ID: 1152530001

View in Genome Browser
Species Human (GRCh38)
Location 17:80912674-80912696
Sequence TGACATGTAGTGTAGCTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152529995_1152530001 7 Left 1152529995 17:80912644-80912666 CCACAGCCCAGCGCCCTTTTGGA 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1152530001 17:80912674-80912696 TGACATGTAGTGTAGCTGGACGG 0: 1
1: 0
2: 0
3: 8
4: 96
1152529999_1152530001 -7 Left 1152529999 17:80912658-80912680 CCTTTTGGATTGTGTGTGACATG 0: 1
1: 0
2: 1
3: 26
4: 199
Right 1152530001 17:80912674-80912696 TGACATGTAGTGTAGCTGGACGG 0: 1
1: 0
2: 0
3: 8
4: 96
1152529993_1152530001 10 Left 1152529993 17:80912641-80912663 CCTCCACAGCCCAGCGCCCTTTT 0: 1
1: 1
2: 2
3: 22
4: 257
Right 1152530001 17:80912674-80912696 TGACATGTAGTGTAGCTGGACGG 0: 1
1: 0
2: 0
3: 8
4: 96
1152529998_1152530001 -6 Left 1152529998 17:80912657-80912679 CCCTTTTGGATTGTGTGTGACAT 0: 1
1: 0
2: 1
3: 16
4: 176
Right 1152530001 17:80912674-80912696 TGACATGTAGTGTAGCTGGACGG 0: 1
1: 0
2: 0
3: 8
4: 96
1152529992_1152530001 19 Left 1152529992 17:80912632-80912654 CCAGCACAGCCTCCACAGCCCAG 0: 1
1: 0
2: 4
3: 85
4: 725
Right 1152530001 17:80912674-80912696 TGACATGTAGTGTAGCTGGACGG 0: 1
1: 0
2: 0
3: 8
4: 96
1152529991_1152530001 20 Left 1152529991 17:80912631-80912653 CCCAGCACAGCCTCCACAGCCCA 0: 1
1: 1
2: 8
3: 70
4: 791
Right 1152530001 17:80912674-80912696 TGACATGTAGTGTAGCTGGACGG 0: 1
1: 0
2: 0
3: 8
4: 96
1152529996_1152530001 1 Left 1152529996 17:80912650-80912672 CCCAGCGCCCTTTTGGATTGTGT 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1152530001 17:80912674-80912696 TGACATGTAGTGTAGCTGGACGG 0: 1
1: 0
2: 0
3: 8
4: 96
1152529997_1152530001 0 Left 1152529997 17:80912651-80912673 CCAGCGCCCTTTTGGATTGTGTG 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1152530001 17:80912674-80912696 TGACATGTAGTGTAGCTGGACGG 0: 1
1: 0
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152530001 Original CRISPR TGACATGTAGTGTAGCTGGA CGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
903342304 1:22662080-22662102 TGACATTTACTCTAACTGGATGG - Intergenic
905939393 1:41851022-41851044 TGAGATGCAGTGTAACTGGCAGG - Intronic
910712695 1:90198060-90198082 TGACATTTTAAGTAGCTGGAAGG - Intergenic
915628608 1:157134540-157134562 TGACATGCAGTGCAACCGGACGG - Intronic
922070401 1:222187035-222187057 TGAAGTGTAGTGTAGGTGAAAGG - Intergenic
924362523 1:243255912-243255934 GGAATTGTAGTGTAACTGGAAGG + Intergenic
924559212 1:245143583-245143605 GGAAATGCAGTGTATCTGGATGG - Intergenic
1065160546 10:22916561-22916583 TAACATGTAGTGTGGTTGCAAGG - Intergenic
1070360067 10:75679592-75679614 TGACATGTGGTGTACATGCATGG + Intronic
1070451197 10:76558805-76558827 TGACATGTATTGAGGCTGGCAGG + Intronic
1073445435 10:103577557-103577579 TCACATCTAGAGAAGCTGGAAGG - Intronic
1075518029 10:123125023-123125045 TGCCATGGAGTGAGGCTGGATGG - Intergenic
1078433225 11:11303422-11303444 TGACAAGTAATGTATCTGAAAGG - Intronic
1078610833 11:12817976-12817998 TGACATGGGGTATATCTGGATGG + Intronic
1080223148 11:29930335-29930357 TGAAATGCAGTGCTGCTGGAGGG - Intergenic
