ID: 1152532541

View in Genome Browser
Species Human (GRCh38)
Location 17:80927818-80927840
Sequence GATGAGGGCAGGCGGAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1018
Summary {0: 1, 1: 0, 2: 7, 3: 85, 4: 925}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152532541_1152532552 18 Left 1152532541 17:80927818-80927840 CCCCTCCTCCGCCTGCCCTCATC 0: 1
1: 0
2: 7
3: 85
4: 925
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532541_1152532557 28 Left 1152532541 17:80927818-80927840 CCCCTCCTCCGCCTGCCCTCATC 0: 1
1: 0
2: 7
3: 85
4: 925
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1152532541_1152532553 24 Left 1152532541 17:80927818-80927840 CCCCTCCTCCGCCTGCCCTCATC 0: 1
1: 0
2: 7
3: 85
4: 925
Right 1152532553 17:80927865-80927887 TCCCGCCCGCACGGAGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 358
1152532541_1152532556 27 Left 1152532541 17:80927818-80927840 CCCCTCCTCCGCCTGCCCTCATC 0: 1
1: 0
2: 7
3: 85
4: 925
Right 1152532556 17:80927868-80927890 CGCCCGCACGGAGGAGCTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 157
1152532541_1152532551 15 Left 1152532541 17:80927818-80927840 CCCCTCCTCCGCCTGCCCTCATC 0: 1
1: 0
2: 7
3: 85
4: 925
Right 1152532551 17:80927856-80927878 TCTGAGAATTCCCGCCCGCACGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152532541 Original CRISPR GATGAGGGCAGGCGGAGGAG GGG (reversed) Intronic
900123442 1:1059245-1059267 GCTGAGCGCAGGCGAGGGAGAGG + Intergenic
900513364 1:3070399-3070421 GGTGAGGACAGGCGGAGCCGCGG + Intronic
901128063 1:6943199-6943221 GAGGAGGGGAGGAGGAGAAGAGG - Intronic
901167232 1:7229461-7229483 AAGGAGGGCAGGAGGAGGGGAGG + Intronic
901167283 1:7229588-7229610 GGGGAGGGCAGGAGGAGGGGAGG + Intronic
901220377 1:7580306-7580328 AATGGGGGCAGGTGGAGAAGAGG + Intronic
901338847 1:8476458-8476480 GATGAGGGTGGGTGGAGGAAAGG + Intronic
901427394 1:9191171-9191193 GATGAGCACAGGCAGAGGCGGGG - Intergenic
901666858 1:10831075-10831097 GATGAGGACAGGAAGAGGAAGGG + Intergenic
901740345 1:11338086-11338108 GAGGAGGGGAGGGGAAGGAGGGG - Intergenic
901791961 1:11658511-11658533 GCTGGGGGCAGGCAGAGGGGTGG - Exonic
901816997 1:11800012-11800034 GATGGTGGCAGGCCCAGGAGGGG + Intronic
901844454 1:11973041-11973063 GAGGAGGGCTAGCTGAGGAGAGG + Intronic
902053841 1:13584237-13584259 GCTGAGCGCCGGAGGAGGAGAGG + Intronic
902395952 1:16132612-16132634 GCTGGGCACAGGCGGAGGAGTGG + Intronic
902490833 1:16779366-16779388 GAGGAGAGCAGGGGGAGTAGGGG + Intronic
902550988 1:17219504-17219526 GATGAGGCCAGGTGGAGGACAGG + Intronic
902686373 1:18080244-18080266 GATAAGGGCAGGAGCACGAGGGG + Intergenic
903020061 1:20387334-20387356 GATGAGGGCAGAAGGCAGAGAGG + Intergenic
903034717 1:20486241-20486263 GAGGAGGGCGGGAGGAGGCGGGG + Intergenic
903625941 1:24730299-24730321 GAGGTGGGGAAGCGGAGGAGGGG + Intergenic
903845893 1:26279882-26279904 GATCAGGGCAGCCGCAGAAGGGG + Exonic
903864133 1:26385748-26385770 GATGTGGGTTGGCGGGGGAGGGG + Intergenic
903939807 1:26921853-26921875 GCGGAGAGCAGGAGGAGGAGCGG + Exonic
903956788 1:27031572-27031594 GATCAGGGCAGGCCTGGGAGAGG - Intergenic
904013871 1:27405903-27405925 GCTGGGGGCAGGAGGAGGTGGGG - Exonic
904081115 1:27873060-27873082 GAGGAGGGCCGGGGGAGGAGTGG - Intronic
904439653 1:30521999-30522021 GATCAAGGAAGGAGGAGGAGAGG + Intergenic
904449019 1:30599139-30599161 GATGGGGGCAGTGGGAGGAAGGG - Intergenic
904850493 1:33455591-33455613 GATGGGAGAAGGCGGAGGAGAGG - Intergenic
905013116 1:34760243-34760265 GAGGAGGGTAGGAGGAGGGGAGG + Intronic
905212388 1:36383579-36383601 GAGGAGGGAAGGAGGAGGACAGG - Intronic
905649373 1:39646309-39646331 GAGGAGGGCAAGGGGAGGACAGG - Intergenic
905663791 1:39749360-39749382 GGTGAGGGCAGGGAGAGCAGTGG - Intronic
906013061 1:42547736-42547758 GATGAGGGGAGGCTGTGAAGAGG - Intronic
906240356 1:44238837-44238859 GAGCAGGGGAGGAGGAGGAGGGG - Intronic
906289362 1:44610000-44610022 GAGGAGGGCAGGGAGGGGAGGGG - Intronic
906330382 1:44879202-44879224 AATGAAGGCAGGGGGTGGAGAGG - Intronic
906700209 1:47852224-47852246 GACGAGGCCAGGCGGAGGTTTGG + Intronic
906972330 1:50528811-50528833 GCTGAGGAGAGGTGGAGGAGAGG - Intronic
907461151 1:54606382-54606404 GCTGAGTGCAGGCAGGGGAGTGG + Intronic
907528562 1:55070066-55070088 GCTGATGACAGGTGGAGGAGAGG + Intronic
907649372 1:56280048-56280070 GAAGAGGGCAGCCTGGGGAGAGG + Intergenic
907865517 1:58396112-58396134 GAAGAGGGCAGGGGAGGGAGGGG + Intronic
907924870 1:58946013-58946035 GATGAGGGAGGAAGGAGGAGAGG - Intergenic
908401188 1:63774240-63774262 GAGGCGGCCAGGCGGAGGCGAGG + Exonic
908420908 1:63957509-63957531 AATGAGGGCAGGAGGAGAATAGG - Intronic
909391321 1:75125263-75125285 GATGAGGAAGGGCGGGGGAGAGG + Intergenic
910223894 1:84916968-84916990 AATGAAGGCAGTCGTAGGAGTGG + Intergenic
910280477 1:85495045-85495067 GCAGAGGGCAGGCGGGGGAAAGG + Intronic
910337908 1:86155326-86155348 GCTGAGGGCAGGCGGAGGCAGGG - Intronic
