ID: 1152529669

View in Genome Browser
Species Human (GRCh38)
Location 17:80910184-80910206
Sequence CGGGGAGCCCAGCACTTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152529669_1152529680 30 Left 1152529669 17:80910184-80910206 CCCTGAAAGTGCTGGGCTCCCCG 0: 1
1: 0
2: 0
3: 7
4: 173
Right 1152529680 17:80910237-80910259 ACTACCTGCAAGCCGGACACAGG 0: 1
1: 0
2: 0
3: 6
4: 62
1152529669_1152529671 -9 Left 1152529669 17:80910184-80910206 CCCTGAAAGTGCTGGGCTCCCCG 0: 1
1: 0
2: 0
3: 7
4: 173
Right 1152529671 17:80910198-80910220 GGCTCCCCGTCTCTGCACTGTGG 0: 1
1: 0
2: 4
3: 13
4: 180
1152529669_1152529676 -3 Left 1152529669 17:80910184-80910206 CCCTGAAAGTGCTGGGCTCCCCG 0: 1
1: 0
2: 0
3: 7
4: 173
Right 1152529676 17:80910204-80910226 CCGTCTCTGCACTGTGGCCTGGG 0: 1
1: 1
2: 4
3: 96
4: 1478
1152529669_1152529674 -4 Left 1152529669 17:80910184-80910206 CCCTGAAAGTGCTGGGCTCCCCG 0: 1
1: 0
2: 0
3: 7
4: 173
Right 1152529674 17:80910203-80910225 CCCGTCTCTGCACTGTGGCCTGG 0: 1
1: 0
2: 2
3: 83
4: 1070
1152529669_1152529678 23 Left 1152529669 17:80910184-80910206 CCCTGAAAGTGCTGGGCTCCCCG 0: 1
1: 0
2: 0
3: 7
4: 173
Right 1152529678 17:80910230-80910252 GCCTGAAACTACCTGCAAGCCGG 0: 1
1: 0
2: 0
3: 8
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152529669 Original CRISPR CGGGGAGCCCAGCACTTTCA GGG (reversed) Intronic
900008747 1:87369-87391 CTGCAATCCCAGCACTTTCAGGG - Intergenic
900375782 1:2354025-2354047 CTGTGATCCCAGCACTTTGAGGG + Intronic
900663427 1:3797790-3797812 CTGTGAGCCCAGCACTTTGGGGG - Intergenic
901594236 1:10372275-10372297 CTGTAATCCCAGCACTTTCAGGG + Intronic
901665910 1:10826037-10826059 CTGGGGACCCAGCACTTTCTTGG + Intergenic
902161628 1:14535133-14535155 CAGGCAGCCCAGGACATTCATGG - Intergenic
902956314 1:19926248-19926270 CAGGGCTCCCAGCACTTTGATGG + Intergenic
903007934 1:20310719-20310741 CTGGAAGCCCAGCCCTTCCAGGG + Exonic
903214854 1:21838343-21838365 CAGAGAGCCCAGCATTTCCATGG - Intronic
903448489 1:23437244-23437266 CGGGGAGCCCAGCGCTGGCCCGG - Exonic
904536662 1:31204036-31204058 CTTAGAGCACAGCACTTTCAGGG + Intronic
905124713 1:35708351-35708373 CGGGGAACCCAGCCCTCTCCCGG + Intergenic
905306846 1:37025546-37025568 CGGGGAGCCAAGGACTTTCCAGG - Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906847924 1:49214425-49214447 CTGGGAGACCAGTTCTTTCACGG + Intronic
907730418 1:57060534-57060556 CGAGGACCCCAGGACATTCAAGG + Intronic
909103900 1:71384667-71384689 CGGGGAGCTCATCACTCTGAAGG + Intergenic
915438071 1:155924463-155924485 CTGTAATCCCAGCACTTTCAGGG - Intronic
915691471 1:157695349-157695371 CTGGGGGCCCAGCACAGTCATGG - Exonic
919121101 1:193341039-193341061 CTGTGATCCCAGCACTTTGAGGG - Intergenic
923673775 1:236063979-236064001 CCGGGAGCACAGCCATTTCACGG + Intronic
1063384902 10:5610022-5610044 AGGTGAGCCCAGCAGTTTCTGGG - Intergenic
