ID: 1152527264

View in Genome Browser
Species Human (GRCh38)
Location 17:80895462-80895484
Sequence ACGTGCGGCTCTCAAGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152527264 Original CRISPR ACGTGCGGCTCTCAAGCTCC AGG (reversed) Intronic
902729934 1:18362627-18362649 AAGTCCGTGTCTCAAGCTCCAGG + Intronic
903463348 1:23534541-23534563 CCATGCTGATCTCAAGCTCCTGG - Intergenic
909655931 1:78032595-78032617 CCGGGCTGCTCTCAAACTCCTGG + Intronic
910387746 1:86704102-86704124 ATGTCCTGCCCTCAAGCTCCTGG - Intergenic
910599914 1:89020028-89020050 CCATGCAGGTCTCAAGCTCCTGG - Intronic
911096923 1:94062399-94062421 ACCTGCTTCTCCCAAGCTCCAGG - Intronic
920919183 1:210284219-210284241 ACAGGCTGCTCTCAAACTCCTGG - Intergenic
922207377 1:223460182-223460204 ACGGGCTGTTCTCAAACTCCTGG - Intergenic
923293283 1:232568220-232568242 ATGTGCCAGTCTCAAGCTCCAGG - Intergenic
923693798 1:236225723-236225745 ACAGGCTGGTCTCAAGCTCCTGG - Intronic
1063132396 10:3189374-3189396 CCAGGCTGCTCTCAAGCTCCTGG + Intergenic
1065693634 10:28359345-28359367 ACGGGCTGGTCTCAAACTCCTGG - Intergenic
1069792770 10:71033833-71033855 ACGTGCGGCTCCCATGGCCCTGG + Intergenic
1069892426 10:71660494-71660516 ACATCCGTCTCTCAAGCTACAGG + Intronic
1075442876 10:122493777-122493799 AGGTGGGGCCCTCAAGGTCCTGG - Intronic
1078415592 11:11162205-11162227 ACTTGCACCTCTCAACCTCCTGG + Intergenic
1079363562 11:19790105-19790127 GTGGGCGGCTCTCATGCTCCCGG + Intronic
1083411752 11:62498547-62498569 ACGTGCTGCTCTCAAACTTCTGG - Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1085035888 11:73299800-73299822 CCCTGAGGCTCTCAAGCTGCTGG - Intergenic
1085980703 11:81720295-81720317 TCATGCTGCTCTCAAACTCCTGG - Intergenic
1091457294 12:617545-617567 CTGTGCAGCTCTGAAGCTCCTGG + Intronic
1092881281 12:12889730-12889752 ACATGCTGGTCTCAAACTCCTGG - Intergenic
1095616490 12:44195842-44195864 ACATGCTGGTCTCAAACTCCTGG - Intronic
1098202557 12:68071395-68071417 CCGGGCTGGTCTCAAGCTCCTGG - Intergenic
1099610543 12:84862998-84863020 ACAGGCTGCTCTCAAGCTGCTGG + Intronic
1102245994 12:111356154-111356176 CCGGGCTGGTCTCAAGCTCCTGG + Intergenic
1102252529 12:111397203-111397225 ACGTGGGGCACGCGAGCTCCTGG - Intergenic
1104761683 12:131300688-131300710 ACGTCAGGGTCTCAGGCTCCAGG - Intergenic
1104835688 12:131788688-131788710 GCTGGCTGCTCTCAAGCTCCTGG + Intronic
1106549047 13:30755706-30755728 ACGTGCGACCCGCAGGCTCCGGG + Intronic
1106710558 13:32327236-32327258 ACAGGCTGCTCTCAAACTCCTGG - Intronic
1113979214 13:114258886-114258908 ACATGCTGGTCTCAAACTCCTGG - Intronic
1115273940 14:31585322-31585344 ACGTGCAGCTCTGAAGTTGCGGG + Intronic
1115596567 14:34915557-34915579 ACGTGGTGGTCTCAAACTCCTGG + Intergenic
1116805769 14:49492769-49492791 AGCTGCGGCCCTGAAGCTCCAGG - Intergenic
1118282154 14:64439392-64439414 ACTTGGGGCTCTCCACCTCCAGG - Intronic
1119112097 14:71984433-71984455 ACGGGCTGGTCTCAAACTCCTGG - Intronic
1119899704 14:78249297-78249319 ACGTGCTACTCTGAGGCTCCTGG - Intronic
