8852565 TTCCCCCAGAGGGGCCCAGTGGG - Intronic
950324137 3:12089403-12089425 TGTCCTGGGAGGGACCCAGTGGG - Intronic
952871637 3:37906115-37906137 TGCCCTGGAAGCCGACCAGTGGG + Intronic
952888748 3:38027622-38027644 CTCTCTGGAAGGAGCCCAGAGGG - Intronic
954975097 3:54685966-54685988 TGCCCTGAAAGGGGATCAGTAGG + Intronic
956147005 3:66200318-66200340 TTCCCTGGCAGGTGCCGGGTGGG + Intronic
956653912 3:71530946-71530968 TTCCATGGTGGGGGCCCATTTGG - Intronic
956877483 3:73477993-73478015 TTTCTTGGGAGGGACCCAGTGGG - Intronic
957276345 3:78095101-78095123 TTCCAGGGGAGGGGCCTAGTGGG - Intergenic
957563438 3:81855403-81855425 TGTCCTGGGAGGGACCCAGTGGG + Intergenic
958157445 3:89772567-89772589 TGCCATGGGAGGGGCCCAGTGGG - Intergenic
958528212 3:95290513-95290535 TGTCCTGGGAGGGACCCAGTGGG + Intergenic
959181994 3:102993089-102993111 TGTCATGGGAGGGGCCCAGTGGG - Intergenic
960481042 3:118190455-118190477 TGTCATGGGAGGGGCCCAGTGGG + Intergenic
961185943 3:124915171-124915193 TTCCCGGGACTGGCCCCAGTGGG + Intronic
961333196 3:126154951-126154973 TTCACTGGCAGGGCCCCTGTGGG + Intronic
962644573 3:137423754-137423776 TGCTGTGGAAGGGACCCAGTGGG + Intergenic
963632623 3:147752154-147752176 TTCCATGGAAGGGTCTCAGAAGG + Intergenic
963893409 3:150660452-150660474 TTGCCTGGAAAGTACCCAGTGGG + Intronic
964605660 3:158557123-158557145 TGTCATGGAAGGGACCCAGTGGG + Intergenic
965083280 3:164063601-164063623 TGTCGTGGGAGGGGCCCAGTGGG + Intergenic
965177875 3:165359348-165359370 TGTCATGGAAGGGACCCAGTGGG - Intergenic
965228118 3:166017907-166017929 TTATTTGGGAGGGGCCCAGTGGG + Intergenic
968000225 3:195200548-195200570 TTGCCTGGGAGGAGCCAAGTTGG - Intronic
968725599 4:2246474-2246496 TGCACTGGAGGTGGCCCAGTGGG - Intergenic
970049087 4:11892382-11892404 TGTCCTGGGAGGGACCCAGTGGG + Intergenic
970553120 4:17204182-17204204 TACCCTAGAAGTGGCTCAGTAGG + Intergenic
970663459 4:18311600-18311622 TGTCCTGGGAGGGACCCAGTGGG - Intergenic
971278959 4:25225391-25225413 TGTCCTGGGAGGGACCCAGTGGG - Intronic
971984016 4:33795555-33795577 TTTCATGGGAGGGACCCAGTGGG - Intergenic
972112779 4:35586153-35586175 TTTCCTGGGAGGAACCCAGTGGG + Intergenic
972268187 4:37483041-37483063 TGTCATGGGAGGGGCCCAGTGGG + Intronic
972347540 4:38205436-38205458 TTGCCTGGAAGAGGCCAGGTTGG - Intergenic
972848373 4:43017995-43018017 TTCCCTGAAATGTGCCAAGTAGG + Intronic
973066623 4:45802823-45802845 TGTCCTGGAAGGGACACAGTGGG - Intergenic
973601772 4:52549419-52549441 TTCCCTGGCAGAGGCCGAGGTGG - Intergenic
974027046 4:56742367-56742389 TGTCCTGGAAGGGACCCGGTGGG - Intergenic
974214659 4:58829198-58829220 TGCTGTGGAAGGGACCCAGTAGG - Intergenic
974334671 4:60526509-60526531 TGTCCTGGGAGGGACCCAGTGGG + Intergenic