910409168 1:86923146-86923168 TAGAAGGGCAGGGGGAGGAGTGG - Intronic
910434041 1:87187320-87187342 GATGAGGGCAGATGAAGGGGTGG + Intergenic
911137696 1:94458965-94458987 GGAGAGGGGAGGTGGAGGAGGGG - Intronic
912379200 1:109237973-109237995 GATGGGGGCAGGGGGATGAATGG - Exonic
912449051 1:109758489-109758511 CATGGGGGCAGGTGAAGGAGAGG - Intronic
912522924 1:110258869-110258891 GATGGGAGCAGGAGGAGGGGAGG - Intronic
912629672 1:111235841-111235863 GATGAGGGGAGGAGGAAGAGAGG + Intronic
912754405 1:112312528-112312550 GCTGAGGGGAGGTGGAGGAGTGG - Intergenic
912762761 1:112383733-112383755 GCTGAGGGGAGGGGGAGGTGGGG - Intergenic
913169840 1:116222023-116222045 GAGGAGGGAAGGAGGAGGGGAGG + Intergenic
913284210 1:117212188-117212210 GCTGAGGGCAGTGGGAGCAGTGG + Intergenic
913314059 1:117535224-117535246 GGAGAGGGGAGACGGAGGAGAGG - Intergenic
913705412 1:121417028-121417050 GAAGAAGGAAGACGGAGGAGAGG - Intergenic
913968704 1:143397599-143397621 GATGAAGGCAAGCAGAAGAGAGG - Intergenic
914063083 1:144223198-144223220 GATGAAGGCAAGCAGAAGAGAGG - Intergenic
914116067 1:144743156-144743178 GATGAAGGCAAGCAGAAGAGAGG + Intergenic
914433743 1:147641850-147641872 GGGAAGGGCAGGCGGAGGCGGGG + Intronic
914889833 1:151612552-151612574 GAGGAGTGCAGGGGCAGGAGGGG - Intronic
914937766 1:151994975-151994997 AAAGAGGGCGGGCGGGGGAGGGG - Intergenic
914984970 1:152448604-152448626 GCTGAAGGCAGGTGGAGGGGTGG + Intergenic
915271351 1:154755940-154755962 GGGGAGGGGAGGAGGAGGAGGGG + Intronic
915285042 1:154847095-154847117 AGTGAGGGCAGGCAGGGGAGGGG - Intronic
915516506 1:156415877-156415899 GATTAGGGCAGGAGGAGGAGGGG + Intronic
915747592 1:158176624-158176646 GTTGAAGGCAAGCGGTGGAGGGG + Intergenic
915839083 1:159201106-159201128 GAGGAGGGCGGGGGGAGGGGAGG + Exonic
916448984 1:164901615-164901637 GAAGAGGCCAGTGGGAGGAGAGG + Intergenic
916500694 1:165384383-165384405 GATGATGGCAGAGGGAGGAATGG - Intergenic
916509518 1:165459671-165459693 GAAGAGAGGAGGAGGAGGAGGGG - Intergenic
916658749 1:166901508-166901530 GATGAGGGAGGGAAGAGGAGAGG - Intergenic
916715273 1:167442354-167442376 GATGAGGGCAGAGGGAGTGGAGG + Intronic
916874228 1:168951682-168951704 GCTGAGGGAAGGAGGAGGAAAGG + Intergenic
917020927 1:170585928-170585950 CATGGAGGCAGGAGGAGGAGTGG + Intergenic
917231754 1:172845277-172845299 GATGAGTGCAGAGGGAGAAGAGG - Intergenic
917289794 1:173460674-173460696 GAGGAGGGAAGGAGGAGGGGAGG + Intergenic
917517777 1:175722211-175722233 GATAGGGGAAGGAGGAGGAGGGG - Intronic
917791873 1:178504233-178504255 AATGAGAGCAGGAGGAGGTGGGG + Intergenic
917853255 1:179082613-179082635 GATCAGGGGAGGCGGGGGACGGG - Intronic
918006061 1:180543153-180543175 GAAGAGGGGAGGGGGAGGAGGGG + Intergenic
918093717 1:181317925-181317947 AAGGAAGGCAGGCGGAGGTGAGG - Intergenic
918123328 1:181558630-181558652 GAGGGTGGCAGGCGGAGGCGTGG + Intronic
919825817 1:201502399-201502421 GCTGAGGGCAGAGAGAGGAGGGG + Intronic
919942156 1:202295676-202295698 GATGTGGTCAGGCGGAGGCCAGG - Intronic
920243721 1:204572615-204572637 GGTGAGGGCCGGGGGAGGGGTGG + Intergenic
921256050 1:213340661-213340683 GGTGAAGGGAGGCGGGGGAGAGG - Intergenic
921260901 1:213384389-213384411 GATGTGGCCAGGAGGAAGAGGGG + Intergenic
921330566 1:214031479-214031501 GGGGAGGGCGGGCGGAGGAGGGG - Intronic
921575570 1:216830982-216831004 GAAAAGAGCAGGGGGAGGAGAGG + Intronic
921730830 1:218576240-218576262 GGTGAGGGCATGGGGAAGAGGGG + Intergenic
922501258 1:226098616-226098638 GGGGAGGGCAGGGGGAGGGGAGG - Intergenic
922748672 1:228060760-228060782 GCTGTGGACAGGCGGAGGAAAGG - Exonic
922936340 1:229425925-229425947 GATGAGAGGAGGAGGAGGAGGGG + Intergenic
923007948 1:230067191-230067213 GGTGGGGGCCGGGGGAGGAGCGG - Exonic
923052193 1:230396560-230396582 GATGAATGCAGGGGGAGGGGGGG - Intronic
923338878 1:232991418-232991440 GATGGGGGCCTGCGGGGGAGGGG + Intronic
923482363 1:234397280-234397302 GAGTAGGGGAGGCAGAGGAGGGG + Intronic
924223549 1:241902554-241902576 GAAGAGGGGAGGGAGAGGAGAGG + Intergenic
924717457 1:246590485-246590507 GAGGAGGGCAGCAGGAGAAGTGG + Intronic
1062907267 10:1187373-1187395 GATGGGAGCGGGAGGAGGAGGGG - Intronic
1062907280 10:1187408-1187430 GATGGGAGCAGGAGGAGGAGGGG - Intronic
1063129929 10:3169390-3169412 GACAAGGGCAGGAGGAGGAGTGG - Intronic
1063430644 10:5985254-5985276 GATGGGGCCAGGCAGAGGGGAGG + Intergenic
1063570853 10:7213420-7213442 GAAGAGGACAGGCGGAGGTCCGG + Intronic
1063611109 10:7562834-7562856 GATGTGGGCAGGGTGGGGAGAGG + Exonic
1063691890 10:8295591-8295613 AAGGAGGGAAGGAGGAGGAGAGG - Intergenic
1064027393 10:11859876-11859898 GATGAGGGCAGGGGCAGGGATGG - Intronic
1065102592 10:22345584-22345606 GAGGAGGGCAGACGGCGGCGGGG + Exonic
1065695467 10:28375918-28375940 GAGGAGGTCAGTTGGAGGAGTGG - Intergenic
1066361839 10:34738767-34738789 GAAGAGGTCAGGGGGAGGATGGG + Intronic
1066465208 10:35643777-35643799 GAGGAGGGGAAGAGGAGGAGGGG - Intergenic
