ID: 1152531708

View in Genome Browser
Species Human (GRCh38)
Location 17:80922838-80922860
Sequence CACGGACCTGCAGGCTGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 742
Summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 686}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152531708_1152531717 -2 Left 1152531708 17:80922838-80922860 CCCGCTCAGCCTGCAGGTCCGTG 0: 1
1: 0
2: 2
3: 53
4: 686
Right 1152531717 17:80922859-80922881 TGGTGGTGACCGGGGCCCCACGG 0: 1
1: 0
2: 1
3: 16
4: 215
1152531708_1152531723 19 Left 1152531708 17:80922838-80922860 CCCGCTCAGCCTGCAGGTCCGTG 0: 1
1: 0
2: 2
3: 53
4: 686
Right 1152531723 17:80922880-80922902 GGGCTGAGCTGTCCCTGAGCCGG 0: 1
1: 0
2: 2
3: 41
4: 344
1152531708_1152531715 -10 Left 1152531708 17:80922838-80922860 CCCGCTCAGCCTGCAGGTCCGTG 0: 1
1: 0
2: 2
3: 53
4: 686
Right 1152531715 17:80922851-80922873 CAGGTCCGTGGTGGTGACCGGGG 0: 1
1: 1
2: 1
3: 20
4: 118
1152531708_1152531718 -1 Left 1152531708 17:80922838-80922860 CCCGCTCAGCCTGCAGGTCCGTG 0: 1
1: 0
2: 2
3: 53
4: 686
Right 1152531718 17:80922860-80922882 GGTGGTGACCGGGGCCCCACGGG 0: 1
1: 0
2: 0
3: 10
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152531708 Original CRISPR CACGGACCTGCAGGCTGAGC GGG (reversed) Intronic
900457344 1:2783668-2783690 CACAGTGCTGCGGGCTGAGCCGG - Exonic
900471260 1:2856156-2856178 CCCTGACCTGCAGGCACAGCCGG - Intergenic
900937428 1:5775371-5775393 CATGGTTCTGCAGGCTGAACAGG + Intergenic
901156382 1:7142399-7142421 CACAGACCTGGAGGCCGAGCTGG - Intronic
901291658 1:8129125-8129147 CACGGTGCCGCAGGCTGTGCAGG + Intergenic
901400940 1:9014824-9014846 CACGGACATGGAGGCCGAGCTGG - Exonic
901931717 1:12600296-12600318 CATGGATCTGCTGGCTGAGGAGG + Intronic
902167444 1:14583989-14584011 CCCTGACCTGCAGCCTGGGCGGG - Intergenic
902219896 1:14958132-14958154 CACTGGCCTCGAGGCTGAGCGGG - Intronic
902360294 1:15938813-15938835 CACTTACCTGCAGGCCAAGCAGG + Exonic
902490666 1:16778553-16778575 CACGGTTCTGCAGGCTGTACAGG + Intronic
902801247 1:18831563-18831585 CACAGTTCTGCAGGCTGAACAGG - Intergenic
903036570 1:20496796-20496818 CACGGTTCTGCAGGCTGTACAGG - Intergenic
903328193 1:22583250-22583272 CAGAGACCTGGAGGCTGGGCCGG - Intronic
904314701 1:29652662-29652684 CACGGCTCTACAGGCTGAACAGG + Intergenic
904398228 1:30237543-30237565 CACGGTTCTGCAGGCTGTACAGG + Intergenic
904981821 1:34510142-34510164 CACAGTCCTGCAGGCTGTACAGG - Intergenic
905381019 1:37561690-37561712 GAAGGCACTGCAGGCTGAGCAGG + Exonic
905648968 1:39643947-39643969 CACGGTTCTGCAGGCTGTACAGG - Intergenic
906102604 1:43272767-43272789 CCCGGACATGCTGGCAGAGCAGG + Exonic
908675450 1:66598547-66598569 CACGGTTCTGCAGGCTGTACAGG + Intronic
909834792 1:80240391-80240413 CACAGTTCTGCAGGCTGTGCAGG - Intergenic
910186203 1:84543404-84543426 CACGGTTCTGCAGGCTGTACAGG + Intergenic
910200678 1:84695384-84695406 CCCGGTTCTGCAGGCTGTGCAGG + Intergenic
911340001 1:96624318-96624340 CACGGTTCTGCAGGCTGTACAGG - Intergenic
911756236 1:101560131-101560153 CACAGTTCTGCAGGCTGTGCAGG - Intergenic
912215565 1:107607268-107607290 CAAGAACCTGAAGACTGAGCTGG + Intronic
913111076 1:115657769-115657791 CACGGTCCTGCAGGCTTTACAGG + Intronic
913157821 1:116117382-116117404 CAGGGACCTGAAGTCTGAGCAGG - Intronic
915673033 1:157506211-157506233 CACGGTTCTGCAGGCTGCACAGG + Intergenic
915840041 1:159206039-159206061 CACGGAGCTGAAGGCTTTGCAGG + Exonic
916409300 1:164529736-164529758 CACGGTTCTGCAGGCTGTACAGG + Intergenic
917176940 1:172245931-172245953 CACAGTTCTGCAGGCTGAACAGG + Intronic
917508821 1:175652743-175652765 CACAGTTCTGCAGGCTGAACAGG - Intronic
919554341 1:199031867-199031889 CACAGACCTGGAGGCCGAGGAGG - Intergenic
920271773 1:204770462-204770484 CACAGTTCTGCAGGCTGTGCAGG + Intergenic
920564799 1:206964685-206964707 CACGGTTCTGCAGGCTGTACAGG - Intronic
921351673 1:214242446-214242468 CACGGTTCTGCAGGCTGTACAGG - Intergenic
921392493 1:214630635-214630657 CAACGTCCTGCAGGCTGAACTGG + Exonic
921609194 1:217190879-217190901 CACGGTTCTGCAGGCTGTACAGG + Intergenic
921706126 1:218324101-218324123 CACGGAGGGGCAGGCTGAGAGGG - Intronic
921745970 1:218741091-218741113 CACGGTTCTGCAGGCTGTACAGG - Intergenic
921766613 1:218980183-218980205 CATGGTTCTGCAGGCTGTGCAGG - Intergenic
921849263 1:219917471-219917493 CCCAGAGCTGCAGGCAGAGCAGG - Intronic
921905983 1:220496093-220496115 CACAGTTCTGTAGGCTGAGCAGG + Intergenic
922595717 1:226811185-226811207 CACGGTTCTGCAGGCTGTACAGG - Intergenic
922776370 1:228215933-228215955 CAGTGACCTGCAGGCTGACAGGG - Intronic
922776989 1:228219361-228219383 CAGGGAGGTGCAGGCTGAGGTGG + Exonic
922782501 1:228264153-228264175 CAGGGAGGTGCAGGCTGAGGCGG + Exonic
922783023 1:228268567-228268589 CAGGGAGGTGCAGGCTGAGGCGG + Exonic
923293621 1:232571880-232571902 CACGGTTCTGCAGGCTGTACAGG - Intergenic
923297132 1:232604932-232604954 CACGGTTCTGCAGGCTGCACGGG - Intergenic
923422400 1:233830230-233830252 CACGGTTCTGCAGTCTGAACAGG + Intergenic
923529777 1:234803982-234804004 CACGGTTCTGCAGGCTGTACAGG - Intergenic
924177000 1:241401287-241401309 CACGGTTCTGCAGGCTGTACAGG + Intergenic
924369870 1:243336454-243336476 CATGGTTCTGCAGGCTGAACGGG + Intronic
924529521 1:244881650-244881672 CACGGCCCTGGAGGTAGAGCAGG + Intergenic
924754110 1:246926189-246926211 CATGGTTCTGCAGGCTGTGCAGG - Intronic
924808427 1:247379979-247380001 CACGGTCCTGCAGGCTGTACAGG - Intergenic
924927951 1:248701908-248701930 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1062819095 10:520620-520642 GAAGGAGCTGCAGGCAGAGCAGG - Intronic
1062860112 10:804331-804353 CACGGAGCTGCAGGGTGGGGCGG + Intergenic
1063411801 10:5842064-5842086 CACGGTTCTGCAGGCTGTACAGG + Intronic
1064002639 10:11676223-11676245 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1064103413 10:12481908-12481930 CTCGGGCCTGCAGTCAGAGCTGG + Intronic
1064457407 10:15500619-15500641 AACGGTTCTGCAGGCTGTGCAGG - Intergenic
1064633088 10:17337240-17337262 CACGGCTCTGCAGGCTGCACAGG - Intronic
1065378448 10:25065554-25065576 CACGGTCCTGCAGGCTGCACAGG - Intergenic
1065678937 10:28209122-28209144 CACGGCTCTGCAGGCTGTACAGG - Intronic
1065902921 10:30224257-30224279 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1066380279 10:34895427-34895449 CAGGGATCAGGAGGCTGAGCTGG - Intergenic
1066499011 10:35972062-35972084 CATGGTTCTGCAGGCTGTGCAGG + Intergenic
1066519336 10:36198252-36198274 CAGGGATTTGCAGGCTGATCAGG + Intergenic
1067412628 10:46078224-46078246 TACGGTTCTGCAGGCTGTGCGGG - Intergenic
1067532122 10:47081521-47081543 CACAGTTCTGCAGGCTGTGCAGG - Intergenic
1067771851 10:49132113-49132135 CACGCACGTGCAGACTGTGCGGG - Exonic
1068008666 10:51420765-51420787 CACAGTTCTGCAGGCTGTGCAGG + Intronic
1069544537 10:69318980-69319002 CACGGAGCTGAAGGATGACCAGG + Intronic
1069728529 10:70596564-70596586 CACGGCTGTGCAGGCTGTGCAGG - Intergenic