1084008755 11:66336332-66336354 TGCCCAGTAGTGAAGCTGGACGG + Exonic
1084895659 11:72265960-72265982 TGAAATGTAGTGTTACTGTATGG + Intergenic
1095631581 12:44383105-44383127 TGACATCTAGTGCAGGTGTATGG - Intronic
1099144076 12:79016855-79016877 TGAAATGTAGTGTAGTTTGATGG + Intronic
1099433643 12:82618763-82618785 TGAAATGTAGTGTAGTCTGAAGG + Intergenic
1099966886 12:89456401-89456423 TGACATGTGGTGTGGCTACACGG - Intronic
1101260323 12:103022675-103022697 AGAAATGTAGTCTAGCTGCAAGG - Intergenic
1108071157 13:46629874-46629896 AGACATCTCTTGTAGCTGGATGG + Intronic
1109947687 13:69459205-69459227 TGGCATCTACTATAGCTGGAAGG - Intergenic
1110696086 13:78492042-78492064 TGACATATACTGTTGCTGAAGGG - Intergenic
1110801200 13:79697605-79697627 TGACATGAAGTGGACCTGTAAGG + Intergenic
1113659124 13:112092741-112092763 GGAGATGCAGTGGAGCTGGAGGG - Intergenic
1113879283 13:113614634-113614656 TGACGTGGAGTGGAGCTGGGAGG - Intronic
1115923668 14:38407147-38407169 TGAAATGTAGTCTATCTGAAAGG - Intergenic
1124104829 15:26728082-26728104 TTAGATGCAGTGTATCTGGATGG - Intronic
1125715426 15:41817281-41817303 TGGCATGTAGAGTAGCTTGATGG + Intronic
1126359816 15:47834878-47834900 TGAGAGGTAGTGTCCCTGGAAGG + Intergenic
1126744756 15:51814745-51814767 TGTCAAGTATTGGAGCTGGAAGG - Exonic
1128761239 15:70217394-70217416 TGAAATGTTGTGTAGCTTCAAGG - Intergenic
1133660165 16:7908868-7908890 TGTCATGTAGTGTAGGTAGATGG - Intergenic
1137263601 16:46850921-46850943 TGAGGTGTAGTGTGTCTGGAAGG - Intergenic
1137327753 16:47459486-47459508 TGACATGTAGTATAGTTATAAGG - Intronic
1140151850 16:72375432-72375454 TGCCATTCAGTGTAGTTGGAGGG + Intergenic
1141758864 16:86013564-86013586 TGACCTGGAGTGTGGCTGGGGGG + Intergenic
1142679034 17:1534811-1534833 TCACATGTGGTGTCCCTGGAAGG + Intronic
1149265859 17:54926822-54926844 TGACAAGTGGTGGAGCTGGAAGG + Intronic
1151542845 17:74773588-74773610 TGCCATGCAGTGCAGCTGGCAGG - Exonic
1152530001 17:80912674-80912696 TGACATGTAGTGTAGCTGGACGG + Intronic
1153088146 18:1312632-1312654 TCACATGTAGTGTTGGTGGAGGG - Intergenic
1155349335 18:24891304-24891326 TGAAGTGCAGTTTAGCTGGATGG + Intergenic
1156993950 18:43443971-43443993 TCACATGAAATGTAGTTGGAAGG + Intergenic
1159331130 18:66995204-66995226 TGACATGGAATGTAATTGGAAGG + Intergenic
1162532359 19:11243275-11243297 TGACAGTTAGCGTGGCTGGACGG + Exonic
927045415 2:19273303-19273325 TGACGTGTTTTGTAGATGGAGGG - Intergenic
929236346 2:39609168-39609190 TGACAAGTACTGGAGCTGGAGGG + Intergenic
929949143 2:46393109-46393131 TGACCTCTTCTGTAGCTGGAAGG + Intergenic
930261456 2:49151687-49151709 TTACATGAGGTGTAGGTGGATGG - Intronic
932850273 2:75177878-75177900 CGTCATGTTGTGGAGCTGGAGGG - Intronic
935426831 2:102928267-102928289 TGGCTTTTAGTGTAGATGGATGG + Intergenic
939538581 2:143463627-143463649 TAAGATGTAGGATAGCTGGATGG - Intronic
948940298 2:241191987-241192009 TGTCATTCACTGTAGCTGGAAGG + Intronic
1168952824 20:1814170-1814192 TGACATGCAGTGGTGCTGGAGGG + Intergenic
1173700818 20:45070120-45070142 TGAAATAAAGTGTAGCTGTAGGG + Intronic
1175346157 20:58277911-58277933 TGACATGCATTGTTCCTGGATGG - Intergenic
1176636333 21:9247738-9247760 TGGCATGTAGTGGAGTGGGATGG + Intergenic