1064023479 10:11827933-11827955 CTGTAATCCCAGCACTTTCAGGG - Intronic
1070021855 10:72594639-72594661 CTGCAATCCCAGCACTTTCAGGG + Intronic
1072631330 10:97148977-97148999 CGGTGTGCCCTGCACTTACAGGG - Intronic
1073328305 10:102655249-102655271 CAGGGAGCCCAGCAGCTTCTTGG - Exonic
1076448716 10:130539674-130539696 CTGTAATCCCAGCACTTTCAAGG - Intergenic
1076869400 10:133186038-133186060 CGGGGACCCCAGCACTGACCCGG + Exonic
1077650499 11:3967364-3967386 GGGGGAGCTCAGCATTTTCTTGG + Intronic
1079221970 11:18571093-18571115 CTGTAATCCCAGCACTTTCAAGG + Intronic
1083634432 11:64112699-64112721 CAGAGAGCACAGCACTTGCAAGG + Intronic
1083644082 11:64162417-64162439 CGCTGAGCCCAGCAGTTTAAGGG + Intronic
1084252070 11:67907579-67907601 AGGGGAGCCCAGGATTTTGAGGG - Intergenic
1089302550 11:117507407-117507429 AGGGCACCCCTGCACTTTCAGGG + Intronic
1089683750 11:120133935-120133957 TGGGGGGCCCTGCACTGTCATGG - Intronic
1089829629 11:121315388-121315410 CTGTAATCCCAGCACTTTCAAGG - Intergenic
1090445093 11:126757568-126757590 CAGGGGGCCCAGCAGTTTTAGGG + Intronic
1092961179 12:13598150-13598172 TGGGGAGCCCAGAACTTGCCTGG - Intronic
1096460992 12:51821406-51821428 GGGGGAGCCCAGGACCTTGAGGG + Intergenic
1096584873 12:52613567-52613589 CTGGGAGCACAGCACTCTCCTGG - Intronic
1098114014 12:67155474-67155496 CTGTAATCCCAGCACTTTCAAGG - Intergenic
1098738406 12:74137637-74137659 AGGGGAGCCCATCACATTCATGG - Intergenic
1098847958 12:75561406-75561428 TGGGGAGCCCAGCACACTCCTGG + Intergenic
1102085512 12:110135160-110135182 ACAGTAGCCCAGCACTTTCAAGG + Intronic
1103440179 12:120957193-120957215 TGGGGAGCCCAACCCTTTCCTGG - Intergenic
1107249761 13:38345632-38345654 GGTGGAGCACAGAACTTTCAGGG + Intergenic
1107774387 13:43822828-43822850 AGGGGAGCCCACCACTCTGAAGG - Intergenic
1113229220 13:108194626-108194648 CAGGGATCCCTGCACTCTCATGG + Intergenic
1115871922 14:37814250-37814272 AAGGGAGCCCAGCATTTCCAAGG - Intronic
1120322017 14:82975608-82975630 CTGGGACCACAGCATTTTCAAGG - Intergenic
1120764836 14:88319424-88319446 AGGGGAGCCCAGCAGTATTAGGG - Intronic
1121282350 14:92708339-92708361 CTGTAATCCCAGCACTTTCAGGG + Intronic
1121323223 14:93004916-93004938 GAGGGAGTCCAGCACATTCACGG + Intronic
1124346864 15:28928813-28928835 AGGGGGGCCCAAAACTTTCATGG - Intronic
1124595562 15:31088960-31088982 TGGGGCTCCCAGCACTTTCTTGG + Intronic
1126776875 15:52107882-52107904 CTGGAATCCCAGCACTTTGAGGG - Intergenic
1127786433 15:62359374-62359396 CTGAGACCCCAGCACTTTGAGGG - Intergenic
1129300688 15:74623878-74623900 CAGGGAGCTCATCACTTCCAAGG - Intronic
1129868808 15:78928154-78928176 AGGGAAGCGCAGCCCTTTCAAGG + Intronic
1130264443 15:82387191-82387213 CTGTAATCCCAGCACTTTCAAGG + Intergenic
1130507548 15:84559758-84559780 CTGTAATCCCAGCACTTTCAAGG - Intergenic