1069772812 10:70910331-70910353 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1069812161 10:71170003-71170025 CACTGATCTGAAGGCAGAGCTGG + Intergenic
1070021261 10:72588261-72588283 CACGGTTCTGCAGGCTGTACAGG - Intronic
1070350068 10:75583312-75583334 CACAGTTCTGCAGGCTGTGCAGG + Intronic
1070832190 10:79424885-79424907 CACGAAGCTCCAGGCTGAGCTGG + Intronic
1071173836 10:82899982-82900004 CACCGTTCTGCAGGCTGAACAGG + Intronic
1072618804 10:97066703-97066725 CACGGTTCTGCAGGCTGTGCGGG - Intronic
1073545581 10:104346007-104346029 CATGGTTCTGCAGGCTGTGCAGG + Intergenic
1073731559 10:106294192-106294214 CACAGTTCTGCAGGCTGTGCAGG - Intergenic
1073924456 10:108499020-108499042 CACAGTTCTGCAGGCTGTGCAGG + Intergenic
1074343483 10:112657096-112657118 CACAGTTCTGCAGGCTGAACAGG - Intronic
1074657848 10:115615801-115615823 CACGGTTCTGCAGGCTGTACAGG - Intronic
1074731371 10:116379976-116379998 CACGGTTCTGCAGGCTGTACAGG - Exonic
1074737604 10:116452596-116452618 CAGTGTCCTGAAGGCTGAGCAGG - Intronic
1074958301 10:118414438-118414460 GAAGGACCTGAAGGCTGAACTGG + Intergenic
1075145767 10:119881821-119881843 CACGGTTCTGCAGGCTGTACAGG + Intronic
1075309132 10:121397151-121397173 CAAGGTCCTGCAGGCTGTACAGG + Intergenic
1076189040 10:128470030-128470052 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1076191480 10:128486490-128486512 CATGGATCTACAGGCTGTGCAGG + Intergenic
1076258726 10:129049171-129049193 CATGGACGGGCAGGCTGAGAGGG - Intergenic
1076404878 10:130205078-130205100 CACGGACCAGCAGGGTGGCCAGG - Intergenic
1076745527 10:132511153-132511175 CACGGTTCTGCAGTCTGTGCGGG + Intergenic
1076868730 10:133182352-133182374 CACGCACCTGCATCCTGGGCTGG - Intronic
1077011706 11:381666-381688 CAGGGTCCTGCAGGCAGGGCTGG + Exonic
1077571285 11:3340432-3340454 GAGGGTCCTGCAGGCAGAGCTGG - Intronic
1078696093 11:13633605-13633627 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1078827146 11:14940231-14940253 CACAGATCTGCAGGCTGTGCAGG + Intronic
1079614162 11:22470183-22470205 CATGGTGCTGCAGGCTGTGCAGG + Intergenic
1080045103 11:27799988-27800010 CACAGTTCTGCAGGCTGAACAGG - Intergenic
1080471053 11:32546128-32546150 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1080812173 11:35715732-35715754 CACGGTTCTGCAGGCTGTACAGG + Intronic
1081010544 11:37806214-37806236 CACAGTTCTGCAGGCTGAACAGG + Intergenic
1081262104 11:40973131-40973153 CATGGATCTGCAGGCTGTACAGG - Intronic
1081804198 11:45881399-45881421 TTCTGACCTGGAGGCTGAGCAGG + Exonic
1083042455 11:59700947-59700969 CACGGTTCTGCAGGCTGTGCAGG + Intergenic
1083780610 11:64915535-64915557 GCGGGGCCTGCAGGCTGAGCTGG + Intronic
1084497923 11:69515979-69516001 CACAGTTCTGCAGGCTGTGCAGG + Intergenic
1084577514 11:69999124-69999146 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1086080733 11:82900473-82900495 GGCGGAGCTGCAGGCTGGGCAGG - Intronic
1086470725 11:87106831-87106853 CACGGTTCTGCAGGCTGTACAGG + Intronic
1087170833 11:95049134-95049156 CACAGAGCTGCAGGTGGAGCTGG + Intergenic
1087306694 11:96498148-96498170 CATGGTTCTGCAGGCTGTGCAGG + Intronic
1087429383 11:98033117-98033139 CATGGCTCTGCAGGCTGAACAGG - Intergenic
1087847872 11:102993645-102993667 CACAGTTCTGCAGGCTGTGCAGG - Intergenic
1088953887 11:114598771-114598793 CACAGACCTGCAGGCCTAGAAGG - Intergenic
1089590289 11:119535930-119535952 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1090306913 11:125699141-125699163 CAGGATCCTGCAGGCTCAGCAGG - Intergenic
1090830708 11:130419046-130419068 CACGGACCTGTCTGGTGAGCAGG + Exonic
1090868912 11:130725832-130725854 CTTGCACCTGCAGGCAGAGCTGG + Intergenic
1091134519 11:133176712-133176734 CACGGTTCTGCAGGCTGTACAGG - Intronic
1092009818 12:5100054-5100076 CACAGCCCTGCCAGCTGAGCAGG - Intergenic
1092014082 12:5142526-5142548 CATGGTCCTGCAGGCTGTACAGG + Intergenic
1094322874 12:29204651-29204673 CACGGTTCTGCAGGATGTGCAGG + Intronic
1094492376 12:30969160-30969182 CAGGGCCCTGCAGCCTGAGCTGG + Intronic
1094646253 12:32327607-32327629 CAAGGAGCTCAAGGCTGAGCTGG + Exonic
1095311676 12:40705747-40705769 CACGGTTCTGCAGGCTGTACAGG + Intronic
1095781666 12:46067028-46067050 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1096460751 12:51820532-51820554 CAAGGACCTGGAGGCGGCGCTGG - Intergenic
1096783687 12:54005178-54005200 TCCTGACCTGCAGGCTGGGCTGG - Intronic
1097959818 12:65521467-65521489 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1099184435 12:79502602-79502624 CACTGTCCTGCAGACTGTGCAGG + Intergenic
1100334671 12:93618223-93618245 CACAGTCCTGCAGGCTGTACAGG - Intergenic
1100428588 12:94510008-94510030 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1100807797 12:98305363-98305385 CACAGTTCTGCAGGCTGTGCAGG - Intergenic
1101293200 12:103393186-103393208 CAGGGATCTGCAGGCTGTACAGG + Intronic
1102626600 12:114240073-114240095 CATGGAGGTGCAGGATGAGCGGG - Intergenic
1103379187 12:120480625-120480647 CAAGGACCTGAAGGCTGAGGAGG - Intronic
1104132825 12:125910822-125910844 CTAAGATCTGCAGGCTGAGCTGG + Intergenic
1104151361 12:126087052-126087074 CACGGCTCTGCAGGCTGTACGGG + Intergenic
1104385917 12:128351542-128351564 CATGGATCTGCAGGCTGTACAGG + Intronic
1104901871 12:132193818-132193840 CACGGGCCTGCAGGCTCTACAGG + Intergenic
1104926922 12:132318659-132318681 CACGGGGCTGCAGGCCCAGCTGG - Intronic
1104942223 12:132400524-132400546 CACAGATCTGCAGTCTGGGCAGG + Intergenic
1105045080 12:132996171-132996193 CAAGAAGCTGCAGGCTGGGCTGG - Intronic
1105794857 13:23841302-23841324 CCTGCAACTGCAGGCTGAGCAGG + Intronic
1105833004 13:24182359-24182381 CACGGTTCTGCAGGCTGTACAGG + Intronic
1106648636 13:31665064-31665086 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1108087145 13:46805229-46805251 CATGGTTCTGCAGGCTGTGCAGG - Intergenic
1108092117 13:46859727-46859749 CACGGTTCTGCAGGCTGTACAGG - Intronic
1108640469 13:52378464-52378486 CTCTGACCTACAGGCGGAGCGGG - Exonic
1108715902 13:53077607-53077629 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1109280016 13:60345062-60345084 CACAGTTCTGCAGGCTGAGCAGG - Intergenic
1109283049 13:60379387-60379409 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1109961964 13:69643463-69643485 CATGGTTCTGCAGGCTGTGCAGG - Intergenic
1111051300 13:82885539-82885561 CATGGATCTGCAGGCTGTACAGG + Intergenic
1111176199 13:84599507-84599529 CACGGTTCTGCAGGCTTAACAGG - Intergenic
1111282240 13:86042217-86042239 CATGGATCTGCAGGCTGTACAGG - Intergenic
1112229628 13:97575570-97575592 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1112363408 13:98737639-98737661 CACGGTTCTGCAGGCTGTACAGG - Intronic
1112786865 13:102961048-102961070 CACGGTTCTGCAGGTTGTGCAGG + Intergenic
1113572125 13:111365556-111365578 CACAAACCTGCAGTCTGGGCAGG - Intergenic
1113617499 13:111691357-111691379 CAGCCACCTGCAGGCTGAGGAGG + Intergenic