974511328 4:62845636-62845658 TGTCATGGAAGGGACCCAGTGGG - Intergenic
975307463 4:72866169-72866191 TTTCATGGGAGGGACCCAGTGGG + Intergenic
975683552 4:76898143-76898165 TTCCCGGGATAGGGCCGAGTCGG + Exonic
975877527 4:78860501-78860523 GTCCATGGAAGGTGCTCAGTTGG + Intronic
975941999 4:79659369-79659391 TTTCATGGAAGGAACCCAGTGGG + Intergenic
978090022 4:104703677-104703699 TTCCCTGGCAAGGTACCAGTGGG + Intergenic
978183384 4:105829657-105829679 TGTCATGGAAGGGACCCAGTGGG - Intronic
978904183 4:113986273-113986295 TTTCATGGGAGGGACCCAGTGGG + Intergenic
979740091 4:124138876-124138898 TCTCATGGAAGGGACCCAGTGGG + Intergenic
979908224 4:126325194-126325216 TGTCCTGGGAGGGACCCAGTGGG + Intergenic
980386195 4:132089996-132090018 TTTCATGGGAGGGACCCAGTAGG + Intergenic
982494307 4:156071202-156071224 TGCTGTGGAAGGGACCCAGTGGG - Intergenic
983105644 4:163682626-163682648 TGCTGTGGAAGGGACCCAGTGGG + Intronic
983164425 4:164458361-164458383 TGTCATGGAAGGGACCCAGTAGG + Intergenic
983545373 4:168957795-168957817 TGTCGTGGAAGGGACCCAGTGGG + Intronic
984515205 4:180730461-180730483 TTTTGTGGAAGGGACCCAGTGGG + Intergenic
984571321 4:181397674-181397696 TGCCATGGGAGGGACCCAGTGGG - Intergenic
984938053 4:184907018-184907040 TCCCCTTGAAGTGGCCCTGTTGG + Intergenic
985220117 4:187695533-187695555 TGTCCTGGGAGGGACCCAGTGGG + Intergenic
985630688 5:1012502-1012524 TTTCCTGGAAGGGAGCCAGGAGG + Intronic
986220279 5:5762834-5762856 TGCCCTGGAAGGGGCCTTGAGGG + Intergenic
986894214 5:12346350-12346372 GTCCATGGGAGGGACCCAGTGGG + Intergenic
987153760 5:15067130-15067152 TACCATGGGAGGGCCCCAGTGGG - Intergenic
987223665 5:15817569-15817591 TGTCATGGAAGGGTCCCAGTGGG + Intronic
987236727 5:15950257-15950279 TGTCCTGGGAGGGACCCAGTGGG - Intergenic
988149823 5:27363559-27363581 TTTCATGGAAGGAACCCAGTGGG + Intergenic
988296479 5:29369521-29369543 TGTCATGGAAGGGACCCAGTGGG - Intergenic
988416730 5:30954988-30955010 TATCCTGGGAGGGACCCAGTGGG + Intergenic
988804623 5:34728444-34728466 CTCCATGGGAGGGACCCAGTGGG + Intronic
989747887 5:44853089-44853111 TGTCATGGGAGGGGCCCAGTGGG - Intergenic
990701198 5:58476555-58476577 TGTCCTGGGAGGGACCCAGTGGG - Intergenic
992008142 5:72499812-72499834 TTCCATGGAAGGTGGCCAGAGGG + Intronic
992079299 5:73219005-73219027 TTCTCTGGAAGGAGCCCTCTGGG - Intergenic
993253244 5:85554898-85554920 TTCCAGGGAAGGGGCCTAGTGGG - Intergenic
993409486 5:87555823-87555845 TGCCATGGGAGGGACCCAGTGGG - Intergenic
993575275 5:89591967-89591989 TTTTGTGGAAGGGACCCAGTGGG + Intergenic
993809892 5:92463371-92463393 TATCCTGGGAGGGACCCAGTGGG - Intergenic
994006608 5:94844892-94844914 TTTCCTGGAAGAAACCCAGTAGG + Intronic