1134042078 16:11076514-11076536 AGGGGAACCCAGCAGCTTCAGGG - Intronic
1135400386 16:22162666-22162688 CCGCGAGCCCAGCGCTCTCAGGG + Intergenic
1136776758 16:32875908-32875930 CATGGTGCCCAGCCCTTTCAGGG + Intergenic
1137670555 16:50275902-50275924 TGGGTAGCCCAGCCCATTCATGG + Intronic
1139015402 16:62683947-62683969 TGGGTATCCCTGCACTTTCATGG + Intergenic
1141495790 16:84408502-84408524 CCGGGAGCCGAGCGCTGTCAGGG - Intronic
1141742670 16:85904367-85904389 CTGGGAGTCCAGCACTGTCATGG - Intronic
1142455592 16:90219595-90219617 CTGCAATCCCAGCACTTTCAGGG + Intergenic
1203079173 16_KI270728v1_random:1138017-1138039 CATGGTGCCCAGCCCTTTCAGGG + Intergenic
1142558534 17:795901-795923 CTGGCATCCCAGCACTTTCGAGG - Intergenic
1142961416 17:3554548-3554570 TGGGGAGCACAGCACACTCAGGG - Intronic
1144617128 17:16787081-16787103 AGGTCAGCCCAGCACGTTCAAGG - Intronic
1144895566 17:18528592-18528614 AGGTCAGCCCAGCACGTTCAAGG + Intergenic
1145136650 17:20415638-20415660 AGGTCAGCCCAGCACGTTCAAGG - Intergenic
1145737342 17:27242132-27242154 CTGTAATCCCAGCACTTTCAGGG + Intergenic
1145932013 17:28692604-28692626 CAGTAATCCCAGCACTTTCAGGG + Intronic
1149337806 17:55655193-55655215 CGGGGGGCCAAGTACTTTCTAGG + Intergenic
1149647212 17:58249392-58249414 GGGGGAGCCCCGCGCCTTCAGGG + Intronic
1151406152 17:73887821-73887843 GAGGGAGCTCAGCACTTTCTGGG - Intergenic
1152048457 17:77954399-77954421 CTTGCAGCGCAGCACTTTCAGGG - Intergenic
1152184715 17:78847740-78847762 CTGGAATCCCAGCACTTTGAGGG - Intergenic
1152529669 17:80910184-80910206 CGGGGAGCCCAGCACTTTCAGGG - Intronic
1152668987 17:81590208-81590230 CTGGGAGCCCAGCTCCTCCATGG + Intronic
1154441401 18:14393001-14393023 CGTAGATCCCAGCAATTTCAAGG + Intergenic
1154960438 18:21302976-21302998 CTGTAATCCCAGCACTTTCAGGG - Intronic
1160161929 18:76479898-76479920 GGGGGATCCCAGCAGTTTAAGGG - Intronic
1160223772 18:76996980-76997002 AGGAGAGGCCAACACTTTCAGGG - Intronic
1160834733 19:1119351-1119373 CGGGCTGCCCAGCACTCCCAGGG - Intronic
1161198839 19:3003019-3003041 GGGGGTGCCCAGCACCATCAGGG + Intronic
1161409743 19:4110517-4110539 CGGGGAGATCAGCATTTGCATGG - Exonic
1163126457 19:15246795-15246817 TGGGGGCCCCAGCACTTGCAAGG - Intronic
1163247743 19:16107722-16107744 CTGTGATCCCAGCACTTTGAGGG + Intergenic
1163352424 19:16786263-16786285 CTGTAATCCCAGCACTTTCAGGG - Intronic
1164743901 19:30596940-30596962 CGGGGAGCCCATCGCTTTCTGGG + Intronic
1166581874 19:43908126-43908148 GGGGGAGCCTCACACTTTCATGG + Intergenic
925051146 2:816587-816609 CAGGGAGCCCAGTGCTTGCAGGG + Intergenic
925190426 2:1877857-1877879 GGGGGACCCCAGCACTTCCCTGG - Intronic
925459742 2:4050168-4050190 TTGTGAGCCCAGCACTCTCATGG + Intergenic
935827128 2:106962929-106962951 CTGTGATCCCAGCACTGTCAAGG + Intergenic
937905815 2:127052308-127052330 CGGGGAGCCCAGCGCTGCCGAGG - Exonic