1067068475 10:43116551-43116573 AATGAGGGAAGGGGGAGAAGAGG - Intronic
1067192236 10:44081473-44081495 GTTGAGAGCAGACTGAGGAGAGG + Intergenic
1067318695 10:45197990-45198012 GAGGGGAGCAGGTGGAGGAGTGG - Intergenic
1067688005 10:48479342-48479364 GATGAGGGAAGGCGGAGGTGTGG + Intronic
1067728972 10:48795241-48795263 TATGAGGTCAGGTGGGGGAGAGG + Intronic
1068783304 10:60944223-60944245 GGTGGGGGCAGGCGAAGGGGAGG - Exonic
1069047606 10:63759585-63759607 GAGGAGGGGTGGTGGAGGAGGGG + Intergenic
1069666324 10:70162493-70162515 GAGGAGGGGAAGGGGAGGAGGGG + Intronic
1069721857 10:70554925-70554947 GGGGAGGGGAGGGGGAGGAGGGG - Intronic
1070553973 10:77514136-77514158 CATCAGGGCAGGCAGAGGGGAGG - Intronic
1070736492 10:78866940-78866962 GGGGAGGGCAGGCAGAGAAGAGG - Intergenic
1070737658 10:78875317-78875339 GATGGGGGCAGGGGGAGTGGAGG + Intergenic
1071209107 10:83317415-83317437 GAGGAGAGCAGAGGGAGGAGTGG + Intergenic
1071601696 10:86961688-86961710 GATGAGGCCAGGGGTATGAGTGG - Intronic
1075015220 10:118905722-118905744 GAGGAATGCAGGCAGAGGAGGGG + Intergenic
1075093990 10:119459227-119459249 GGGGAGGGCAGGCGCAGAAGGGG - Intronic
1075399635 10:122151668-122151690 GAGGAGGGTGGGTGGAGGAGAGG + Intronic
1075442887 10:122493825-122493847 GAGGAGGGGAAGGGGAGGAGGGG - Intronic
1075575200 10:123572760-123572782 GGGGAGGGGAGGAGGAGGAGAGG + Intergenic
1075575206 10:123572776-123572798 GGAGAGGGGAGGAGGAGGAGAGG + Intergenic
1075575212 10:123572792-123572814 GGAGAGGGGAGGAGGAGGAGAGG + Intergenic
1075690403 10:124390184-124390206 GATGACGGGAGGCGGTGGCGTGG - Intergenic
1075726429 10:124613091-124613113 GAGTAGGGCAGGGGGAGGAGGGG + Intronic
1076047601 10:127307361-127307383 GAAGAGGGCAGGCGGGGAAGAGG - Intronic
1076398242 10:130157360-130157382 GATGGGGGTGTGCGGAGGAGAGG + Intronic
1076549705 10:131270547-131270569 CTTGAGGGCAGGTTGAGGAGAGG + Intronic
1076563254 10:131381260-131381282 GCGAAGGGCAGGCTGAGGAGTGG + Intergenic
1076599502 10:131647782-131647804 GAGGAAGGGAGACGGAGGAGAGG - Intergenic
1076778107 10:132709299-132709321 GATGGGGGAAGGAGGGGGAGGGG + Intronic
1076802269 10:132836089-132836111 GAGCAGGGCAGGCGGAGCATGGG - Intronic
1076989940 11:267547-267569 GAGGAGGGGAGGAGGGGGAGGGG + Intergenic
1077015986 11:399392-399414 GGAGGGGGCAGGTGGAGGAGTGG - Intronic
1077274270 11:1696248-1696270 GATCAGGGCAGGCTCAGGACAGG - Intergenic
1077325128 11:1960473-1960495 TCTTAGGGCAGGCGGAGGGGTGG - Intronic
1077531332 11:3097010-3097032 GAAGACGGGAGGGGGAGGAGAGG + Intronic
1077531355 11:3097099-3097121 GAAGATGGGAGGAGGAGGAGAGG + Intronic
1077531364 11:3097131-3097153 GAAGATGGGAGGAGGAGGAGAGG + Intronic
1077896456 11:6457032-6457054 GATGAGGGGTAGGGGAGGAGTGG + Intronic
1078150805 11:8758265-8758287 GATGGGGGTAGGAGGAAGAGGGG - Intronic
1078234733 11:9473696-9473718 GATGAGGTCAAGAGGAAGAGTGG - Intronic
1078273128 11:9815510-9815532 AAAGAGGGCAGGAGGAAGAGAGG + Intronic
1078433063 11:11302446-11302468 GCAGAGGGCAGGAGGAGGAAAGG - Intronic
1078575385 11:12497675-12497697 CCTGAGGGCAGGAGGAGGGGAGG + Intronic
1079375270 11:19886744-19886766 GAAGAAGGCAGGGGGAAGAGAGG + Intronic
1079427136 11:20354388-20354410 GAAGAGGGTAGATGGAGGAGGGG - Intergenic
1079845975 11:25468172-25468194 GAGGAGGGCAGCAGGAGAAGTGG + Intergenic
1080397460 11:31903093-31903115 GAAGAGGGCAGGAGGAGGGAGGG + Intronic
1080802009 11:35618331-35618353 GGGGAGCGGAGGCGGAGGAGGGG + Intergenic
1081484286 11:43515900-43515922 GATCTGGGGAGGCTGAGGAGAGG + Intergenic
1081493175 11:43582369-43582391 AATGAGTGGAGGGGGAGGAGGGG - Intronic
1081534872 11:43989366-43989388 CAGGAAGGCAGGCGGGGGAGGGG - Intergenic
1081626598 11:44659693-44659715 GCTGCGGGGAGGAGGAGGAGAGG + Intergenic
1081687329 11:45052088-45052110 GTGGAGGGCAGGGAGAGGAGGGG + Intergenic
1081997827 11:47376529-47376551 GAGGAGGGAAGGAGGAGGATAGG - Intronic
1082008293 11:47433382-47433404 CAGGAGGGAAGGAGGAGGAGTGG - Intergenic
1082097555 11:48143783-48143805 GGAGAGGGGAGGGGGAGGAGGGG - Intronic
1082097565 11:48143799-48143821 GAGAAGGGGAGGAGGAGGAGAGG - Intronic
1082097579 11:48143832-48143854 GAGAAGGGGAGGAGGAGGAGAGG - Intronic
1083293650 11:61703553-61703575 GGTGAGGGCAGGCAGAGGCCAGG + Intronic
1083306563 11:61764830-61764852 GAGGGCGGCAGGCAGAGGAGTGG + Intronic
1083454862 11:62771758-62771780 GAGGAGAGGAGGCTGAGGAGCGG + Intronic
1083750913 11:64760076-64760098 TTTGAGGGCAAGGGGAGGAGAGG + Exonic
1084033058 11:66492346-66492368 GATTAGGGCAGTCAGAGAAGTGG - Intronic
1084092230 11:66886204-66886226 GAGGGGGGCAGGCAGAGGAGGGG + Intronic
1084104922 11:66975070-66975092 GAGGAGGGGAGGGGGAGGGGAGG + Intergenic
1084198233 11:67538559-67538581 CATGATGGCATGCAGAGGAGAGG - Intergenic
1084289321 11:68151709-68151731 GTGGAGGGCAGGCGGAGAACAGG - Intergenic
1084372126 11:68751206-68751228 GGTGAGGGGCGGCCGAGGAGGGG + Intronic
1084657208 11:70526756-70526778 GAGTAGGGGAGGGGGAGGAGTGG - Intronic
1085202365 11:74709266-74709288 GATGAGGCCTGGATGAGGAGGGG - Intronic