1121197878 14:92090993-92091015 CCAAGCTGCTCTCAAGCTCCTGG + Intronic
1122853812 14:104550510-104550532 CCGTGCAGCTCCCCAGCTCCTGG + Intronic
1124542793 15:30603337-30603359 ACCTGGGGCTCTCAAAGTCCTGG + Intergenic
1125451367 15:39811236-39811258 CCAGGCTGCTCTCAAGCTCCTGG + Intronic
1125498636 15:40222141-40222163 CCGGGCAGCTCTCAAACTCCTGG - Intergenic
1129589088 15:76899371-76899393 CCGTGCTGGTCTCCAGCTCCTGG + Intronic
1129815602 15:78550539-78550561 CCATGCCGGTCTCAAGCTCCTGG + Exonic
1130556952 15:84929641-84929663 CCATGCTGGTCTCAAGCTCCTGG - Intronic
1133321644 16:4917689-4917711 CCGGGCTGCTCTCAAACTCCTGG - Intronic
1133328607 16:4957737-4957759 ACCGGCGGCTCTCCAGCGCCTGG + Intronic
1133826510 16:9282862-9282884 CCATGCTGGTCTCAAGCTCCTGG - Intergenic
1135093184 16:19538517-19538539 CCAGGCTGCTCTCAAGCTCCTGG + Intronic
1135548659 16:23381865-23381887 CCGGGCTGGTCTCAAGCTCCTGG + Intergenic
1139842687 16:69894288-69894310 CCATGCGGATCTCAAACTCCTGG + Intronic
1140166838 16:72561418-72561440 ATGTGCAGCTCTCTAGCTCTAGG - Intergenic
1140397690 16:74642700-74642722 CCATGCTGCTCTCAAACTCCTGG + Intronic
1140698096 16:77554945-77554967 CCGGGCTGCTCTCAAACTCCGGG + Intergenic
1141287032 16:82682014-82682036 AGGTGGGGCTCTCAAGCCCTTGG + Intronic
1143167477 17:4904270-4904292 CACTGCGGCTCTCAAACTCCTGG + Intergenic
1143452765 17:7045647-7045669 ACAGGCTGGTCTCAAGCTCCTGG + Intergenic
1144615973 17:16773237-16773259 ACAGGCTGCTCTCAAACTCCTGG - Intronic
1144896732 17:18542438-18542460 ACAGGCTGCTCTCAAACTCCTGG + Intergenic
1145135485 17:20401772-20401794 ACAGGCTGCTCTCAAACTCCTGG - Intergenic
1145791407 17:27629841-27629863 CCGAGCTGGTCTCAAGCTCCTGG + Exonic
1148340569 17:46871116-46871138 ACAGGCTGCTCTCAAACTCCTGG + Intronic
1151515353 17:74590866-74590888 CAGGGCTGCTCTCAAGCTCCAGG - Intronic
1152527264 17:80895462-80895484 ACGTGCGGCTCTCAAGCTCCAGG - Intronic
1152844300 17:82590363-82590385 CCATGCTGGTCTCAAGCTCCGGG + Intronic
1153838825 18:8988380-8988402 CCCTGCAGCTCTCAGGCTCCTGG - Intergenic
1157739452 18:50079651-50079673 ACCTGCCACTCTCCAGCTCCTGG + Intronic
1158152344 18:54387287-54387309 GCGGGCGGCTCTCAAGATGCTGG - Intergenic
1161206339 19:3043027-3043049 CCAGGCTGCTCTCAAGCTCCTGG + Intronic
1161722763 19:5912816-5912838 ACAGGCGGGTCTCAAACTCCTGG + Intronic
1161950872 19:7467175-7467197 AGGTGCGGCTCTCACTCGCCTGG + Intronic
1162969641 19:14172528-14172550 CCAGGCTGCTCTCAAGCTCCTGG - Intronic
1162979741 19:14230893-14230915 ACTTGCTGGTCTCAAACTCCTGG + Intergenic
1165296494 19:34930606-34930628 ACCTGGGGCTCCCAAGGTCCTGG - Intronic
1165940627 19:39413291-39413313 ACTTCGGGCTCTCAGGCTCCAGG - Exonic
1166231092 19:41426249-41426271 ACGTGGGGCAGTCCAGCTCCAGG - Exonic
1167132017 19:47593140-47593162 CAGTGCCGATCTCAAGCTCCAGG - Intergenic
1167554524 19:50185655-50185677 ACAGGCTGGTCTCAAGCTCCTGG - Intergenic
1167583988 19:50362745-50362767 CCGTGCTGATCTCAAACTCCTGG + Intronic
1168605462 19:57756146-57756168 ACATGCGGCCCACAAGCTGCGGG + Exonic