940280506 2:151984117-151984139 AGGGGAGCCCAGTAAATTCAGGG - Intronic
944547760 2:200814413-200814435 CTGAGTGCCCAGCACTTTCCTGG - Intronic
945139466 2:206668449-206668471 CTGGGAGCCCAGGACTTTCCAGG + Intronic
946564999 2:220954576-220954598 GAAGGAGGCCAGCACTTTCAGGG + Intergenic
947687105 2:232097632-232097654 AGGGGAGCCCACCACTTTGAAGG - Intronic
949087089 2:242164392-242164414 CTGCAATCCCAGCACTTTCAGGG + Intergenic
1169210222 20:3762028-3762050 CTGTAATCCCAGCACTTTCACGG + Intronic
1170750810 20:19143014-19143036 CTGGGAGCCCAACACATTCTGGG - Intergenic
1172694122 20:36809956-36809978 CGTGGTGCCCAGCGCTTTCCAGG - Intronic
1172838257 20:37886718-37886740 AGGGGTGCCCAGCACCTTAAGGG + Intergenic
1173187265 20:40849814-40849836 CAGTGAGCTCAGCACTTTCCAGG - Intergenic
1174468474 20:50736494-50736516 TGCGGAGACCAGCACTTTAAAGG - Intronic
1176083784 20:63286730-63286752 TGGGGAGCCCAGCTCCTGCAGGG - Intronic
1176085379 20:63293411-63293433 CGGGGTGCCCAGCACGCACAGGG + Intronic
1176624824 21:9083684-9083706 GGGGGAGCCCAGCCCCTGCACGG - Intergenic
1181563231 22:23717595-23717617 CGGGGATCCCACCAATCTCAGGG - Intergenic
1181761177 22:25059794-25059816 AGGGGACCCCTGCACTCTCAGGG + Intronic
1183714378 22:39525230-39525252 CGGAGAGCCCAGCACAATAAGGG + Intergenic
1183785155 22:40024929-40024951 AGGGGTGCCCAGCGGTTTCAAGG + Intronic
1184165616 22:42725650-42725672 CAGGGAGCCCACCACCTTCCAGG - Intergenic
1184445990 22:44547232-44547254 CAGGGAGGCCGGCGCTTTCAGGG - Intergenic
1184673169 22:46026331-46026353 TGGGGAGCTCAGCTCTGTCATGG - Intergenic
949675222 3:6445513-6445535 CTTGGAGCACAGGACTTTCAAGG - Intergenic
954560071 3:51549249-51549271 CTGTAATCCCAGCACTTTCAGGG - Intronic
956257396 3:67298169-67298191 CGGGCAGGCCAACACTGTCATGG + Intergenic
956841862 3:73147590-73147612 CGGTAATCCCAGCACTTTGAAGG - Intergenic
961453533 3:127013390-127013412 CAGGGAGCCCAGCATCTCCAAGG - Intronic
964927366 3:161975368-161975390 TGGGCATCCCTGCACTTTCAGGG - Intergenic
967818092 3:193815785-193815807 AGAGGAGTCCAGCACTTTCTAGG - Intergenic
968359382 3:198136783-198136805 CGGAGAGCCAAGCACCTTCCAGG + Intergenic
968662478 4:1804459-1804481 GGGGGAGCCCAGGCCTTTCTTGG - Exonic
971307928 4:25500119-25500141 CGGTAATCCCAGCACTTTGAGGG + Intergenic
974037676 4:56831218-56831240 CTGTAATCCCAGCACTTTCAGGG + Intergenic
978619016 4:110621447-110621469 CAGGCAGCCCAGCTCTTCCACGG - Intronic
980480830 4:133385286-133385308 CGGGCATCCCTGCACTCTCAGGG + Intergenic
980902013 4:138914092-138914114 CTGTAATCCCAGCACTTTCAGGG + Intergenic
985534329 5:455134-455156 GGGGGAGACCTGCACTGTCAAGG - Intronic
985920179 5:2965135-2965157 CAGGAACCCCAGCTCTTTCATGG - Intergenic
988852593 5:35194228-35194250 CTGAGAGCCCAGCACTTTGTAGG - Intronic
996407351 5:123118650-123118672 CAGGGTGCACAGCACTTTTAGGG + Intronic