994040983 5:95259608-95259630 TACCCTGGTGGGGGCCCTGTGGG + Intronic
994764669 5:103900933-103900955 TGTCCTGGAAGGGATCCAGTGGG + Intergenic
995390826 5:111638918-111638940 TGCCATGGGAGGGACCCAGTGGG + Intergenic
995703464 5:114961237-114961259 TGTCATGGAAGGGACCCAGTGGG - Intergenic
997256905 5:132436003-132436025 TTCCCTGGGAGTGGACCTGTGGG + Intronic
999276184 5:150331592-150331614 ATCTCTGGAGGGGGCCCAGCAGG + Intronic
999581818 5:153047380-153047402 TGTCATGGAAGGGACCCAGTGGG + Intergenic
1001260651 5:170225591-170225613 TTCCCTGGAAAGGGAACATTTGG - Intergenic
1003349544 6:5303193-5303215 TTCCCTGGCAGGGACTCAGTGGG + Intronic
1004193268 6:13483330-13483352 TTTCCTTGAATGGGCCCTGTTGG - Intronic
1007322613 6:41038477-41038499 CACCCTGGGAGAGGCCCAGTGGG - Intronic
1007753496 6:44083997-44084019 TTCCCTGGAAAGACCCCAGCAGG - Intergenic
1008081943 6:47204143-47204165 TACCCAGGAAGGCTCCCAGTGGG - Intergenic
1009699862 6:67161750-67161772 TGTCATGGAAGGGACCCAGTGGG + Intergenic
1009847507 6:69151842-69151864 TGCCATGGGAGGGACCCAGTGGG + Intronic
1012013876 6:93829889-93829911 TTTCCTGGGAAGGACCCAGTGGG + Intergenic
1012069322 6:94592693-94592715 TGTCCTGGGAGGGACCCAGTGGG - Intergenic
1012644747 6:101664970-101664992 TGCCATGCGAGGGGCCCAGTGGG - Intronic
1014407128 6:121065506-121065528 TTCTGTGGGAGGGACCCAGTGGG + Intergenic
1015044417 6:128760805-128760827 TCTGCTGGGAGGGGCCCAGTGGG - Intergenic
1015481116 6:133710949-133710971 TGCCATGGGTGGGGCCCAGTGGG - Intergenic
1016067799 6:139701769-139701791 TGTCCTGGGAGGGACCCAGTGGG - Intergenic
1016428767 6:143961304-143961326 TTCCCTGTAAGAGGATCAGTTGG - Intronic
1016935425 6:149446127-149446149 TTCCCTGGAAGGGGCTAAAGGGG - Intergenic
1017769850 6:157636567-157636589 TTCCCAGGCAGGAGCCCAGCAGG - Intronic
1018489836 6:164280339-164280361 TGCCATGGGAGGGACCCAGTGGG + Intergenic
1018526042 6:164710679-164710701 TCCCCTGGAATGGGGCCACTCGG + Intergenic
1018645323 6:165942654-165942676 TTCCCAAGAAGAGGTCCAGTGGG - Intronic
1019514866 7:1435144-1435166 TTCCCTGAAACGGGACCAGATGG + Exonic
1019550266 7:1598938-1598960 TACCATGGGAGGGACCCAGTGGG - Intergenic
1020400826 7:7775318-7775340 TGTCCTGGGAGGGACCCAGTGGG + Intronic
1022575796 7:31495842-31495864 TGTCATGGGAGGGGCCCAGTGGG - Intergenic
1022850682 7:34258650-34258672 TTCCCTGGAAGTGACAAAGTGGG + Intergenic
1023123769 7:36935100-36935122 TGCTGTGGAAGGGACCCAGTGGG + Intronic
1024110047 7:46135362-46135384 TGTCATGGAAGGGACCCAGTGGG - Intergenic
1025750941 7:64293445-64293467 TTCCCTGGGCCGTGCCCAGTGGG - Intergenic
1026567266 7:71499832-71499854 TATCCTGGGAGGGACCCAGTGGG + Intronic
1028620321 7:92819397-92819419 TTCACTGCAAAGGGCCCTGTGGG + Intronic