1113623029 13:111776617-111776639 CAGCCACCTGCAGGCTGAGGAGG + Intergenic
1113826342 13:113257426-113257448 CACGGTTCTGCAGGCTGTACAGG + Intronic
1113842321 13:113367166-113367188 CACGGAGCTCCAGGCTGTCCTGG + Intergenic
1114648359 14:24268152-24268174 CACAGTGCTGCAGTCTGAGCTGG - Exonic
1115647983 14:35383658-35383680 AGGGGACCTGCAGGCTGAGGAGG + Intergenic
1115841039 14:37470590-37470612 CACAGTTCTGCAGGCTGTGCAGG - Intronic
1115858225 14:37654532-37654554 CACGGTTCTGCAGGCTGTACAGG - Intronic
1116574340 14:46553412-46553434 CACAGTTCTGCAGGCTTAGCAGG - Intergenic
1118497665 14:66324898-66324920 CATAGACCTGCAGGGTGGGCAGG - Intergenic
1118956893 14:70490803-70490825 CACAGTTCTGCAGGCTTAGCAGG + Intergenic
1119611724 14:76069076-76069098 CATGGTTCTGCAGGCTGTGCAGG + Intronic
1120680604 14:87476804-87476826 CATGGTCCTGCAGGCTGTACAGG + Intergenic
1121407212 14:93726302-93726324 CACAGAGCAGCAGGCTGAGCGGG - Intronic
1121471049 14:94154685-94154707 CACAGTCCTGCAGGCTGGGGAGG - Intronic
1121628394 14:95404257-95404279 CACAGTTCTGCAGGCTGAACGGG - Intergenic
1122139977 14:99657267-99657289 CAGCTAGCTGCAGGCTGAGCTGG - Intronic
1122158840 14:99768348-99768370 CACGGAGCCGCTGTCTGAGCTGG + Intronic
1122265465 14:100544697-100544719 CTTGGACTGGCAGGCTGAGCTGG + Intronic
1122922994 14:104887601-104887623 CACGGGCCTCCCGGCTGAGGCGG + Exonic
1122929296 14:104926063-104926085 CAGAGGCCTGGAGGCTGAGCTGG + Intronic
1122969111 14:105145281-105145303 CACTGGCCTGCAGGTGGAGCTGG - Intronic
1123102044 14:105810943-105810965 CACGGTTCTGCAGGCTGTCCGGG + Intergenic
1123140671 14:106074238-106074260 CACAGTTCTGCAGGCTTAGCAGG - Intergenic
1123161692 14:106284683-106284705 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1123213969 14:106788852-106788874 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1124006013 15:25796030-25796052 CACGGTTCTGCAGGCTGTACAGG - Intronic
1124188668 15:27552224-27552246 CACGGTTCTGCAGGCTATGCAGG - Intergenic
1124644489 15:31427697-31427719 CACAGTTCTGCAGGCTGTGCAGG + Intronic
1125722648 15:41852565-41852587 CACTGACTTGCAGGCTGAGAGGG + Intronic
1125785303 15:42311539-42311561 CATGGTCCTGCAGGCTGTACAGG + Intronic
1126098238 15:45104276-45104298 CCCTGACCTGCGAGCTGAGCAGG - Exonic
1127879568 15:63144674-63144696 CACGGTTCTGCAGGCTGGACAGG - Intronic
1128361581 15:66965376-66965398 CGCGGAGCTGCAGGCTGTGAGGG - Intergenic
1128478388 15:68016664-68016686 CACGGTTCTGCAGGCTGAATAGG - Intergenic
1129087000 15:73104720-73104742 CACAGTCCTGCAGGCTGTGCAGG + Intronic
1129232640 15:74205304-74205326 CACAGTTCTGCAGGCTGTGCAGG + Intronic
1129248173 15:74292673-74292695 CAGAGACCTGCAGGCTGGGGAGG + Intronic
1129762655 15:78139673-78139695 CATGGTTCTGCAGGCTGTGCAGG + Intronic
1129941417 15:79500349-79500371 CACGGTCCTGCAGGCTGTAGAGG - Intergenic
1131047509 15:89325607-89325629 CCCGCATCTGCAGGCTGAGGAGG + Exonic
1131568181 15:93505616-93505638 CTTGGCCCGGCAGGCTGAGCTGG + Intergenic
1131716600 15:95118020-95118042 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1132181326 15:99754942-99754964 CATGGTCCTGCAGGCTGTACAGG + Intergenic
1132759046 16:1500149-1500171 CACGTACCTGCAGCAGGAGCGGG - Exonic
1132878295 16:2149821-2149843 CCCAGGCCTGCAGGCTCAGCGGG - Intronic
1133386388 16:5373564-5373586 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1134093098 16:11401972-11401994 CTCCACCCTGCAGGCTGAGCGGG - Intronic
1134165814 16:11928504-11928526 GAGGGTCCTGCAGGCAGAGCTGG - Intronic
1134494908 16:14725236-14725258 GAGGGTCCTGCAGGCAGAGCTGG + Intronic
1134500291 16:14764356-14764378 GAGGGTCCTGCAGGCAGAGCTGG + Intronic
1134526833 16:14950968-14950990 GAGGGTCCTGCAGGCAGAGCTGG + Intronic
1134545573 16:15105380-15105402 GAGGGTCCTGCAGGCAGAGCTGG - Intronic
1134580288 16:15364694-15364716 GAGGGTCCTGCAGGCAGAGCTGG - Intronic
1134625696 16:15721045-15721067 CATGGACCTGCCGGCAGAGCGGG + Exonic
1134714410 16:16349445-16349467 GAGGGTCCTGCAGGCAGAGCTGG + Intergenic
1134722285 16:16392809-16392831 GAGGGTCCTGCAGGCAGAGCTGG + Intronic
1134945142 16:18319060-18319082 GAGGGTCCTGCAGGCAGAGCTGG - Intronic
1134952406 16:18359213-18359235 GAGGGTCCTGCAGGCAGAGCTGG - Intergenic
1135311207 16:21405918-21405940 GAGGGTCCTGCAGGCAGAGCTGG - Intronic
1135364159 16:21838369-21838391 GAGGGTCCTGCAGGCAGAGCTGG - Intronic
1135447683 16:22532979-22533001 GAGGGTCCTGCAGGCAGAGCTGG + Intronic
1135805155 16:25535965-25535987 CACCGTTCTGCAGGCTGTGCAGG - Intergenic
1135876413 16:26204427-26204449 CACAGTTCTGCAGGCTGAACAGG - Intergenic
1135900217 16:26451570-26451592 CATGGTTCTGCAGGCTGAGCAGG + Intergenic
1136150361 16:28343813-28343835 GAGGGTCCTGCAGGCAGAGCTGG - Intronic
1136166598 16:28457651-28457673 GAGGGTCCTGCAGGCAGAGCTGG - Intronic
1136196377 16:28657381-28657403 GAGGGTCCTGCAGGCAGAGCTGG + Intronic
1136257439 16:29051425-29051447 GAGGGTCCTGCAGGCAGAGCTGG + Intronic
1136307911 16:29384914-29384936 GAGGGTCCTGCAGGCAGAGCTGG - Intronic
1136321327 16:29486458-29486480 GAGGGTCCTGCAGGCAGAGCTGG - Intronic
1136436007 16:30226428-30226450 GAGGGTCCTGCAGGCAGAGCTGG - Intronic
1137785626 16:51135035-51135057 CCCGGACCCGGAGGCCGAGCAGG + Intergenic
1137968005 16:52955841-52955863 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1138089496 16:54162657-54162679 CACGGCTCTGCAGGCTGTACAGG + Intergenic
1138218678 16:55229236-55229258 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1138658568 16:58504343-58504365 CTGGTACCTGCAGGCAGAGCAGG - Exonic
1138708021 16:58937769-58937791 CACGGTTCTGCAGGCTTAACAGG + Intergenic
1138813219 16:60174931-60174953 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1139152268 16:64396981-64397003 CACGGTACTGCAGGCTGTACAGG + Intergenic
1139855603 16:69977347-69977369 GAGGGTCCTGCAGGCAGAGCTGG - Intergenic
1140248964 16:73277781-73277803 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1140367131 16:74390744-74390766 GAGGGTCCTGCAGGCAGAGCTGG + Intronic
1140980023 16:80099143-80099165 CACGGATCTGTAGGCTGTACAGG - Intergenic
1141066950 16:80921677-80921699 CTCGGACCTGCAGCCTTACCTGG - Intergenic
1141109297 16:81258816-81258838 CACGGTTCTGCAGGCTGTACAGG + Intronic
1141492676 16:84385121-84385143 CACGGTTCTGCAGGCTGTACAGG + Intronic
1142290609 16:89192254-89192276 CCCGGAGCAGCAGGCTGAGGCGG - Exonic
1142433364 16:90042499-90042521 CAAGGACCTGCAGTATGAGCTGG + Exonic
1143554495 17:7651876-7651898 CGCGGACACGCAGGCGGAGCTGG - Intronic
1143838246 17:9710088-9710110 CATGGAGCTGCTGGCTGACCAGG - Exonic
1144308438 17:13990623-13990645 CACGATTCTGCAGGCTGTGCAGG - Intergenic
1144580621 17:16457048-16457070 TGCTGACCTGCAGGCTGACCTGG + Intronic
1145025254 17:19463449-19463471 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1146633550 17:34487764-34487786 CCCAGAGCTGAAGGCTGAGCTGG + Intergenic
1146914844 17:36671982-36672004 CACTGGCCTGCAGGATGAGGAGG - Intergenic