1177758002 21:25370558-25370580 TGTGATGTGGTGTAGCTGGAAGG + Intergenic
1177808492 21:25899698-25899720 TGGGATGTGGTTTAGCTGGATGG - Intronic
1178004570 21:28203500-28203522 GGACATAGAGTGTAGATGGATGG + Intergenic
1179023448 21:37659564-37659586 AGAAATGCAGTCTAGCTGGAGGG + Intronic
1179418306 21:41215849-41215871 TGACCTTTTATGTAGCTGGAGGG + Intronic
951707580 3:25558756-25558778 AGAAATGTAGGGTAGCTGGTGGG - Intronic
953764262 3:45723309-45723331 TGACATTTAGAATAGCTAGAAGG + Intronic
955414827 3:58682474-58682496 TTACATATAGTGTATCTGCATGG - Intergenic
957822939 3:85401472-85401494 TGGCATGTGGTGAAGATGGAGGG + Intronic
967606672 3:191455166-191455188 AGACATGTACTGAAGCTGCATGG - Intergenic
970719794 4:18973139-18973161 TGACTTGTACTGTAGATGGCAGG + Intergenic
973791604 4:54383288-54383310 AGTCATGTAGATTAGCTGGAAGG + Intergenic
974265418 4:59580939-59580961 AGACTTGTAGTGTAGTTTGAAGG + Intergenic
978753510 4:112279253-112279275 TGAAGTGAAGTGTAGGTGGAGGG - Intronic
981243562 4:142507929-142507951 TGAAATTTAGTCTAGCTGAAGGG - Intronic
1202751230 4_GL000008v2_random:6223-6245 TGGCATGTAGTGGAGTGGGATGG + Intergenic
988544841 5:32145956-32145978 TGACATGGATTTTAGCAGGAGGG - Intronic
996267755 5:121562088-121562110 TGCCATCTAGTGTAGTTTGAGGG - Intergenic
996797495 5:127365135-127365157 TGACAGATAGGTTAGCTGGAAGG + Intronic
1007115732 6:39341904-39341926 TCACATGTAGTGTAGATTGTAGG - Intronic
1009305222 6:62081299-62081321 TGAGATCAAATGTAGCTGGAGGG + Intronic
1012996841 6:105982891-105982913 AGACAGGCAGGGTAGCTGGAAGG + Intergenic
1015460556 6:133486754-133486776 TGAAGTCTAGTGTGGCTGGAAGG + Intronic
1015496443 6:133888758-133888780 GGGCATGGAGTGTAGGTGGAAGG + Intergenic
1016121559 6:140348399-140348421 TGACATGTTGGGTAGCAGGCAGG + Intergenic
1017110825 6:150931079-150931101 TGACTTGGAGTGCAGCTGCAGGG + Intronic
1017348237 6:153409196-153409218 TGACATGTAGCCAAGCTGGTCGG + Intergenic
1019919955 7:4157227-4157249 TTGCATGTGGAGTAGCTGGACGG + Intronic
1025185836 7:56857585-56857607 TGACATTCCGTGTGGCTGGAGGG + Intergenic
1026043213 7:66886237-66886259 TGACATTCCGTGTGGCTGGAGGG - Intergenic
1026251851 7:68678223-68678245 TGAAATGTAGAGTAAATGGAAGG - Intergenic
1031601745 7:123718499-123718521 TGACAATGAGTGTATCTGGAAGG + Intronic
1038359227 8:26860900-26860922 GGAGATGCGGTGTAGCTGGAGGG - Intronic
1039780054 8:40776130-40776152 GAACATCTAGTGTAGATGGATGG - Intronic
1042474872 8:69235762-69235784 TGACTTGTAGAGCAGATGGAAGG - Intergenic
1048075704 8:131068080-131068102 TGACATGAAGTGTTACTGTATGG + Intergenic
1052569097 9:30198502-30198524 TGACATTTTGTGTAGTTGGCAGG + Intergenic
1056123083 9:83508848-83508870 TGACTTGTTGAGTAGCTGGCTGG + Intronic
1056556661 9:87695250-87695272 AGACTTGTAGTGAAGCAGGAGGG - Intronic
1058671252 9:107362289-107362311 TGACATGTAGTCTAGCTCTGTGG + Intergenic
1196534130 X:116821174-116821196 TGCTCTGTAGTGTAGTTGGAAGG - Intergenic
1197563270 X:128050172-128050194 TGAGAGGTAATGCAGCTGGAAGG - Intergenic
1199280748 X:145996698-145996720 TGACATGTAGTGTAAGTGACTGG + Intergenic
1201136068 Y:10991054-10991076 TGGAATGTAGTGTAGTTGAATGG - Intergenic