1085229777 11:74956183-74956205 GATGAGGGTAGACAGAGGAGAGG - Intronic
1085882527 11:80484767-80484789 GACCAGAGCAGGCGGATGAGAGG + Intergenic
1086077728 11:82872403-82872425 GATGAGGGCATGCTGGAGAGGGG + Intronic
1086125630 11:83345659-83345681 GATGAGGGCAGGAGGAGTGAGGG + Intergenic
1086536452 11:87852797-87852819 GATGAGGGCAGGAGAAGGAGAGG - Intergenic
1086737926 11:90329925-90329947 AAGGAGGGGAGGGGGAGGAGGGG - Intergenic
1087338954 11:96878374-96878396 GATGAGGGCAGGAGGCAGACAGG - Intergenic
1087474805 11:98622074-98622096 GAGGAGGGGAGGGAGAGGAGGGG - Intergenic
1088570564 11:111219597-111219619 GGGGAGGGGAGGGGGAGGAGAGG - Intergenic
1089257359 11:117200882-117200904 CATGAGGGCAGGTGGAGTGGGGG + Intronic
1089310622 11:117555942-117555964 GAGGAGGGGCGGGGGAGGAGGGG + Intronic
1089603090 11:119626959-119626981 GATGGGGCCAGGGGGAGGTGAGG + Intronic
1089643628 11:119863986-119864008 GATGAGGGCAGGAGGAAGGCAGG - Intergenic
1089705450 11:120274594-120274616 GATGATGGGAGGAGAAGGAGGGG + Intronic
1089768947 11:120788859-120788881 GATGGCAGCAGGTGGAGGAGCGG - Intronic
1089908878 11:122075401-122075423 GATAAGGCCAGGGGGAGGGGAGG + Intergenic
1090020213 11:123121781-123121803 GATGAAAGCAGGTGGAAGAGAGG - Intronic
1090261264 11:125322396-125322418 GAAGAGGACAGGCAGTGGAGGGG - Intronic
1091070515 11:132558415-132558437 GAGGAGGGGAGGAGGAGGAGGGG - Intronic
1091070539 11:132558479-132558501 GAGGAGGGGAGGAGGAGGAGTGG - Intronic
1202808109 11_KI270721v1_random:15652-15674 TCTTAGGGCAGGCGGAGGGGTGG - Intergenic
1091603114 12:1929874-1929896 GAAGAGGGGAGGAGGAAGAGGGG + Intergenic
1091603137 12:1929945-1929967 GAAGAGGGGAGGAGGAAGAGTGG + Intergenic
1091687350 12:2572811-2572833 GAGGAGGGGAGGAGGAGGAGAGG - Intronic
1091768987 12:3139359-3139381 GGTGAGGGGAGGAGGGGGAGGGG - Intronic
1091785005 12:3238031-3238053 GAGGAGGGAAGGAAGAGGAGAGG - Intronic
1092145654 12:6212854-6212876 CATAAGGGCAGGCTGGGGAGAGG - Intronic
1092817320 12:12323089-12323111 GAGGAGGGGAGGGGGAGGGGAGG + Intergenic
1094441719 12:30485459-30485481 GGTGGAGGCAGGAGGAGGAGCGG - Intergenic
1096456673 12:51793102-51793124 GATGAGGGCAAGAGAAGAAGTGG + Intronic
1096781111 12:53992634-53992656 GCTGATGCCAGGGGGAGGAGGGG + Intronic
1096983664 12:55743227-55743249 GAGGAGGGAGGGAGGAGGAGGGG - Intergenic
1096984242 12:55745731-55745753 GTTGAGGGCTGGGGGAGGGGAGG - Intronic
1097037183 12:56131622-56131644 GATGAGGGCAGCCAGTGAAGGGG + Intronic
1097244457 12:57599476-57599498 GATGAGGGAGGGCAGATGAGGGG + Intronic
1097245363 12:57604945-57604967 GGGGAGGGGAGGTGGAGGAGGGG - Intronic
1097872250 12:64610931-64610953 GGCGAGGGAAGGCGGAGGAAGGG + Intronic
1097964429 12:65563622-65563644 GAGGAGGGGAGGAGGAGGAGGGG + Intergenic
1098892698 12:76025756-76025778 GCTGATGGCAGGCTGAGCAGTGG - Exonic
1099177788 12:79441747-79441769 AATGAAGGCAGGGGGAAGAGAGG - Intronic
1100002547 12:89855041-89855063 GATGAGAGCAGGAGCAAGAGAGG + Intergenic
1100233637 12:92635319-92635341 GATTAGGGGATGAGGAGGAGAGG + Intergenic
1101647486 12:106644880-106644902 GAGGAGGGCAGGCCCAGGAAAGG + Intronic
1102023451 12:109699686-109699708 GATGAGGTCAGTGGGAGAAGTGG - Intergenic
1102025910 12:109714264-109714286 GCTCAGAGCAGGAGGAGGAGGGG + Exonic
1102215196 12:111156296-111156318 GATGAGGGCAGGAAGAAAAGGGG - Intronic
1102408793 12:112698909-112698931 GAGAAGGGCGGGGGGAGGAGGGG - Intronic
1102454949 12:113065495-113065517 GGTGAGGGGAGGAGAAGGAGAGG - Intronic
1102637787 12:114339448-114339470 GTGGAGGGCGGGAGGAGGAGAGG + Intergenic
1102792309 12:115657759-115657781 GAGGAGGGGAAGAGGAGGAGAGG - Intergenic
1103080921 12:118023417-118023439 GAGGAGGGGAGGAAGAGGAGGGG + Intronic
1103235384 12:119368193-119368215 GGGAAGGGCAGGAGGAGGAGGGG + Intronic
1103510611 12:121471188-121471210 GATGAGGTCAGACGGAGGGAGGG - Intronic
1103760845 12:123249403-123249425 GAGCAGGGCAGGGGGAGGGGGGG + Intronic
1103825105 12:123731808-123731830 GGGGATGGCAGGAGGAGGAGAGG - Intronic
1104639442 12:130458063-130458085 GAGGAGGGGAGGGGGAGGTGGGG - Intronic
1104639450 12:130458077-130458099 GAAGAGGAGGGGCGGAGGAGGGG - Intronic
1104749900 12:131231764-131231786 GCGGAGGGGAGGAGGAGGAGGGG - Intergenic
1104801055 12:131555560-131555582 GCTGCGGGCAAGCGGAGCAGGGG + Intergenic
1104952424 12:132447535-132447557 GCTGAGGGCAGGCGGAGCGCTGG + Intergenic
1105007287 12:132729420-132729442 GATGAGGGGAGGGGTAGGGGAGG + Intronic
1105010047 12:132749573-132749595 ACTGAGGGCAGGCGGATGACTGG + Intronic
1105223872 13:18409163-18409185 GAGGGGAGCAGGTGGAGGAGTGG + Intergenic
1106092461 13:26609438-26609460 GAAGAGGGGAAGAGGAGGAGGGG - Intronic
1106313807 13:28576578-28576600 GATGAGGTCAGGGGAGGGAGAGG + Intergenic
1106538714 13:30671389-30671411 GATGTGGGCAGGCAGGTGAGAGG - Intergenic
1106620044 13:31364310-31364332 GGTCAGGGCAGGCAGGGGAGGGG - Intergenic
1107740328 13:43443787-43443809 GATCAGACCAGGCGAAGGAGAGG + Intronic