1146966791 17:37038034-37038056 CACGGTTCTGCAGGCTGTACAGG - Intronic
1147445999 17:40475677-40475699 CACGGCGCTACAGGCTCAGCAGG - Intergenic
1147452209 17:40512641-40512663 CCAGGCTCTGCAGGCTGAGCAGG + Intergenic
1147476185 17:40713585-40713607 TACGGTTCTGCAGGCTGTGCAGG - Intergenic
1147554493 17:41467710-41467732 CACAGACCTGCAGGCTTCTCAGG - Intergenic
1148755444 17:49970656-49970678 CAGAGACCTGGAGGCTAAGCTGG - Intronic
1148801025 17:50225913-50225935 CACAGGCCTGGAGGCTGAGGAGG - Intergenic
1148976827 17:51537005-51537027 CACGGTTCTGCAGGCTGTACGGG - Intergenic
1149787638 17:59449641-59449663 CATGGTCCTGCAGGCTGTACAGG - Intergenic
1150573350 17:66407478-66407500 CACGGTACTGCAGGCTGTCCAGG - Intronic
1151382747 17:73736822-73736844 CATGGTCCTGCAGGCTGTACAGG - Intergenic
1151432714 17:74075053-74075075 CATGGTTCTGCAGGCTGTGCAGG + Intergenic
1151883071 17:76906278-76906300 GTGGGACCTGCAGGCAGAGCAGG - Intronic
1152213344 17:79016955-79016977 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1152422989 17:80204052-80204074 CAAGAGCCTGCAGGCTGGGCAGG - Intronic
1152531708 17:80922838-80922860 CACGGACCTGCAGGCTGAGCGGG - Intronic
1152626380 17:81389595-81389617 CAGGGACCCCCAGGCTGAGGAGG - Intergenic
1152779277 17:82219237-82219259 CTCAGACCTGCAGGCCCAGCAGG - Intergenic
1153267577 18:3286210-3286232 CACAGATCTGCAGGCTGTACAGG + Intergenic
1153348525 18:4053693-4053715 CACGGTTCTGCAGGCTGTACAGG - Intronic
1153525739 18:5992838-5992860 CACGGTTCTGCAGGCTGTACAGG - Intronic
1154117073 18:11620535-11620557 GAGGGTCCTGCAGGCAGAGCTGG - Intergenic
1155125651 18:22872955-22872977 CACGGTTCTGCAGGCTTAACAGG + Intronic
1155226333 18:23732576-23732598 AAGGGACCTGCAGGGTGCGCAGG + Intronic
1156043158 18:32846969-32846991 CAGTGATCTGCAGGCTGAGGTGG - Intergenic
1156068376 18:33174044-33174066 CACGGTTCTGCAGGCTGTACAGG + Intronic
1156545565 18:37960734-37960756 CATGGTTCTGCAGGCTGTGCAGG + Intergenic
1157302429 18:46488706-46488728 CCCTGACCTGAAGGCTGAGCTGG - Intronic
1157571180 18:48713371-48713393 AATGGACATGCAGGCTGACCTGG - Intronic
1157588693 18:48821477-48821499 CACTGCCTTGCAGGCAGAGCAGG + Intronic
1157591519 18:48838987-48839009 GAAGGACCTCCAGGCTGTGCCGG + Intronic
1157923452 18:51737728-51737750 GAAGGACCTGCAGGGTGTGCAGG + Intergenic
1158203822 18:54968921-54968943 TACGGTTCTGCAGGCTGTGCAGG + Intergenic
1158623988 18:59056274-59056296 CATGGTTCTGCAGGCTGTGCAGG + Intergenic
1159165836 18:64698718-64698740 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1159218669 18:65429772-65429794 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1159673545 18:71252690-71252712 CACAGTTCTGCAGGCTGTGCAGG - Intergenic
1160313833 18:77821914-77821936 CAGGGTTCTGCAGGCTGTGCAGG - Intergenic
1160617051 18:80138251-80138273 CTCAGACCTGCAGGCCCAGCCGG + Exonic
1160933619 19:1582613-1582635 CAAGGGCCTGCAGGGTGAGCGGG - Exonic
1161105708 19:2443085-2443107 CACAGAGCTGCTGCCTGAGCAGG + Intronic
1161930337 19:7335479-7335501 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1162098373 19:8324505-8324527 CATCGCCCTGGAGGCTGAGCAGG - Exonic
1162104959 19:8364624-8364646 CACGTACCTGCAGGCTGTGAAGG - Exonic
1162113385 19:8413426-8413448 CACGGGCCTGCAGGTAGGGCCGG + Intronic
1162341950 19:10096567-10096589 GGCGGACCTGCAGGCAGAGGAGG + Exonic
1162932375 19:13963432-13963454 CCCGAGCCTGCAGGCTGGGCGGG - Intronic
1163219099 19:15901599-15901621 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1163861807 19:19746892-19746914 CAGGGGCCAGCAGGGTGAGCGGG - Intergenic
1164589969 19:29501420-29501442 CACGGTTCTGCAGGCTGTCCAGG + Intergenic
1164756128 19:30691163-30691185 CGCTGACCAGCTGGCTGAGCCGG + Intronic
1165108114 19:33486393-33486415 CACGGAACTGCTGCCTGGGCCGG + Intronic
1165150754 19:33758866-33758888 CACGGCTCTGCAGGCTGGACAGG + Intronic
1165710178 19:38005356-38005378 CAGGGATCTGCAGGATGAGGCGG - Intronic
1165941077 19:39415094-39415116 CTCTGGCCTGGAGGCTGAGCAGG - Exonic
1166364630 19:42272299-42272321 GGCGGACCTGGAGGATGAGCCGG + Intronic
1166706051 19:44908632-44908654 CAAGGAGCTGCAGGCGGCGCAGG + Exonic
1166789869 19:45392302-45392324 CACCGAGCTGGAGCCTGAGCCGG - Exonic
1167137121 19:47623469-47623491 CAGGGAGCTGCTGCCTGAGCTGG + Intronic
1167570656 19:50286634-50286656 CCGGGCCCTGCGGGCTGAGCTGG + Exonic
1167758914 19:51431106-51431128 CAAGGATCTGCAGGCTGTACAGG - Intergenic
1168127239 19:54291883-54291905 AAGGGATTTGCAGGCTGAGCGGG + Intergenic
1168153411 19:54460787-54460809 CTCCTACCTGCAGGCCGAGCTGG + Exonic
1168648059 19:58073965-58073987 CACGGTTCTGCAGGCTGTACAGG - Intronic
924971896 2:136002-136024 CACGGTTCTGCAGGCTGTACAGG - Intergenic
925078663 2:1041738-1041760 CACAGATCTGCAGGCTGTGTAGG - Intronic
925660394 2:6196322-6196344 CTGGGACCTGCATGCTGAGAAGG + Intergenic
925770888 2:7282179-7282201 CAAGGACAGGCAGGCTGAGAAGG - Intergenic
926058142 2:9788478-9788500 CACAGTTCTGCAGGCTGAACAGG - Intergenic
926096792 2:10086510-10086532 CACGGTCCTGCAGGCTGTACAGG - Intergenic
926227079 2:10974599-10974621 CACAGTTCTGCAGGCTGAACAGG + Intergenic
926232301 2:11013443-11013465 CATGGTTCTGCAGGCTGTGCAGG - Intergenic
926236023 2:11044613-11044635 CATGGTCCTGCAGACTGTGCAGG - Intergenic
926275406 2:11399755-11399777 CACGGTTCTGCAGGCTGAACAGG - Intergenic
926423878 2:12724053-12724075 CACGGACCTCTATTCTGAGCTGG - Intronic
926926126 2:17989240-17989262 CACAGTTCTGCAGGCTGTGCAGG - Intronic
927395687 2:22648301-22648323 CACTGTTCTGCAGGCTGTGCAGG - Intergenic
927514741 2:23665599-23665621 CACGGTTCTGCAGGCTGTACGGG + Intronic
928247169 2:29640575-29640597 CACGGTTCTGCAGGCTGTACAGG - Intronic
928318821 2:30267100-30267122 CACGGTTCTGCAGGCTGTACAGG + Intronic
929172974 2:38949743-38949765 CACGGTTCTGCAGGCTGTACAGG + Intronic
929328224 2:40645287-40645309 GTCGGGACTGCAGGCTGAGCCGG + Intergenic
929605739 2:43232934-43232956 CAGGGTCCTGCAGGCTGCCCTGG - Intronic
929785529 2:44988154-44988176 CACGGTTCTGCAGGCTGCACAGG + Intergenic
929788037 2:45006046-45006068 GAAAGACCCGCAGGCTGAGCGGG - Exonic
930119258 2:47746738-47746760 CATGGTTCTGCAGGCTGTGCAGG - Intronic
930461903 2:51691928-51691950 CACAGTTCTGCAGGCTGTGCAGG + Intergenic
930639006 2:53836206-53836228 CACGGTTCTGCAGGCTGTACAGG - Intergenic
931216566 2:60250523-60250545 CACGGTTCTGCAGGCTGTACAGG + Intergenic
932102649 2:68914699-68914721 CTGTGACTTGCAGGCTGAGCAGG + Intergenic
933157701 2:78993309-78993331 CAGGGACCTGGACGCAGAGCGGG - Intergenic
933439660 2:82296816-82296838 CATGGTCCTGCAGGCTGTACAGG + Intergenic
934988194 2:98902301-98902323 CGGGGCCCTGCAGGCAGAGCAGG - Intronic
935543371 2:104375612-104375634 CATGGTTCTGCAGGCTGTGCAGG + Intergenic
935605589 2:104969617-104969639 CTCGGACCTGCTGGGTGATCAGG + Intergenic
935645602 2:105330875-105330897 CCCCTACCTGGAGGCTGAGCCGG - Intergenic