997716494 5:136046846-136046868 CAGGGAGTCCAGCACTTCCTAGG - Exonic
999103112 5:149043863-149043885 CATGGAGCCCAGCATTTTCTGGG + Intronic
999269565 5:150288909-150288931 CGGGGAGCACCGCTGTTTCAGGG - Intronic
1000087564 5:157901316-157901338 CTGTAATCCCAGCACTTTCAAGG - Intergenic
1000399497 5:160811437-160811459 AGGGGAGCCCAGTACTTGGAAGG + Intronic
1001695489 5:173667007-173667029 CAAGGAGGCCAGCACTTTCCTGG - Intergenic
1002342274 5:178524889-178524911 CTGGGAGCCCAGCACTCTGCGGG + Intronic
1004700370 6:18073779-18073801 CTGTAATCCCAGCACTTTCAGGG + Intergenic
1006396890 6:33793441-33793463 GGGGGAGCCCAGCACTGGCTGGG - Intergenic
1007253911 6:40515463-40515485 CTGGGAGCCAGGCACTGTCATGG - Intronic
1014384618 6:120785719-120785741 CTGGCATCCCTGCACTTTCAGGG + Intergenic
1020128298 7:5545458-5545480 TGGAGAGCCCAGCACCTACAGGG - Intronic
1021692937 7:23247904-23247926 CGCGGAGCCCGGCACTGTGATGG + Intronic
1026645718 7:72166446-72166468 CTGTGATCCCAGCACTTTGAGGG - Intronic
1029105364 7:98170839-98170861 TGGGGAGCCCTGCAGTGTCATGG + Intronic
1030172985 7:106623552-106623574 CTGTAATCCCAGCACTTTCAGGG + Intergenic
1032489124 7:132310794-132310816 CTGGGGCACCAGCACTTTCAAGG + Intronic
1034563340 7:151895173-151895195 CTGTGTGCCCAACACTTTCACGG + Intergenic
1035497637 8:66948-66970 CTGCAATCCCAGCACTTTCAGGG - Intergenic
1035918374 8:3650604-3650626 CCGGGAGCTCAGTACATTCATGG - Intronic
1035958619 8:4112128-4112150 CTGGATGCCCAGCACTTTGAAGG - Intronic
1037101909 8:15057131-15057153 GCTGGAGCACAGCACTTTCAGGG + Intronic
1040391635 8:46955205-46955227 CCGGAAGCCCTGAACTTTCATGG + Intergenic
1042221059 8:66474485-66474507 CTGTAATCCCAGCACTTTCAGGG - Intronic
1049071512 8:140359111-140359133 CGGGGAGCCCTGCACTGCCGTGG - Intronic
1053177500 9:35938645-35938667 TGGAGGGCCCAGCACTTTCCAGG + Intergenic
1057242333 9:93422567-93422589 CTGTAATCCCAGCACTTTCAGGG + Intergenic
1059157772 9:112005154-112005176 CTGTAATCCCAGCACTTTCAGGG + Intergenic
1059388705 9:113985328-113985350 CGGGGAGCTCACCACCTCCAGGG + Intronic
1062744069 9:138200497-138200519 CGGAGAGCCAAGCACCTTCCAGG + Intergenic
1203747987 Un_GL000218v1:54112-54134 GGGGGAGCCCAGCCCCTGCACGG - Intergenic
1203561737 Un_KI270744v1:63861-63883 GGGGGAGCCCAGCTCCTGCACGG + Intergenic
1187176115 X:16897741-16897763 ACTGGAGCCCAGCCCTTTCAAGG + Intergenic
1189822679 X:44885611-44885633 CTGTGATCCCAGCACTTTCAGGG + Intronic
1191066917 X:56358316-56358338 AGGGGCGCCCACCACTGTCAAGG - Intergenic
1192203304 X:69080926-69080948 CAGGGATCCCACCACTTTTATGG - Intergenic
1193152252 X:78138243-78138265 CGGGGAGGCCAGGAGTTTCCTGG - Intronic
1196619629 X:117807241-117807263 AGGGAAGCCCAGCACTATAAAGG + Intergenic
1197783708 X:130180340-130180362 CTGTAATCCCAGCACTTTCAGGG + Intronic
1201161335 Y:11169106-11169128 GGGGGAGCCCAGCCCCTGCACGG - Intergenic