1107758314 13:43649987-43650009 GATGAAGGCATGTGGAGCAGAGG - Intronic
1107778672 13:43875827-43875849 GTTGAAGGCAGGCAGAGGAGTGG - Intronic
1107851642 13:44577345-44577367 GCGGAGCGCAGGAGGAGGAGGGG + Intergenic
1108133706 13:47332483-47332505 CATGGGGGAAGGCGAAGGAGAGG + Intergenic
1108192772 13:47959466-47959488 GAGGAGGGGCGGAGGAGGAGGGG + Intronic
1108667969 13:52652008-52652030 GATGGGGGCAGATTGAGGAGCGG - Intergenic
1112133531 13:96550338-96550360 GATGGTGGAAGGTGGAGGAGGGG - Intronic
1112181974 13:97091929-97091951 GGGGAGGGAAGGAGGAGGAGAGG + Intergenic
1112310381 13:98312903-98312925 AAAGAGGGCAGGAGGAGAAGTGG + Intronic
1112350162 13:98626381-98626403 GGGGAGGGGAGGGGGAGGAGGGG + Intergenic
1112354373 13:98661627-98661649 GGTGAGGGCAGCCTGGGGAGAGG - Intergenic
1113236257 13:108278575-108278597 GAGAAGGGGAGGAGGAGGAGAGG - Intronic
1113523120 13:110954440-110954462 GATTGGGGCAGGCAGAGGACAGG + Intergenic
1113695470 13:112342860-112342882 GCCGAGGGCAGGTGGAGGGGGGG - Intergenic
1113702244 13:112396369-112396391 AATGGGGGCAGGCAGAGGATAGG - Intronic
1113967703 13:114163780-114163802 GCCGAGGGCAGGGGCAGGAGTGG + Intergenic
1114008019 14:18333989-18334011 GAGGGGAGCAGGTGGAGGAGTGG + Intergenic
1114558507 14:23576014-23576036 GATGAGGGCGGGCGGCGCTGCGG + Exonic
1114570894 14:23667518-23667540 GATCAGGGCTGGTGGTGGAGTGG - Intergenic
1114582227 14:23772561-23772583 AAGGAGGCCAGGCGGAGGAGAGG + Intergenic
1114614409 14:24060647-24060669 GACGAGTGCAGGAGGAGGTGCGG + Exonic
1114767315 14:25388561-25388583 GATGAGGGAAAGTGGAGGAGAGG + Intergenic
1115443841 14:33466713-33466735 GATGGGAGCAGGAGGAAGAGAGG + Intronic
1116137055 14:40939648-40939670 GATGAGGGGAGGGGGAGGGATGG - Intergenic
1117127084 14:52640733-52640755 GATAGGGGAAGGTGGAGGAGAGG + Exonic
1117337350 14:54766716-54766738 GCTGAGAGCAGGCGTGGGAGAGG - Intronic
1117473041 14:56065873-56065895 GGTGAGGGCGGGGGGAGGACAGG + Intergenic
1117986778 14:61394486-61394508 AAAGAGGTCAGGAGGAGGAGTGG + Intronic
1118171811 14:63395811-63395833 GAGGAGGAGAGGAGGAGGAGGGG + Intronic
1118500919 14:66361944-66361966 CATGTGGGCAGCCAGAGGAGAGG + Intergenic
1118992315 14:70808654-70808676 GATGAGGGCGGGGGGTGGGGAGG - Intronic
1119029639 14:71181755-71181777 GCCAAGGGCAGGCGGTGGAGGGG - Intergenic
1119432888 14:74579725-74579747 GATTAGTGCAGGCAGAGGACAGG + Intronic
1119438849 14:74614686-74614708 GAAGTGGGCAGGGTGAGGAGCGG - Intergenic
1119593877 14:75916146-75916168 GATGAGGGGAGGAGAGGGAGGGG + Intronic
1119892410 14:78192778-78192800 AAAGAGGGCAGGGGTAGGAGAGG + Intergenic
1120835708 14:89036892-89036914 GGTGGGGGCAGGCAGGGGAGGGG - Intergenic
1120855902 14:89212392-89212414 GATGAAGTCAGGCTGAGGTGAGG + Intronic
1120857585 14:89226105-89226127 GATGGGGGCGGGGGGAGGGGAGG + Intronic
1121030660 14:90655995-90656017 GGAGTGGGCAGGCGGAGGAGTGG - Intronic
1121185578 14:91964860-91964882 GAAGAGGGCATGAGTAGGAGAGG - Intergenic
1121432123 14:93895100-93895122 GAGGAGGGGAGGGGGAGGGGAGG - Intergenic
1121867603 14:97377350-97377372 GAGGAGGGCAAGAGGAAGAGAGG + Intergenic
1122081686 14:99271260-99271282 GATGGGGGGAGCCGGGGGAGGGG + Intronic
1122209395 14:100165347-100165369 GCTGAAGTCAGGGGGAGGAGAGG - Intergenic
1122234403 14:100323664-100323686 GCTGAGGGCAGGCTGGGGATGGG + Intronic
1122418760 14:101562721-101562743 GCTGAGGGCACGCTGGGGAGGGG - Exonic
1122426222 14:101607656-101607678 GAGGAGGAGAGGTGGAGGAGAGG - Intergenic
1122426260 14:101607804-101607826 GAGGAGGAGAGGTGGAGGAGAGG - Intergenic
1122426279 14:101607874-101607896 GAGGAGGAGAGGCGGAGGAGAGG - Intergenic
1122426314 14:101608005-101608027 GAAGAGGAGAGGTGGAGGAGAGG - Intergenic
1122426327 14:101608058-101608080 GAAGAGGAGAGGTGGAGGAGAGG - Intergenic
1122469425 14:101956149-101956171 GATAACAGGAGGCGGAGGAGGGG - Intergenic
1122924648 14:104894059-104894081 GATGAGGGCTAGGGGAGAAGGGG - Intronic
1122975486 14:105169050-105169072 CAGGAGCCCAGGCGGAGGAGGGG - Intergenic
1123049631 14:105534745-105534767 GACGGGGGCAGGAGGAGGAAGGG + Intergenic
1123450855 15:20358113-20358135 GAAGAGGGGAGGAGGAGGGGAGG + Intergenic
1123970359 15:25502783-25502805 ACTGAGGGCTGGAGGAGGAGGGG - Intergenic
1124441459 15:29689006-29689028 GATGAGGGGAGGGGGAAGGGAGG + Intergenic
1124664416 15:31580219-31580241 GTGGAGGGCAGCAGGAGGAGAGG + Intronic
1124720258 15:32105475-32105497 GAGGAGGAAAGGAGGAGGAGAGG + Intronic
1124720576 15:32108089-32108111 ATTGAGGGAGGGCGGAGGAGGGG - Intronic
1125184848 15:36918673-36918695 GATGAGAGCGGGAGGAGGAGAGG + Intronic
1125518198 15:40334616-40334638 GCTGAGGCCTGGAGGAGGAGAGG - Exonic
1125930076 15:43593994-43594016 CAGGCGGGCGGGCGGAGGAGAGG - Intronic
1125943244 15:43693826-43693848 CAGGCGGGCGGGCGGAGGAGAGG - Exonic
1126368797 15:47923855-47923877 GGTGAGGGGAGGTGAAGGAGAGG - Intergenic
1126436753 15:48645282-48645304 GGAGAGGGCAGGCTGAGGAGTGG - Intronic