1028715189 7:93957426-93957448 TGTCATGGAAGGGACCCAGTGGG + Intergenic
1029626962 7:101725922-101725944 TTCCCTCGGAGGGGCCCCTTGGG - Intergenic
1031017103 7:116586925-116586947 TGTCGTGGGAGGGGCCCAGTGGG + Intergenic
1031150858 7:118052564-118052586 TTCCCAGGCAGGGGACCACTTGG - Intergenic
1031230073 7:119095132-119095154 TACCGTGGGAGGGACCCAGTTGG - Intergenic
1031974398 7:128084713-128084735 CTCCCTGGCAGGCACCCAGTTGG + Exonic
1032019877 7:128401396-128401418 TTTCCTGGGAGGTGACCAGTGGG + Intronic
1032570593 7:132992075-132992097 TTCCCTTGATGGGTCCTAGTAGG - Intronic
1032714786 7:134498166-134498188 TGCTGTGGGAGGGGCCCAGTGGG + Intergenic
1032728322 7:134613034-134613056 TGTTGTGGAAGGGGCCCAGTGGG - Intergenic
1033841578 7:145380684-145380706 TGCCGTGGGAGGGACCCAGTTGG - Intergenic
1034075202 7:148224950-148224972 TGCCATGGGAGGGACCCAGTGGG - Intronic
1034741953 7:153483287-153483309 TGTCATGGGAGGGGCCCAGTGGG + Intergenic
1035651007 8:1264817-1264839 TGCCATGGGAGGGACCCAGTGGG + Intergenic
1037311309 8:17559675-17559697 TGCCGTGGAAGGGACCCAGTGGG - Intronic
1037805925 8:22057840-22057862 GTCCCTGGAAGGGACACACTGGG - Intronic
1038360789 8:26873945-26873967 TGTCGTGGAAGGGACCCAGTGGG - Intergenic
1038478471 8:27885372-27885394 GTACCTAGAAGGGGCCCTGTTGG - Intronic
1038734897 8:30160072-30160094 TTCCCAGGAAGGGGACAAGATGG + Intronic
1041296732 8:56364506-56364528 TGTCATGGGAGGGGCCCAGTGGG - Intergenic
1041602576 8:59737651-59737673 TGTCCTGGAAGGGACCCGGTGGG + Intergenic
1041770693 8:61469503-61469525 TACCCAGGCAGGGGCCAAGTGGG - Intronic
1041780723 8:61575959-61575981 TTCCATGGAAGAGGCAAAGTAGG - Intronic
1042149897 8:65770503-65770525 TGTTCTGGGAGGGGCCCAGTGGG - Intronic
1043909344 8:85842724-85842746 TTGCCTGGAAGTGGCCCTGCAGG + Intergenic
1044017005 8:87057428-87057450 TATCATGGCAGGGGCCCAGTGGG - Intronic
1044409078 8:91865425-91865447 TGTCATGGGAGGGGCCCAGTGGG - Intergenic
1045702134 8:104879458-104879480 TGCCATGGGAGGGACCCAGTAGG - Intronic
1046016540 8:108612101-108612123 TGTCGTGGAAGGGGCCCATTGGG - Intronic
1046020623 8:108660340-108660362 TTCCATTGAATGGGCCCAGATGG + Intronic
1046114584 8:109769389-109769411 TGCCCAGGTAGGGTCCCAGTAGG + Intergenic
1046532936 8:115471446-115471468 TGTCCTGGGAGGGACCCAGTGGG - Intronic
1047782316 8:128120076-128120098 GTGCCTGGTAGGGTCCCAGTAGG + Intergenic
1047909606 8:129513424-129513446 TGCTGTGGGAGGGGCCCAGTGGG - Intergenic
1048210579 8:132451077-132451099 TTCCATGGGAGGGACCCGGTGGG + Intronic
1048356039 8:133654782-133654804 GTCCCTGGAAGGAGCCCAGCAGG + Intergenic
1048622847 8:136153602-136153624 TGTCCTGAGAGGGGCCCAGTGGG + Intergenic