935699837 2:105801920-105801942 GATGGGCCTGCAGCCTGAGCTGG - Intronic
935901625 2:107799109-107799131 AGCCCACCTGCAGGCTGAGCAGG - Intergenic
936544758 2:113381341-113381363 CACGGTTCTGCAGGCTGTACAGG - Intergenic
937620563 2:123980458-123980480 CACAGACCTGGAGGTTGAGGAGG + Intergenic
937740684 2:125349375-125349397 CACGGCTCTGCAGGCTGTACGGG + Intergenic
937761021 2:125603892-125603914 CACAGGCCTGTAGGCTGAGGAGG + Intergenic
937995564 2:127691679-127691701 CATGGTCCTGCAGGCTGTACAGG + Intergenic
938250792 2:129814007-129814029 CATGGTCCTGCAGGCTGTGCAGG - Intergenic
938794156 2:134704454-134704476 CACGGACCTGGAAGCTGAGATGG - Intronic
939279455 2:140043172-140043194 CACTGGTCTGCAGGCTGTGCAGG - Intergenic
939779744 2:146431020-146431042 CATGGTCCTGCAGGCTGTACAGG - Intergenic
939969851 2:148645823-148645845 CACGGCCGTCCAGGCGGAGCAGG - Intronic
940604328 2:155900932-155900954 CATGGGCCTGCAGGCTGTGTAGG - Intergenic
940720937 2:157280984-157281006 CACGGTTCTGCAGGCTGTACAGG - Intronic
940737342 2:157468138-157468160 CACAGACCTGCAGTTTGAACAGG - Intronic
941261684 2:163305922-163305944 CACAGTTCTGCAGGCTGTGCAGG - Intergenic
942104673 2:172620850-172620872 CACGGTTCTGCAGGCTGTACAGG - Intergenic
942189404 2:173455834-173455856 CACGGTTCTGCAGGCTGTACAGG + Intergenic
942269748 2:174262329-174262351 CAGCTACCTGCAGGCTGAGGTGG + Intergenic
942650704 2:178164488-178164510 CACGGTTCTGCAGGCTGTACAGG + Intergenic
943230558 2:185245176-185245198 CACAGTCCTGCAGGCTGTACAGG - Intergenic
943485115 2:188469465-188469487 CACGGTTCTGCAGGCTGTACAGG + Intronic
944230186 2:197384646-197384668 CACGGTTTTGCAGGCTGTGCAGG - Intergenic
944303902 2:198157483-198157505 CACAGACCTGGAGGCTTAGGAGG + Intronic
945517063 2:210775406-210775428 CACGGTTATGCAGGCTGTGCAGG - Intergenic
946338642 2:219054995-219055017 CATAGAGCTGCAAGCTGAGCTGG - Exonic
946431299 2:219628389-219628411 CCCGGACCTGCAGGCCCAGACGG - Exonic
946906989 2:224426945-224426967 CACGGTTCTGCAGGCTGTACAGG - Intergenic
947096111 2:226568661-226568683 CACGGTTCTGCAGGCTGTACAGG - Intergenic
947963952 2:234263122-234263144 CACGGCTCTGCAGGCTGTACAGG - Intergenic
948219077 2:236255089-236255111 CACGGTTCTGCAGGCTGTACAGG - Intronic
948430460 2:237915378-237915400 CACTGCACTCCAGGCTGAGCAGG + Intergenic
948532877 2:238623914-238623936 CACGGTTCTGCAGGCTGTACAGG + Intergenic
948732393 2:239975286-239975308 CACGGTTCTGCAGGCTGTACAGG - Intronic
949066180 2:241991620-241991642 CACGGTTCTGCAGGCTGTACAGG - Intergenic
949066434 2:241993542-241993564 CAGGGTCGTGCCGGCTGAGCTGG - Intergenic
1168816602 20:741894-741916 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1168921140 20:1537265-1537287 AACAGACCTGCAGGCAGAGCAGG - Exonic
1169192342 20:3666342-3666364 CATGGACCCTGAGGCTGAGCAGG - Intergenic
1170015427 20:11775849-11775871 CACGGTTCTGCAGGCTGTGAAGG - Intergenic
1170560263 20:17551186-17551208 CACGGTTCTGCAGGCTGTACAGG + Intronic
1170573263 20:17644504-17644526 CACGCACCTGCAGGCTGAGGGGG - Intronic
1170692725 20:18629728-18629750 CACAGTTCTGCAGGCTGTGCAGG + Intronic
1171446167 20:25206174-25206196 CACGTAGCTGCGGGCAGAGCCGG + Intronic
1171488883 20:25502866-25502888 CACGATTCTGCAGGCTGTGCAGG - Intronic
1172015632 20:31870808-31870830 CAGGGACGTCCAGGCAGAGCCGG - Intronic
1172183771 20:33019100-33019122 CACCGACCTCCGGGATGAGCCGG - Exonic
1172838374 20:37887348-37887370 CACAGACCTCCAGGGTGAGGAGG + Intergenic
1173017297 20:39237225-39237247 CACGGTTCTGCAGGCTGCACAGG - Intergenic
1173396218 20:42682630-42682652 CATGGAGCTGAGGGCTGAGCTGG + Intronic
1173723247 20:45278583-45278605 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1174086054 20:48008077-48008099 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1174146078 20:48453602-48453624 CAAACACCTGCAGGATGAGCGGG + Intergenic
1174167852 20:48597981-48598003 CTGTGACCTGCAGGCTGACCAGG - Intergenic
1174799339 20:53550134-53550156 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1175249082 20:57598106-57598128 CCCTGACCTGCAGGTGGAGCTGG + Intergenic
1175399853 20:58693819-58693841 CCCTGCCCTGCAGGGTGAGCCGG + Exonic
1175809042 20:61847666-61847688 CACGGTTCTGCAGGCTGTACAGG + Intronic
1176019902 20:62957236-62957258 CAGGGCCCTGCAGGCAGAGGAGG + Intronic
1176660031 21:9625454-9625476 CCCTCACCTGCAGGCTGAGCAGG + Intergenic
1177147798 21:17425297-17425319 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1177190363 21:17844834-17844856 CACTGCCCTGCAGGCTGTACAGG + Intergenic
1177206737 21:18018612-18018634 CACAGTTCTGCAGGCTGTGCAGG - Intronic
1177273409 21:18876988-18877010 CACGGTTCTGCAAGCTGTGCAGG + Intergenic
1177786276 21:25675037-25675059 CACGGTTCTGCAGGCTGTACAGG + Intronic
1178396194 21:32245917-32245939 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1179020895 21:37639963-37639985 CACAGATCTGCAGGCTGTACAGG - Intronic
1179051961 21:37896006-37896028 CACGGTTCTGCAGGCTGCACAGG + Intronic
1179396286 21:41043384-41043406 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1179782103 21:43707895-43707917 CACGGTTCTGCAGGCTGCACAGG - Intergenic
1179802694 21:43818701-43818723 CACTGCTCTGCAGGCTGAGGGGG - Intergenic
1179893060 21:44346995-44347017 TACGGTCCTGCAGGCTGTACAGG + Intergenic
1180093847 21:45545492-45545514 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1180156397 21:45979434-45979456 CGCGGACCTGCTGGCGGAGCCGG + Intergenic
1180336444 22:11580652-11580674 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1180880079 22:19197408-19197430 GATGGAGCTGCAGGCTGGGCAGG - Intronic
1180942548 22:19668814-19668836 CACGGTTCTGCAGGCTGTACGGG + Intergenic
1181464331 22:23102612-23102634 AAAGGCCCTGCAGGCAGAGCAGG - Intronic
1181540754 22:23572022-23572044 CACGGGTCTGCAGGCTGTACAGG + Intergenic
1181556853 22:23676099-23676121 TAGGAACCTGCAGGCTGAGAGGG + Intergenic
1181831690 22:25565043-25565065 GGCGGACCTGGAGGCTGTGCTGG + Exonic
1182444068 22:30380134-30380156 CACGGCGCTGCCGGCTGAGCAGG - Exonic
1183266343 22:36828551-36828573 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1183272404 22:36870417-36870439 CCCAGACCGGCAGGCTGAGCAGG - Exonic
1183648660 22:39141230-39141252 CACCCAGCTGCAGGCTGGGCTGG + Intronic
1183860853 22:40668852-40668874 CATGGTTCTGCAGGCTGGGCAGG - Intergenic
1184210266 22:43031190-43031212 CGCGGAGCTGGAGGCTGTGCCGG + Intergenic
1184549663 22:45197724-45197746 CAAGGCCCTGGAGGCAGAGCTGG + Intronic
1184550218 22:45200397-45200419 CACGGAGCTGGAGGCTCAGAGGG - Intronic
1184854357 22:47138339-47138361 GATGGACCTGCAGGCTGGGGAGG + Intronic
1184924480 22:47627278-47627300 CACAGACTTGCAGGCTGGGAAGG + Intergenic
1185368230 22:50446646-50446668 CAGGGACATGCAGGCCGAGCTGG + Exonic
1185375723 22:50481886-50481908 CAGGGAGCTGCAGGCAGAGGAGG - Exonic
950040813 3:9917984-9918006 TACGCACCTGCAGACAGAGCTGG + Exonic
950429279 3:12941570-12941592 CTCGGACCTGCAGGACAAGCAGG - Exonic