1127681363 15:61301854-61301876 GATGATGACAGGCTGATGAGTGG + Intergenic
1127798637 15:62458869-62458891 GAGGAGGGCAGAGGTAGGAGAGG - Intronic
1127932993 15:63609723-63609745 CATGAGGACAGGGAGAGGAGAGG - Intronic
1128072560 15:64806837-64806859 GAGGAAGGCAGGCGGAGGAAGGG + Intergenic
1128562166 15:68676035-68676057 GGTGTGGGCAGGTGGAGGGGTGG + Intronic
1128940869 15:71786748-71786770 GAGGAGGGGAGGAGGAGGGGGGG + Intergenic
1128940886 15:71786791-71786813 GAAGAGGGGAGGAGGAGGAGGGG + Intergenic
1129391956 15:75225132-75225154 GGTGAAGGCAGGGAGAGGAGAGG + Intergenic
1129472419 15:75763030-75763052 GGTGAAGGCAGGGAGAGGAGAGG - Intergenic
1129535792 15:76312697-76312719 GAAGAGGGCAGTGGGAGGAGAGG - Intergenic
1129658802 15:77541811-77541833 GAGGAGGGCGGCAGGAGGAGGGG - Intergenic
1129776757 15:78241862-78241884 GATTAGGGAAGGAGGAGGAAGGG + Intronic
1129794920 15:78368879-78368901 GAGGAGGGCAGGCAGAGGTATGG + Intergenic
1129878392 15:78991955-78991977 GATGAGGGGAGGTGGAGGGAAGG + Intronic
1130002528 15:80059851-80059873 GAAGGGAGCAGGCGGGGGAGGGG - Intronic
1130044755 15:80435175-80435197 GACGAGGGCAGGCAGAGGGCAGG - Intronic
1130112481 15:80977194-80977216 TCTGAGGGCAAGAGGAGGAGAGG - Exonic
1130721025 15:86386095-86386117 GGAGAGGGGAGGAGGAGGAGGGG - Intronic
1131146384 15:90016190-90016212 AAGGAGGGTAGGCGGAGGTGGGG + Intronic
1131242325 15:90757609-90757631 GAAGATGGCAGGGTGAGGAGGGG - Intronic
1131513556 15:93063114-93063136 GATGGAGGCAGGCGGAGGGAAGG + Intronic
1131525136 15:93146555-93146577 GGTAGGGGCAGGCGGAGGATGGG - Intergenic
1132053769 15:98633946-98633968 GAGGAGGGAGGGAGGAGGAGGGG - Intergenic
1132092731 15:98959017-98959039 TGTGAGGGCAGGCTGGGGAGAGG - Exonic
1132420984 15:101668328-101668350 GAATAGGGAAGGCTGAGGAGAGG + Intronic
1132520303 16:384186-384208 GGGGAGGGCAGTGGGAGGAGGGG - Intronic
1132817534 16:1839650-1839672 AAGGAGGGCAGGCAGAGGACTGG - Exonic
1132837946 16:1964124-1964146 GTTGCGGGCTGGCTGAGGAGAGG - Intronic
1133520134 16:6549139-6549161 GAGGAGGGAAGGAGGAGGGGGGG + Intronic
1133520209 16:6549330-6549352 GAGGAGGGGTGGAGGAGGAGGGG + Intronic
1133520218 16:6549352-6549374 GAGGAGGGAAGGAGGAGGAGGGG + Intronic
1133520284 16:6549533-6549555 GAGGAGGGGAGGAGGAGGATGGG + Intronic
1133620638 16:7522986-7523008 GATGAGGCAAGGAGGAGGAGGGG - Intronic
1133770508 16:8864898-8864920 CATGCGGGCAGGCTGAGCAGGGG - Intronic
1134634812 16:15784241-15784263 GATGATGGCAGGGAGAGAAGAGG + Intronic
1135724053 16:24840936-24840958 GAGGAGGGGAGGAGGGGGAGGGG + Intergenic
1137429901 16:48410273-48410295 GATGAGGAAGGGCGGATGAGAGG - Intronic
1137578964 16:49621878-49621900 GAACAGGGCAGGGGGAGAAGAGG - Intronic
1138229682 16:55327835-55327857 GAGGAAGGCAGAGGGAGGAGAGG + Exonic
1138577140 16:57915256-57915278 CAGCGGGGCAGGCGGAGGAGGGG + Exonic
1138652653 16:58470318-58470340 GAAAAGGCCAGGAGGAGGAGTGG + Intronic
1139355437 16:66364654-66364676 CATGAGGACAGGCGGGGGTGAGG + Intergenic
1139653081 16:68372265-68372287 GTTGGGGGCAGCTGGAGGAGGGG + Exonic
1139664989 16:68448857-68448879 GAGGATGGCTGGCGGAGGCGTGG + Intergenic
1139944177 16:70627453-70627475 GGGGAGGGAAGGGGGAGGAGGGG - Intronic
1140139216 16:72238935-72238957 GCTGAGGGGAGGCAGAGGAGGGG - Intergenic
1140244831 16:73238726-73238748 GAAGAGAGCAGGCGAGGGAGAGG - Intergenic
1140928028 16:79601137-79601159 GTGGAGGGCAGGCAGGGGAGGGG - Intergenic
1141477482 16:84283570-84283592 GGTGAGGGCAGGTGGGGGAGAGG + Intergenic
1141571586 16:84937281-84937303 GAGGAGGGCGGGAGGAGGTGGGG - Intergenic
1141584135 16:85021795-85021817 GGGGAGGGGAGGAGGAGGAGAGG + Intergenic
1141637284 16:85321006-85321028 GATGGGGGCAGGGGGCGCAGAGG - Intergenic
1141651729 16:85396507-85396529 GGTGTTGGCAGGCAGAGGAGCGG - Intergenic
1141673154 16:85503359-85503381 GCTGAGGGCAGGTGGAGGCTGGG - Intergenic
1141894986 16:86953644-86953666 GAGCTGGGCAGGCGGGGGAGTGG - Intergenic
1141912416 16:87068957-87068979 GGTGAGAGCACGCGCAGGAGAGG + Intergenic
1141915212 16:87091788-87091810 GATGAGGGCAGGTGGGAGAGAGG - Intronic
1141942512 16:87286962-87286984 GAGGAGGGAAGGGAGAGGAGCGG + Intronic
1142205318 16:88780110-88780132 GACGGGGGCAGGCAGAGGGGTGG - Intronic
1142290584 16:89192140-89192162 GAGGAGGGCAGGCGAAGTGGGGG + Intronic
1142481160 17:219022-219044 GAGGAGGGCAGGCAAAGGACAGG - Intronic
1142707018 17:1701761-1701783 GAGGGGGGCGGGCGGAGGGGAGG + Intergenic
1142808617 17:2384939-2384961 GAGGTGGGCAGGCTGAGGGGAGG + Exonic
1142808890 17:2386144-2386166 CAGGAGGGCAGGCTGAGGTGGGG - Exonic
1143115847 17:4581574-4581596 GCTGGGGGCAGGCGGAGAAGTGG + Intergenic
1143141985 17:4745914-4745936 GGTGGGGGCAGGAGGAGCAGAGG - Exonic
1143374374 17:6458624-6458646 GGTGGGGGCTGGCGGAGAAGTGG - Intronic
1143563308 17:7707695-7707717 GGTGAGGGCGGGCTGAAGAGTGG + Intronic
1143619834 17:8074458-8074480 GGTGAGGGGAGGAGGAGGGGAGG - Intronic
1143704491 17:8687436-8687458 GGGGAGGGGAGGGGGAGGAGAGG - Intergenic