1048658705 8:136572201-136572223 TGTCATGGAAGGGACCCAGTGGG + Intergenic
1048781636 8:138007996-138008018 TGTCGTGGAAGGGACCCAGTGGG + Intergenic
1049151508 8:141038014-141038036 ATCCCAGGAAGGGGCCGAGCAGG - Intergenic
1050785935 9:9401715-9401737 TGTCCTGGGAGGGACCCAGTAGG + Intronic
1052851539 9:33381333-33381355 GTCCCTGGGAGGGGCCCTGGAGG - Intergenic
1057144120 9:92747155-92747177 TTCCCTGGTGGGTCCCCAGTAGG + Intronic
1061155875 9:128861244-128861266 TGTCCTGGGAGGGACCCAGTGGG + Intronic
1061218509 9:129235661-129235683 ACCCCTTGGAGGGGCCCAGTAGG - Intergenic
1061368224 9:130183423-130183445 TTCCCTGGCAGGGGAGCAGGGGG + Intronic
1061393725 9:130331996-130332018 TCTCCTGGAAGGGGACCACTGGG + Intronic
1061789049 9:133048967-133048989 TCCCCAGGAAGGGGCCAAGGAGG - Intronic
1062049233 9:134438574-134438596 GTGCCTGGGAGGGGCCCAGCTGG - Intronic
1062619336 9:137412483-137412505 TCTCCTGGAAGGGCCCCGGTGGG - Intronic
1062740669 9:138173231-138173253 TATCGTGGGAGGGGCCCAGTGGG - Intergenic
1185951017 X:4434383-4434405 TGCCGTGGGAGGGACCCAGTAGG + Intergenic
1187298870 X:18028962-18028984 TGTCCTGGGAGGGACCCAGTGGG + Intergenic
1187438578 X:19295572-19295594 TGTCGTGGAAGGGACCCAGTGGG + Intergenic
1187590036 X:20707439-20707461 TACCGTGGGAGGGACCCAGTGGG + Intergenic
1188056181 X:25543164-25543186 TGTCATGGAAGGGACCCAGTGGG - Intergenic
1188908227 X:35813571-35813593 TCCCCTGGAAGGATCCCAGAGGG + Intergenic
1188960961 X:36490960-36490982 ATTCCTGGGAGGGACCCAGTGGG - Intergenic
1191714242 X:64183337-64183359 TTCCTTGGAAGTGGGGCAGTGGG + Intergenic
1191972511 X:66832615-66832637 TGTCATGGGAGGGGCCCAGTGGG + Intergenic
1193524680 X:82574724-82574746 TGCCCTTGAAGGGGCCTAGATGG - Intergenic
1193644667 X:84052982-84053004 TTCCATGGGAGGAACCCAGTTGG + Intergenic
1193682716 X:84541627-84541649 TTCACTGGCAGTGTCCCAGTGGG - Intergenic
1193682761 X:84541872-84541894 TTCACTGGCAGTGTCCCAGTGGG - Intergenic
1193840852 X:86406038-86406060 TGTCATGGGAGGGGCCCAGTGGG - Intronic
1194397682 X:93405204-93405226 TGTCATGGGAGGGGCCCAGTGGG - Intergenic
1195915416 X:109930674-109930696 TTCCCTGGTTGAGCCCCAGTGGG - Intergenic
1197995382 X:132367143-132367165 TGTCCTGGGAGGGACCCAGTGGG - Intergenic
1198600323 X:138277476-138277498 TGTCATGGAAGGGACCCAGTAGG + Intergenic
1199219516 X:145301291-145301313 TGTCATGGGAGGGGCCCAGTGGG + Intergenic
1199565943 X:149216013-149216035 TGTCATGGAAGGGACCCAGTAGG + Intergenic
1199629058 X:149763348-149763370 TTCTCTGCAAGGGGTGCAGTTGG - Intergenic
1199890941 X:152081359-152081381 TTCCCTAAAAGGGGGACAGTTGG + Intergenic
1200346355 X:155452863-155452885 TTTCCTGGGAGGGACCCAGTGGG + Intergenic
1201382033 Y:13391466-13391488 TACCATGGGAGGGACCCAGTGGG + Intronic