951191129 3:19772744-19772766 CACGGTTCTGCAGGCTGTACAGG - Intergenic
951464822 3:22990434-22990456 CGCGGATCTGCTGGGTGAGCTGG - Intergenic
951857662 3:27215729-27215751 CACGGTTCTGCAGGCTGTACAGG + Exonic
953417970 3:42733877-42733899 CACGGCCCTGCATGCGGGGCAGG + Intronic
953847387 3:46438546-46438568 GACCGACCTGCACACTGAGCTGG - Intronic
953869431 3:46613706-46613728 GAGGGACTTGCAGGATGAGCGGG - Intronic
953890842 3:46750640-46750662 CACGGAGCTGGAGGCGGAGCAGG + Intronic
953949265 3:47175809-47175831 CACGGTACTGCAGGCTGTACAGG - Intergenic
954156091 3:48685630-48685652 CACTCACCTGCAGGCGGCGCAGG + Exonic
954649741 3:52153923-52153945 CCCGGGCCTGCAGTGTGAGCGGG - Intronic
954684824 3:52364798-52364820 CACTGCCCTGAAGGCTCAGCCGG + Intronic
955235370 3:57134588-57134610 CAAGAAGCTGCAGGCTGACCAGG + Intronic
955688082 3:61564212-61564234 CACGGACTTGACGACTGAGCGGG + Intronic
956330768 3:68104940-68104962 CACGGTTCTGCAGGCTGTACAGG + Intronic
956724875 3:72148737-72148759 CACGGTTCTGCAGGCTGTGCAGG + Intergenic
957963778 3:87295461-87295483 CACGGTTCTGCAGGCTGCACAGG + Intergenic
958592513 3:96175717-96175739 CATGGCCCGGCAGGCTGAGTGGG + Intergenic
959884387 3:111482056-111482078 CACGGTTCTGCAGGCTGTACAGG + Intronic
960777313 3:121271824-121271846 CACAGTTCTGCAGGCTGTGCTGG + Intronic
961347968 3:126277090-126277112 CACGGTTCTGCAGGCTGTACAGG + Intergenic
961697102 3:128712923-128712945 CACGGTTCTGCAGGCTGTACAGG + Intergenic
962518590 3:136176823-136176845 CACGGTTCTGCAGGCTGTACAGG - Intronic
962605696 3:137031210-137031232 CAGCTACCTGGAGGCTGAGCTGG - Intergenic
963549073 3:146698215-146698237 CACGGTTCTGCAGGCTGTTCAGG + Intergenic
964073405 3:152663847-152663869 CACGGTTCTGCAGGCTGTACAGG + Intergenic
964468839 3:157030038-157030060 CATGGTTCTGCAGGCTGAACAGG + Intronic
965044944 3:163564881-163564903 CACGGATCTGCAGGCTGTACAGG + Intergenic
965341947 3:167502259-167502281 CACGGTTCTGCAGGCTGTTCAGG - Intronic
967646889 3:191935540-191935562 CACGATTCTGCAGGCTGTGCAGG - Intergenic
968446495 4:654944-654966 GACGGCCCTGGGGGCTGAGCCGG - Intronic
968492859 4:899785-899807 CGCGGACCAGCAAGCTGAACAGG + Intronic
968911404 4:3478550-3478572 CACAAACCTGCAGACTGGGCTGG + Intronic
968976363 4:3824245-3824267 CAAGGGCCAGCAGGCTGAGAAGG - Intergenic
969116645 4:4874428-4874450 CAGGGAGCTGGAGGCTGGGCAGG - Intergenic
969330842 4:6472684-6472706 CGCGGCCCTGCAGGTGGAGCCGG + Intronic
969869627 4:10096517-10096539 CACGGAACCGCAGGCTGAGCTGG - Intronic
969929658 4:10618613-10618635 CACGGTTCTGCAGGCTGTACGGG + Intronic
970052934 4:11936776-11936798 CATGGTTCTGCAGGCTGTGCAGG + Intergenic
970125627 4:12806846-12806868 CATGGTCCTGCAGGCTGTACAGG + Intergenic
970344443 4:15139932-15139954 CACTGACCTGGAGGCCTAGCTGG + Intergenic
971265727 4:25094696-25094718 CACGGTTCTGCAGGCTGTACAGG - Intergenic
971585065 4:28394832-28394854 CACGGTTCTGCAGGCTGTACAGG - Intronic
971896776 4:32606386-32606408 CATGGATCTGCAGGCTGTACAGG + Intergenic
972227102 4:37026193-37026215 CACGGTTCTGCAGGCTGTACAGG + Intergenic
972844260 4:42969394-42969416 CACAGTCCTGCAGGCTTAACAGG + Intronic
972953979 4:44366523-44366545 CACGATTCTGCAGGCTTAGCAGG - Intronic
975300111 4:72780110-72780132 CACGGTTCTGCAGGCTGCACAGG - Intergenic
975636704 4:76457446-76457468 CACGGTTCTGCAGGCTGTACAGG - Intronic
975929516 4:79501891-79501913 CACAGTTCTGCAGGCTGTGCAGG - Intergenic
976532912 4:86175700-86175722 CACGGTCCTGCAGGCTGTACAGG - Intronic
976649395 4:87418880-87418902 CACGGTTCTGCAGGCTGTACAGG + Intergenic
976710252 4:88063082-88063104 AACAGATGTGCAGGCTGAGCAGG + Intronic
977895759 4:102363180-102363202 CAAGGACCTGCAGCATAAGCAGG - Intronic
978990654 4:115078177-115078199 CACGGTTCTGCAGGCTGTACAGG + Intronic
979515355 4:121603027-121603049 CACGGTTCTGCAGGCTGTACAGG + Intergenic
980290271 4:130841328-130841350 CACAGTTCTGCAGGCTGAACAGG + Intergenic
980650394 4:135706476-135706498 CCCGGACCACCAGGCTGAGGTGG - Intergenic
981351366 4:143733787-143733809 CATGGTCCTGCAGGCTGTACAGG + Intergenic
982034328 4:151330934-151330956 CACAGTTCTGCAGGCTGTGCAGG + Intergenic
982188912 4:152833948-152833970 CACAGTTCTGCAGGCTGTGCAGG + Intronic
983372583 4:166880012-166880034 CACGGTTCTGCAGGCTGTACAGG - Intronic
983571600 4:169214354-169214376 CACAGTCCTGCAGGCTGTACTGG - Intronic
983747452 4:171219262-171219284 CACAGATCTGCAGGCTGTACAGG - Intergenic
983791042 4:171797651-171797673 CACGGTTCTGGAGGCTGAGAAGG + Intergenic
983826306 4:172266184-172266206 CACAGCCCTGAAGCCTGAGCAGG + Intronic
984773438 4:183458549-183458571 CACGGCTCTGCAGGCTGCACAGG - Intergenic
984871947 4:184333553-184333575 CACGGCTCTGCAGGCTGCACAGG + Intergenic
985242993 4:187950706-187950728 CACAGTTCTGCAGGCTGTGCAGG + Intergenic
985320037 4:188700794-188700816 CATGGTCCTGCAGGCTGTGTGGG + Intergenic
985415335 4:189730952-189730974 CCCTCACCTGCAGGCTGAGCAGG - Intergenic
986124848 5:4875411-4875433 CATGGTTCTGCAGGCTGAACAGG + Intergenic
986735146 5:10662760-10662782 CACTGGGCTGAAGGCTGAGCAGG - Intergenic
987091126 5:14508577-14508599 CACAGAGCTGCAAGCTGCGCTGG + Exonic
987291370 5:16511712-16511734 CATGGATCTGCAGGCTGTACAGG + Intronic
987397855 5:17442799-17442821 CACGGTTCTGCAGGCTGTACAGG + Intergenic
987650748 5:20737082-20737104 CACGGTTCTGCAGGCTGTGTAGG - Intergenic
987693783 5:21302106-21302128 CACAGTTCTGCAGGCTGAACAGG + Intergenic
988045186 5:25942188-25942210 CACAGATCTGCAGGCTGTACAGG + Intergenic
988716761 5:33836302-33836324 CCCGGACCTGAAGGCTCATCAGG + Intronic
988744806 5:34124381-34124403 CACGGTTCTGCAGGCTGTGTAGG + Intronic
990405374 5:55484788-55484810 CACCTACCTGGAGGTTGAGCTGG - Intronic
990883605 5:60567889-60567911 CACAGTCCTGCAGGCTGTACAGG + Intergenic
990921996 5:60978387-60978409 CACGGTTCTGCAGGCTGTACAGG + Intronic
991163325 5:63531327-63531349 CACGGTTCTGCAGGCTGTACAGG - Intergenic
991432114 5:66559187-66559209 CACGGTTCTGCAGGCTGTACAGG + Intergenic
991762135 5:69929314-69929336 CACAGTCCTGCAGGCTGTACAGG + Intergenic
991785193 5:70188786-70188808 CACAGTCCTGCAGGCTGTACAGG - Intergenic
991841363 5:70804363-70804385 CACAGTCCTGCAGGCTGTACAGG + Intergenic
991877640 5:71189184-71189206 CACAGTCCTGCAGGCTGTACAGG - Intergenic
991890415 5:71326700-71326722 CACAGTTCTGCAGGCTGAACAGG - Intergenic
992353243 5:75952747-75952769 CACGGCTCTGCAGGCTGTACAGG - Intergenic
992473129 5:77077311-77077333 CCGGGAACTGCAGGCCGAGCGGG - Exonic
992546953 5:77822682-77822704 CACGGCTCTGCAGGCTGTACAGG + Intronic
993638511 5:90374227-90374249 CACAGATCTGCAGGCTTTGCAGG + Intergenic
994168198 5:96629934-96629956 CACCGTACTGCAGGCTTAGCTGG - Intronic
994209143 5:97068762-97068784 CACGGTTCTGCAGGCTGTACAGG - Intergenic
995017480 5:107327375-107327397 CTTGGAGCTGCAGGCTGAGAAGG + Intergenic
995810146 5:116097674-116097696 CACGGTTCTGCAGGCTGTACGGG + Intronic