1143762700 17:9116486-9116508 AAAGAGGGCAGGGAGAGGAGGGG - Intronic
1143766815 17:9143251-9143273 GATGGCAGCAGGGGGAGGAGTGG + Intronic
1144899176 17:18568500-18568522 GATGGAGGCAGGCGGAGGGAAGG - Intergenic
1145017609 17:19409416-19409438 GATGCGGGGAGGGTGAGGAGGGG - Intergenic
1145250478 17:21294394-21294416 TATGAGTGGAGGCGGAGCAGGGG + Intronic
1145891967 17:28423428-28423450 GGTGAGGGGAGGCAGAGAAGAGG - Intergenic
1145991368 17:29081044-29081066 GATGAGGGCAGCAGGGAGAGAGG + Intronic
1146176384 17:30668408-30668430 GAGGGGGGCAGGCGGGGGTGGGG + Intergenic
1146349844 17:32084522-32084544 GAGGGGGGCAGGCGGGGGTGGGG + Intergenic
1146911324 17:36650207-36650229 GAGGAGGGCATGTGGAGGAGGGG + Intergenic
1146955812 17:36935931-36935953 GAAGAGGGAAGGAGGAGGGGGGG - Intergenic
1147361523 17:39933795-39933817 GAGGAGGGGAGGAGTAGGAGTGG - Intergenic
1148035529 17:44656738-44656760 GAGGAGGAGAGGCTGAGGAGGGG + Intronic
1148342478 17:46881576-46881598 GATGAGGGCAGGAGGAGGTGAGG - Intronic
1148405991 17:47416575-47416597 GAGGAGGGGAGGGGGAGAAGGGG - Intronic
1148694855 17:49552628-49552650 TGTGGGGGCAGGCGTAGGAGAGG - Intergenic
1148785796 17:50145669-50145691 GAAGAGGGGAAGAGGAGGAGGGG + Intronic
1149044149 17:52225013-52225035 GATGAGGGCAGGCTAAGGCGAGG - Intergenic
1149056315 17:52370809-52370831 GAGAATGGCAGGGGGAGGAGTGG + Intergenic
1149806267 17:59620288-59620310 GATTGGGGTAGGTGGAGGAGGGG + Intronic
1150089447 17:62310043-62310065 GAGGAGGAGAGGAGGAGGAGGGG - Intergenic
1150224165 17:63513937-63513959 CGTGAGGGCAGGCTGGGGAGTGG - Intronic
1150364856 17:64573204-64573226 GAGGAGGGGAGGAGGAGGGGAGG + Intronic
1150364861 17:64573215-64573237 GAGGAGGGGAGGAGGAGGAGGGG + Intronic
1150501301 17:65653451-65653473 GAAGGGGGCAGGAGGAGGGGAGG + Intronic
1151346801 17:73507360-73507382 GAAGAGGGCATGGTGAGGAGGGG - Intronic
1151353128 17:73543224-73543246 GGGGAGGGGAGGAGGAGGAGAGG + Intronic
1151356650 17:73562573-73562595 GAAGAAGGCAGGCGTGGGAGGGG + Intronic
1151507597 17:74539712-74539734 GCTGGAGGCAGGCAGAGGAGTGG - Intergenic
1151540410 17:74761933-74761955 GATGGGGACAGGCAGAGGACAGG + Intronic
1151626273 17:75277801-75277823 GATGGGGGCAGGGGGAGGCTGGG - Intronic
1151655810 17:75495471-75495493 GTGGTGGGCAGGCGGTGGAGGGG + Intronic
1151980895 17:77507848-77507870 GATGGGGGCTGGATGAGGAGAGG - Intergenic
1152114253 17:78375208-78375230 GGTGAGGGCAGGAGGGCGAGGGG + Intergenic
1152301086 17:79495576-79495598 GATGTGGGAAGGTGGGGGAGGGG + Intronic
1152301423 17:79497142-79497164 CATGGGGCCAGGGGGAGGAGTGG - Intronic
1152532541 17:80927818-80927840 GATGAGGGCAGGCGGAGGAGGGG - Intronic
1152610224 17:81311683-81311705 GATGAGGGCAGGGAGAGGTGGGG + Exonic
1152793227 17:82293224-82293246 GAGGAGGGCAAGGGGAGGGGAGG + Intergenic
1152794780 17:82301578-82301600 GTTGAGGGCAGGGGCAGGGGTGG + Intergenic
1152864255 17:82712847-82712869 GATGACGGCAGGAGGCAGAGAGG - Intergenic
1153015909 18:582546-582568 TCTGAGGGCAGGGGAAGGAGGGG + Intergenic
1153224088 18:2884737-2884759 GCTCAGGGCAGGTGGAGGATTGG + Intronic
1154358874 18:13642680-13642702 GATGAGGGCAGGCTGGGTTGAGG - Intronic
1154475297 18:14748733-14748755 GAGGGGAGCAGGTGGAGGAGTGG + Intronic
1154529433 18:15329951-15329973 GAGGGGAGCAGGTGGAGGAGTGG - Intergenic
1156076731 18:33288218-33288240 GCGGAGGGGAGGAGGAGGAGAGG - Intronic
1156231185 18:35155410-35155432 GATGGGGGTGGGTGGAGGAGGGG + Intergenic
1156424599 18:36996641-36996663 GATGAGGGCAGTAGGAGGAAGGG + Intronic
1156539427 18:37894830-37894852 GATCAGAGCTGGAGGAGGAGGGG + Intergenic
1157220207 18:45824110-45824132 GGTGGGGGCAGGTGAAGGAGGGG + Intergenic
1157496732 18:48161885-48161907 GATGTGAGAATGCGGAGGAGAGG - Intronic
1157675584 18:49566230-49566252 GTTGAGGTCAGGGGCAGGAGAGG + Intronic
1158319650 18:56248892-56248914 GAGGGGGGCAGGGGGAAGAGTGG + Intergenic
1158505609 18:58044198-58044220 GGTGGGAGGAGGCGGAGGAGGGG + Intergenic
1158610392 18:58935174-58935196 GGAGAGGGGAGGAGGAGGAGTGG - Intronic
1158610398 18:58935190-58935212 GGAGAGGGGAGGAGGAGGAGAGG - Intronic
1158938227 18:62384465-62384487 GAGGGGGGAAGGGGGAGGAGAGG - Intronic
1158951511 18:62499567-62499589 GAAGGGGGAAGGAGGAGGAGGGG - Intergenic
1159029699 18:63218606-63218628 GATGAGTGGAGGGGGATGAGTGG - Intronic
1159609173 18:70507556-70507578 CATGTGGGCAGGCAGAGGAAAGG - Intergenic
1159850954 18:73526869-73526891 GAAGAGGAGAGGAGGAGGAGGGG - Intergenic
1160387516 18:78505479-78505501 GATGAGGGAAGGCCAGGGAGAGG + Intergenic
1160529985 18:79557105-79557127 GACGAGGAAAGGCTGAGGAGAGG + Intergenic
1160816751 19:1039618-1039640 GAGGATGGCAGGAGGGGGAGGGG - Intergenic
1160953614 19:1679395-1679417 GATGAAGGCAGGCGCAGGAAGGG + Intergenic
1161022235 19:2015778-2015800 GAGGAGAGTAGGGGGAGGAGGGG + Intronic
1161055799 19:2190158-2190180 GATGAAGGCAGGCGGTGTGGGGG - Intronic
1161142995 19:2659784-2659806 GATGAGGGAAGGAAGAGGAAAGG + Intronic
1161330105 19:3682932-3682954 GGGGAGGGGAGGGGGAGGAGGGG - Intronic