925384483 2:3452557-3452579 AAGTGCGGCTCACAACCACCAGG - Intronic
927382239 2:22492411-22492433 CCATGCTGGTCTCAAGCTCCTGG + Intergenic
927768616 2:25837640-25837662 ACGGGCTGGTCTCAAACTCCTGG - Intronic
929824559 2:45300051-45300073 ACGAGCATCTCCCAAGCTCCAGG + Intergenic
930819119 2:55627555-55627577 AGGTGCTGATCTCAAACTCCTGG - Intergenic
932873721 2:75429291-75429313 ACGTGCTGCTCCCAGGCTGCTGG - Intergenic
936463658 2:112728837-112728859 ATGTGAGCCTGTCAAGCTCCAGG + Intronic
937985926 2:127638054-127638076 AGGTGCGGCTCTCTGGCTGCTGG + Intergenic
938044550 2:128106002-128106024 ACATGCTGGTCTCAAACTCCTGG + Intronic
940914361 2:159238356-159238378 TCCTGCTGGTCTCAAGCTCCTGG + Intronic
942547940 2:177084077-177084099 CCATGCTGGTCTCAAGCTCCTGG + Intergenic
944561739 2:200946197-200946219 ACGGGCTGGTCTCAAACTCCTGG + Intronic
944855940 2:203766813-203766835 CCGTGCTGGTCTCAAACTCCTGG - Intergenic
1173391967 20:42643524-42643546 CCATGCTGGTCTCAAGCTCCTGG + Intronic
1176954992 21:15091976-15091998 CCAGGCTGCTCTCAAGCTCCTGG - Intergenic
1177666740 21:24169433-24169455 ATGTGCTGGTCTCAAACTCCTGG - Intergenic
1180593228 22:16957874-16957896 ATGTGCTCCTCTCCAGCTCCTGG - Intergenic
1182806104 22:33071908-33071930 ACGTGGGGCTATCAAGCCTCTGG + Intergenic
1182953304 22:34397455-34397477 CCGGGCTGGTCTCAAGCTCCTGG + Intergenic
1183691987 22:39395407-39395429 CCGGGCGGGTCTCAAACTCCCGG - Intergenic
1184457565 22:44620409-44620431 ACGGGCGGCTCCCGGGCTCCGGG + Intergenic
950629634 3:14273914-14273936 ACATGCTGGTCTCAAACTCCTGG + Intergenic
950733174 3:14980370-14980392 ACAGGCTGCTCTCAAACTCCTGG + Intronic
951887208 3:27536104-27536126 CCAGGCTGCTCTCAAGCTCCTGG - Intergenic
951902277 3:27668493-27668515 TCGTCCTGCTCTCAAACTCCTGG - Intergenic
953014125 3:39056415-39056437 ATTTGCGGCACTTAAGCTCCGGG - Intronic
954255892 3:49405765-49405787 ACCTGCGCCTCTCAAGTTCGAGG + Intronic
959725421 3:109536370-109536392 CCGAGCTGCTCTCAAACTCCCGG - Intergenic
959924826 3:111909384-111909406 ACAGGCTGGTCTCAAGCTCCTGG - Intronic
961330833 3:126136983-126137005 ACATGCAGCTCTGAAGCCCCAGG - Intronic
961499076 3:127318198-127318220 ACGTGCCCCTCTCAGGCTGCAGG - Intergenic
962016605 3:131447211-131447233 GCATGCTGGTCTCAAGCTCCTGG + Intergenic
965385897 3:168046080-168046102 ACGGGCTGGTCTCAAACTCCTGG + Intronic
965461271 3:168967361-168967383 TCAGGCTGCTCTCAAGCTCCTGG + Intergenic
966287274 3:178312518-178312540 ACGGGCTGTTCTCAAACTCCTGG - Intergenic
968498560 4:932462-932484 ACTTCCGGCTGTCAAGCTCCCGG + Exonic
972663083 4:41135878-41135900 CCATGCTGGTCTCAAGCTCCTGG + Intronic
977159517 4:93616332-93616354 ACAGGCGGGTCTCGAGCTCCTGG - Intronic
981762494 4:148209505-148209527 ACAGGCTGCTCTCAAACTCCTGG + Intronic
988111746 5:26831248-26831270 CCAGGCGGCTCTCAAACTCCTGG + Intergenic
989261595 5:39424907-39424929 CCGCGCGGCTCCGAAGCTCCCGG - Exonic
992861766 5:80918586-80918608 CCAGGCTGCTCTCAAGCTCCTGG + Intergenic
993992684 5:94679382-94679404 ACATGCTGGTCTCAAACTCCTGG - Intronic