996356491 5:122601127-122601149 CACAGGCCTGGAGGCTGAGGAGG - Intergenic
996492477 5:124114511-124114533 CACTGTCCTGCAGGCTGTACAGG + Intergenic
997161540 5:131614367-131614389 CATGGTCCTGCAGGCTGTACAGG + Intronic
997273641 5:132564007-132564029 CACGGTTCTGCAGGCTGTACAGG - Intronic
997305899 5:132836230-132836252 CACGGTTCTGCAGGCTGTACAGG - Intergenic
997815595 5:137014292-137014314 CACGATTCTGCAGGCTGAACAGG - Intronic
997966582 5:138361724-138361746 CATGGGCCTGAAGGATGAGCAGG - Intronic
998941532 5:147288501-147288523 CATGGTTCTGCAGGCTGTGCAGG + Intronic
999030920 5:148290249-148290271 CACGGTTCTGCAGGCTGTGCAGG + Intergenic
999153952 5:149444665-149444687 CACGGTTCTGCAGGCTGTACAGG - Intergenic
999254269 5:150201124-150201146 CGCGGACCAGCAGCATGAGCAGG - Exonic
999369139 5:151042605-151042627 GACTGACCTGGAGGCCGAGCGGG - Exonic
999383436 5:151137799-151137821 CATGGTTCTGCAGGCTGAACAGG - Intronic
1000552301 5:162682247-162682269 CATGGTTCTGCAGGCTGTGCAGG + Intergenic
1001754412 5:174157334-174157356 CAAGGACCTGCTGGCTCAGATGG - Intronic
1002279272 5:178121247-178121269 CAAGGAGCTGCGGGCTCAGCAGG + Exonic
1002643499 5:180641548-180641570 AACGGAGCTGCTGGCTGAGCTGG + Intronic
1002658635 5:180774097-180774119 CATGGTTCTGCAGGCTGAACAGG + Intergenic
1002696560 5:181095964-181095986 CATGGCTCTGCAGGCTGTGCAGG + Intergenic
1002698062 5:181103409-181103431 CATGGCTCTGCAGGCTGTGCAGG - Intergenic
1003270122 6:4601004-4601026 CACAGACCAGCAGGCAGAGCAGG - Intergenic
1003313712 6:4992024-4992046 CACGTTTCTGCAGGCTGTGCAGG - Intergenic
1004076710 6:12350585-12350607 CACGGTTCTGCAGGCTGAACAGG + Intergenic
1004176431 6:13344105-13344127 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1004959617 6:20771890-20771912 CACGGTTCTGCAGGCTGTACGGG - Intronic
1005146987 6:22702744-22702766 CATGGTTCTGCAGGCTGTGCAGG + Intergenic
1005557126 6:26997831-26997853 CACAGTTCTGCAGGCTGAACAGG - Intergenic
1005805201 6:29468195-29468217 CCAGAACCTGCAGGCTGGGCTGG - Intergenic
1008522341 6:52374157-52374179 CACGGTTCTGCAGGCTGTACAGG - Intronic
1010189123 6:73176422-73176444 CATGGTTCTGCAGGCTGTGCAGG - Intronic
1010403451 6:75475040-75475062 CATGGTTCTGCAGGCTGTGCAGG - Intronic
1011645689 6:89455796-89455818 CACGGTTCTGCAGGCTGTACAGG - Intronic
1014040047 6:116815916-116815938 CATGGTCCTGCAGGCTGTACTGG + Intronic
1014577612 6:123092705-123092727 CACGGTTCTGCAGGCTGCACAGG - Intergenic
1014774169 6:125489440-125489462 CACTGTTCTGCAGGCTGAACGGG - Intergenic
1014811860 6:125895613-125895635 CACAGTTCTGCAGGCTGTGCAGG + Intronic
1014819699 6:125973601-125973623 CACCTACCAGCAGGCAGAGCAGG - Intronic
1015286274 6:131489718-131489740 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1016889712 6:148993880-148993902 CAGTGATCTGCAGGCTGTGCAGG - Intronic
1017590008 6:155968512-155968534 CACGGTTCTGCAGGCTGTGCAGG - Intergenic
1017645549 6:156536901-156536923 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1017872231 6:158496212-158496234 CACGGCCCCCCTGGCTGAGCTGG - Intronic
1018056309 6:160055203-160055225 AACAGACCAGCAGGCTGAACTGG - Intronic
1018364761 6:163108344-163108366 CACGGTTCTGCAGGCTGTGCAGG - Intronic
1018425212 6:163673826-163673848 CACAGTCCTGCAGGCTGTACAGG + Intergenic
1018769210 6:166956940-166956962 CGCGGGCCTGCAGGGTGCGCGGG - Intronic
1018940327 6:168305238-168305260 CACAGTCCTGCAAGCTGACCAGG - Intronic
1019039965 6:169095639-169095661 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1019053485 6:169202441-169202463 CACGGTTCTGCAGGCTATGCAGG + Intergenic
1019269894 7:140951-140973 GTCCCACCTGCAGGCTGAGCAGG + Intergenic
1019390465 7:783887-783909 GCCGGGGCTGCAGGCTGAGCTGG - Intronic
1019614691 7:1953927-1953949 CACTGACCTTCTGGCTGGGCGGG - Intronic
1019816343 7:3203940-3203962 CACGGTTCTGCAGGCTGTCCAGG + Intergenic
1019948993 7:4355647-4355669 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1020765227 7:12311472-12311494 CACAGTCCTGCAGGCTGTACAGG + Intergenic
1022532380 7:31075141-31075163 CAGGGACCTGCAAGGTGAGATGG - Intronic
1022981888 7:35611832-35611854 CACAGTTCTGCAGGCTGTGCAGG - Intergenic
1023543329 7:41289596-41289618 CACGGTTCTGCAGACTGAACAGG - Intergenic
1024147933 7:46536199-46536221 CACAGTCCTGCAGGCTGTACAGG - Intergenic
1024692605 7:51819179-51819201 CAGAGAGGTGCAGGCTGAGCTGG - Intergenic
1024755716 7:52528220-52528242 CACAGACCTGGAGGTTGACCTGG + Intergenic
1024947883 7:54829554-54829576 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1025075869 7:55942699-55942721 CACAGTTCTGCAGGCTGTGCAGG + Intergenic
1025729525 7:64097671-64097693 CACGGTTCTGCAGGCTGTACAGG + Intronic
1026338724 7:69417197-69417219 CACGGATCTGCAGGCTGTAAAGG + Intergenic
1026841408 7:73671496-73671518 CCTGGCCCTGGAGGCTGAGCTGG + Exonic
1027027005 7:74860221-74860243 CACTGCCCTCCAGCCTGAGCAGG - Intergenic
1027348686 7:77288347-77288369 CATGGTTCTGCAGGCTGTGCAGG + Intronic
1028634504 7:92972136-92972158 CATGGTTCTGCAGGCTGTGCAGG + Intergenic
1029034345 7:97503341-97503363 CACAGTTCTGCAGGCTGTGCAGG + Intergenic
1029498113 7:100908979-100909001 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1030999481 7:116398168-116398190 CATGGTTCTGCAGGCTGAACAGG - Intronic
1031762151 7:125726941-125726963 CACGGCTCTGCAGGCTGCACAGG - Intergenic
1031795887 7:126174321-126174343 CATGGTCCTGCAGGCTGTACAGG - Intergenic
1031976516 7:128097135-128097157 CGGGGGCCTGCAGGGTGAGCTGG + Intergenic
1032288061 7:130558444-130558466 CACAGTTCTGCAGGCTGAACAGG - Intronic
1032392557 7:131565485-131565507 CACGGTTCTGCAGGCTGTGCAGG + Intergenic
1032536483 7:132668846-132668868 CACGGTTCTGCAGGCTGTACAGG + Intronic
1032891221 7:136197655-136197677 CACTGTTCTGCAGGCTGTGCAGG + Intergenic
1033754777 7:144389283-144389305 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1034681335 7:152930831-152930853 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1034690961 7:153013336-153013358 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1034728660 7:153364604-153364626 CACGGTTCTGCAGGCTGTGCAGG + Intergenic
1034819537 7:154204098-154204120 CACTGCCCTGCAGGATGACCAGG - Intronic
1034854700 7:154531777-154531799 CACGGACCTGAAAGCTTAACAGG + Intronic
1034936984 7:155206620-155206642 CAGGGATCTGCAGGCTGTACGGG + Intergenic
1034973426 7:155433600-155433622 CAGGGATCTGCAGGCTGTACAGG - Intergenic
1035578329 8:723244-723266 CACGGTTCTGCAGGCTGTACAGG - Intronic
1036121259 8:6020248-6020270 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1036141991 8:6217182-6217204 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1036418515 8:8573378-8573400 CACAGTTCTGCAGGCTGTGCAGG - Intergenic
1036640543 8:10580726-10580748 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1037411553 8:18603915-18603937 CACGGGTCTGCAGGCTGTACAGG - Intronic