999387866 5:151168053-151168075 CCATGCTGGTCTCAAGCTCCTGG - Intergenic
1001928912 5:175658849-175658871 AACTGAGGCTCTCAAGCTCAAGG - Intronic
1003859042 6:10305007-10305029 GCGGGCGGGTCTCAAACTCCTGG - Intergenic
1006393367 6:33771847-33771869 ACGCAGGGCTCCCAAGCTCCCGG + Exonic
1008567621 6:52784645-52784667 TCATGCTGCACTCAAGCTCCTGG - Intergenic
1013099686 6:106975572-106975594 GCGAGCGGCTCCCCAGCTCCTGG - Intronic
1017923938 6:158894836-158894858 CCAAGCTGCTCTCAAGCTCCTGG - Intronic
1018926501 6:168210765-168210787 ACGTGCTGCTCTCGGGCCCCTGG + Intergenic
1021825964 7:24551632-24551654 CCGGGCTGCTCTCAAACTCCTGG - Intergenic
1021892651 7:25201467-25201489 CCAGGCTGCTCTCAAGCTCCTGG + Intergenic
1023343723 7:39249780-39249802 AAATGCAGCTCTCAATCTCCCGG + Intronic
1025004490 7:55343788-55343810 ACCTGCGGGTCTCAAGCAGCTGG - Intergenic
1025896893 7:65711127-65711149 CCGTGCTGGTCTCAAACTCCTGG + Intergenic
1026175088 7:67989643-67989665 CCATGCTGGTCTCAAGCTCCTGG - Intergenic
1027223620 7:76230438-76230460 CCAGGCTGCTCTCAAGCTCCTGG - Intronic
1027520261 7:79198035-79198057 CCAGGCTGCTCTCAAGCTCCTGG - Intronic
1027816589 7:82980342-82980364 ACATGGTGCTCTGAAGCTCCCGG + Intronic
1034250541 7:149687123-149687145 CCGGGCTGGTCTCAAGCTCCTGG + Intergenic
1035279477 7:157768538-157768560 ACGTGAGGCTCCCCAGCTCCTGG + Intronic
1036195151 8:6708013-6708035 ACCTGCTGCTCACAAGCCCCTGG - Intergenic
1036961003 8:13244506-13244528 ACGGGCTGGTCTCAAACTCCTGG + Intronic
1037302611 8:17468649-17468671 ACGTGCTGGTCTCGAACTCCTGG + Intergenic
1037510523 8:19577351-19577373 AGGTGCTGCTCTCAAACCCCTGG - Intronic
1038549632 8:28455444-28455466 ACGAGCTGGTCTCAAACTCCTGG + Intronic
1039160030 8:34607863-34607885 CCAGGCTGCTCTCAAGCTCCTGG + Intergenic
1039229565 8:35428393-35428415 CCATGCGGGTCTCAAACTCCTGG + Intronic
1039821665 8:41140607-41140629 CCGTGCGGCTCTCACTCCCCAGG - Intergenic
1039984345 8:42435562-42435584 ACTTGGGGCTCTCAGGCCCCAGG + Intronic
1041248049 8:55907615-55907637 ACGTGGGTCTCTCAAAGTCCTGG - Intronic
1042370143 8:67982212-67982234 ACAAGCTGCTCTCAAACTCCTGG - Intronic
1043055589 8:75433606-75433628 ACGGGCTGGTCTCAAACTCCTGG + Intronic
1043755617 8:84000279-84000301 AGGTGCAGCTCTTAAGCTGCTGG + Intergenic
1045186407 8:99842941-99842963 CCGTGCTGGTCTCAAACTCCTGG - Intronic
1052946508 9:34172799-34172821 ACAGGCTGGTCTCAAGCTCCTGG - Intergenic
1055647169 9:78372344-78372366 CCATGCGGGTCTCAAACTCCTGG - Intergenic
1055676701 9:78670257-78670279 AGGAGTGGCTCTCAAGTTCCAGG + Intergenic
1186052840 X:5617833-5617855 CCAGGCTGCTCTCAAGCTCCTGG - Intergenic
1186351507 X:8744437-8744459 CCGTGCTGGTCTCAAACTCCTGG + Intergenic
1190100088 X:47515993-47516015 CCGGGCGGGTCTCAAACTCCTGG - Intergenic
1192791644 X:74387947-74387969 CCGAGCTGCTCTCAAACTCCTGG - Intergenic
1197259509 X:124303100-124303122 ACGGGCTGGTCTCAAACTCCTGG + Intronic
1201285622 Y:12376102-12376124 ACAGGCTGCTCTCAAACTCCTGG + Intergenic
1201895951 Y:18993021-18993043 GCGAGCGGCTCCCCAGCTCCTGG - Intergenic