1038370568 8:26985781-26985803 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1038522469 8:28244996-28245018 CACAGTTCTGCAGGCTGAACAGG + Intergenic
1038552106 8:28479105-28479127 CACAGTTCTGCAGGCTGTGCAGG - Intronic
1039447760 8:37646352-37646374 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1040517013 8:48143640-48143662 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1042220971 8:66473798-66473820 CACAGACCTACAGGCTTAGGGGG - Intronic
1042657844 8:71120003-71120025 CACGGTTCTGCAGGCTGTTCAGG + Intergenic
1042751716 8:72164434-72164456 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1042800106 8:72709431-72709453 CACAGTCCTGCAGGCTGTACAGG + Intronic
1042861273 8:73316685-73316707 CACGGTTCTGCAGGCTGTACAGG + Intronic
1043028997 8:75107291-75107313 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1044552929 8:93532330-93532352 CATGGTTCTGCAGGCTGTGCAGG - Intergenic
1044761327 8:95520755-95520777 CACAGTTCTGCAGGCTGTGCAGG + Intergenic
1045714170 8:105022252-105022274 CATGGTTCTGCAGGCTGTGCAGG + Intronic
1046655143 8:116885460-116885482 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1046829725 8:118731039-118731061 CATGGTTCTGCAGGCTGTGCAGG - Intergenic
1047013661 8:120699583-120699605 CACGGTGCTGCAGGCTGGACAGG - Intronic
1047511663 8:125520499-125520521 CCCAAATCTGCAGGCTGAGCTGG + Intergenic
1047940388 8:129823251-129823273 CACGGTTCTGCAGGCTGTACCGG - Intergenic
1048651708 8:136485453-136485475 CACGGTTCTGCAGGCTGTGTAGG + Intergenic
1048868347 8:138777061-138777083 TAGGGACCTCCAGGATGAGCAGG + Intronic
1049370606 8:142262792-142262814 CACGGTTCTGCAGGCTGTACGGG - Intronic
1049476786 8:142800579-142800601 TTCTGAGCTGCAGGCTGAGCGGG - Intergenic
1049820599 8:144630945-144630967 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1049830465 8:144698332-144698354 CACAGTTCTGCAGGCTGTGCAGG - Intergenic
1050111653 9:2223049-2223071 CATGGTTCTGCAGGCTGTGCAGG + Intergenic
1050600594 9:7246367-7246389 CTCTGACCTGCAGCCTGAGCTGG + Intergenic
1051431010 9:16980509-16980531 CAGGGACCTGGGGGCTGAGATGG - Intergenic
1052834069 9:33237408-33237430 CAAGCACCTTTAGGCTGAGCAGG - Intronic
1053186218 9:36018793-36018815 CACGGTCCTCCAGGCTCAGCTGG - Intergenic
1054857271 9:69914459-69914481 CACGGTTCTGCAGGCTGCACAGG - Intergenic
1055331089 9:75184524-75184546 CATGGTCCTGCAGGCTGTGCAGG + Intergenic
1055814497 9:80188689-80188711 CACAGCTCTGCAGGCTGTGCAGG + Intergenic
1056032142 9:82564122-82564144 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1056188853 9:84165104-84165126 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1057075425 9:92135896-92135918 GAGGGCCCTGCAGGCTGGGCTGG + Intergenic
1057325843 9:94062534-94062556 CATGGTTCTGCAGGCTGTGCAGG + Intronic
1057961518 9:99461930-99461952 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1058374173 9:104304369-104304391 CACGGCTCTGCAGGCTGTACAGG - Intergenic
1058595703 9:106613331-106613353 CACGGTCCCTCATGCTGAGCAGG - Intergenic
1058813026 9:108659589-108659611 CACAGGCCTGGAGGCTTAGCAGG + Intergenic
1059355774 9:113698270-113698292 CACAGTTCTGCAGGCTTAGCAGG - Intergenic
1059411818 9:114137327-114137349 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1059424514 9:114212247-114212269 CAAGGACCTGGAGTCTGAGAGGG + Intronic
1059955305 9:119509440-119509462 CTAGGACCTGCAGGATGAGTGGG - Intronic
1060159739 9:121350592-121350614 CAGGGACCTGAAGGCAGAGATGG - Intronic
1060172991 9:121476888-121476910 CCAGGGGCTGCAGGCTGAGCTGG + Intergenic
1060189151 9:121581286-121581308 CAGGGAACTGGAGGCTGAGCAGG - Intronic
1060789595 9:126477047-126477069 CACGGTTCTACAGGCTGTGCAGG + Intronic
1060798825 9:126531043-126531065 CAGGGTCCAGCAGGCTGAACAGG + Intergenic
1061664721 9:132153885-132153907 CACAGACGTGCAGGCTGGGAGGG - Intergenic
1062032476 9:134367860-134367882 CACAAAACTGCTGGCTGAGCCGG - Intronic
1062050732 9:134445301-134445323 CACGGTTCTGCAGGCTGTCCAGG - Intergenic
1062328024 9:136022064-136022086 CATGGATCTGGAGGCTGACCTGG + Intronic
1062486396 9:136778593-136778615 CACGGAGCTGGAGACTGAGGAGG - Intergenic
1062486473 9:136778936-136778958 CACGGAGCTGGAGACTGAGGAGG - Intergenic
1203637595 Un_KI270750v1:127298-127320 CCCTCACCTGCAGGCTGAGCAGG + Intergenic
1185711204 X:2304727-2304749 CATGGATCTGCAGGCTGTACGGG - Intronic
1185788967 X:2914042-2914064 CACGGTTCTGCAGGCTGCACAGG - Intronic
1185826343 X:3254970-3254992 CACGGTTCTGCAGGCTGCACAGG + Intergenic
1185882235 X:3751561-3751583 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1185968918 X:4639582-4639604 CACGGTTCTGCAGGCTGCACAGG - Intergenic
1186147043 X:6635441-6635463 CACAGTTCTGCAGGCTGAACAGG + Intergenic
1186152302 X:6688351-6688373 CACAGTTCTGCAGGCTGAGCAGG + Intergenic
1187234803 X:17457294-17457316 CACAGTCCTGTAGGCTGTGCAGG + Intronic
1187285610 X:17900341-17900363 CACGGGCCTGCATCCTGTGCAGG - Intergenic
1188394162 X:29659938-29659960 CACAGTTCTGCAGGCTGTGCAGG + Intronic
1188673267 X:32906376-32906398 CACGGTTCTGCAGGCTGTTCAGG - Intronic
1188993347 X:36851691-36851713 CATGGTCCTGCAGGCTGTGCAGG + Intergenic
1189333882 X:40158378-40158400 CGCGGAGCCGCAGGCTGGGCCGG + Intronic
1189357964 X:40325914-40325936 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1189409075 X:40754399-40754421 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1190260692 X:48795121-48795143 CACAGGGCTGCAGGCTGAGCTGG - Intergenic
1192912874 X:75623875-75623897 CATGGTTCTGCAGGCTGTGCAGG + Intergenic
1193102952 X:77636491-77636513 CACGGTTTTGCAGGCTGTGCAGG - Intronic
1193277988 X:79612855-79612877 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1193473558 X:81935448-81935470 CAGGGATCTGCATGCTGTGCAGG - Intergenic
1193865724 X:86727795-86727817 CATGGGTCTGCAGGCTGTGCAGG - Intronic
1194169444 X:90564026-90564048 CACAGGCCTGGAGGCTGAGGAGG + Intergenic
1194352810 X:92841159-92841181 CACGGTTCTGCAGGCTTAACAGG + Intergenic
1195741406 X:108068452-108068474 CACGGTTCTGCAGGCTGTACAGG + Intronic
1196496347 X:116328774-116328796 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1197401119 X:125992138-125992160 CACGGACCTGAAGGCTGGGAGGG + Intergenic
1197525184 X:127552840-127552862 CACAGTTCTGCAGGCTGTGCAGG - Intergenic
1197587188 X:128363417-128363439 CAATGACGTGCAGGCTGAGGTGG - Intergenic
1198979128 X:142374691-142374713 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1199243302 X:145573870-145573892 CATGGATCTGCAGGCTGTACAGG - Intergenic
1199882930 X:151989722-151989744 CCCTGACCTGCAGTCTGAGATGG + Intergenic
1199963065 X:152795043-152795065 CACGGTTCTGCAGGCTGTACAGG - Intergenic
1200160627 X:154006589-154006611 CACGGTTCTGCAGGCTGTACAGG + Intergenic
1200207320 X:154326264-154326286 CCCTGACAGGCAGGCTGAGCAGG - Intronic
1200515686 Y:4141800-4141822 CACAGGCCTGGAGGCTGAGGAGG + Intergenic
1200661112 Y:5957901-5957923 CACGGTTCTGCAGGCTTAACAGG + Intergenic