1161503828 19:4633236-4633258 GAGGAGGGGAGGGGAAGGAGGGG + Intergenic
1161637105 19:5395775-5395797 GAGGAGGGCGGGGGGAGGAAGGG + Intergenic
1161694398 19:5757979-5758001 GATAAGGGAAGGAGGAAGAGGGG - Intronic
1161764559 19:6199565-6199587 GAGGCGCGCAGGCGCAGGAGGGG - Intronic
1161792646 19:6369644-6369666 GCTGAGGGAAGGTGGAAGAGAGG + Intergenic
1161839367 19:6669811-6669833 GCTGAGAGCAGGTGGAGGTGAGG - Intronic
1162038124 19:7953424-7953446 GAGGAGAGGAGGGGGAGGAGGGG - Intergenic
1162038177 19:7953562-7953584 GAGGAGAGAAGGAGGAGGAGGGG - Intergenic
1162237719 19:9321757-9321779 GAGGAGGGCGGGGGGAGGAGGGG - Intergenic
1162292959 19:9792715-9792737 GGTGAGGGGAGACGGAGGCGGGG - Intronic
1162292985 19:9792798-9792820 GGTGAGGGGAGACGGAGGCGGGG - Intronic
1162789654 19:13056181-13056203 CAGGCGGGCAGGGGGAGGAGCGG + Intronic
1162823513 19:13237256-13237278 GGTGAAGGCAGGAGGAGTAGAGG + Intronic
1162982441 19:14248489-14248511 GAGGGGGGCAGGCGGGGGTGGGG - Intergenic
1162982495 19:14248626-14248648 GAGGAGGGCGGGCTGGGGAGGGG - Intergenic
1163061229 19:14763755-14763777 GAGGAGAGGAGGAGGAGGAGAGG - Intronic
1163061244 19:14763822-14763844 GAGGAGAGAAGGAGGAGGAGAGG - Intronic
1163149710 19:15403746-15403768 GGTGGGGGCAGGCAGAGGGGAGG + Intronic
1163347951 19:16756369-16756391 GAAGAGGGGAGGAGGAGAAGGGG + Intronic
1163387947 19:17011689-17011711 GCGGCTGGCAGGCGGAGGAGGGG - Exonic
1163779624 19:19239617-19239639 GGGGAGGGAAGGGGGAGGAGAGG - Intronic
1164149709 19:22540789-22540811 GAAGAGGAGAGGAGGAGGAGAGG + Intergenic
1164234946 19:23323647-23323669 GAAGAGGAAAGGAGGAGGAGAGG - Intronic
1164249581 19:23465452-23465474 GATGAGAGGAGGAGGAAGAGAGG - Intergenic
1164249649 19:23465834-23465856 GAGGAGAGGAGGAGGAGGAGAGG - Intergenic
1164249658 19:23465878-23465900 GATGAGGAGAGGAGGAGGAGAGG - Intergenic
1164324591 19:24180448-24180470 GAGGAGAGCAGGAGGAAGAGAGG + Intergenic
1164518006 19:28952852-28952874 CATGATGGCAGTAGGAGGAGGGG + Intergenic
1164680387 19:30130707-30130729 GAGGAGGGAGGGAGGAGGAGAGG - Intergenic
1164718641 19:30415069-30415091 GAAGAGAGCAGGAGGAGGAGGGG - Intronic
1164856849 19:31531479-31531501 GTTGAGGGCAGGGGGCAGAGAGG - Intergenic
1165245590 19:34496719-34496741 AGTGAGGGCAGGGGGAAGAGGGG + Intronic
1165456189 19:35912174-35912196 GAGGAGGACAGGCTGTGGAGGGG - Intergenic
1165602134 19:37063546-37063568 GGTGGGGGTAGGCGGGGGAGGGG - Intronic
1165757225 19:38300974-38300996 GATGAGGGAGAGGGGAGGAGAGG - Intronic
1165856438 19:38881363-38881385 GAGGGGGTCAGGGGGAGGAGGGG + Intronic
1166302751 19:41921681-41921703 GATTAGGGCAGAGGCAGGAGAGG + Intronic
1166959531 19:46489356-46489378 GAGGAGGGCCGGGGCAGGAGAGG - Intronic
1167108655 19:47446239-47446261 GAAGAGAGCGGGCAGAGGAGGGG + Intronic
1167130509 19:47582231-47582253 GAGGAGGGGAGGAGGAGGACAGG - Intergenic
1167130538 19:47582318-47582340 GAGGAGGGAAGGAGGAGGGGAGG - Intergenic
1167571737 19:50292895-50292917 GGTGAGGGGGGCCGGAGGAGGGG + Intronic
1167608157 19:50492754-50492776 GAGGAGGAAAGGGGGAGGAGGGG + Intergenic
1167608185 19:50492849-50492871 GAGGAGGAAAGGGGGAGGAGGGG + Intergenic
1167725916 19:51212414-51212436 GGTGAGGTCAGGATGAGGAGAGG - Intergenic
1167765597 19:51480155-51480177 GCTGAGGGGAGGCACAGGAGGGG + Intronic
1167773699 19:51541176-51541198 GGTGAGGACAGACGGAGAAGTGG - Intergenic
1168357705 19:55712833-55712855 GAAGAGGGGAGGAAGAGGAGTGG + Intronic
1202702493 1_KI270712v1_random:175069-175091 GATGAAGGCAAGCAGAAGAGAGG - Intergenic
925039160 2:716805-716827 GATGAGGGGAGGAGGAGGGGAGG + Intergenic
925151080 2:1615245-1615267 GATGAGAGAAGGGGGGGGAGGGG - Intergenic
925633861 2:5923407-5923429 GTTGGGGGCAGGCTGGGGAGGGG - Intergenic
925909931 2:8567177-8567199 GGTGGGGGCAGGTGGAGGAAGGG - Intergenic
925929335 2:8694258-8694280 GATGGGGGCTGGTGGGGGAGAGG + Intergenic
925937117 2:8774720-8774742 GATGAGGTCAGAAGGAGGAAGGG + Intronic
926010030 2:9400245-9400267 GAAGAGGGCAGGAGGGGAAGGGG - Intronic
926036189 2:9637804-9637826 GGTTAGGGCAGGAGGGGGAGAGG - Intergenic
926094549 2:10072841-10072863 GAGCAGTGCAGGTGGAGGAGCGG + Intronic
926116546 2:10217357-10217379 GGTGAGGGCTGGAGGGGGAGCGG - Intergenic
926137060 2:10343820-10343842 GATGAGGGCAGAAAGAGAAGAGG + Intronic
926610408 2:14941082-14941104 GATGAGGGCAGGATAGGGAGGGG + Intergenic
926972047 2:18475937-18475959 GAGGAGGGAAGGCGGGGGAAGGG + Intergenic
927187344 2:20491290-20491312 GGGGAGGGCCGGCGGAGAAGTGG - Intergenic
927533941 2:23837258-23837280 GATCGGAGCAGGCGCAGGAGTGG + Intronic
927694573 2:25231187-25231209 CAGGAGGGCTGGGGGAGGAGGGG - Exonic
927943191 2:27118650-27118672 CCTGAGGGCAGGTGGAGGAAGGG - Intronic
928019978 2:27696695-27696717 TGTGAGGGTAGGGGGAGGAGTGG - Intergenic
928108460 2:28488204-28488226 GGGGAGGGGAGGGGGAGGAGGGG + Intronic
929945722 2:46370353-46370375 GAGGAGGGCAGGGGGAGTTGAGG + Intronic
930030372 2:47055004-47055026 GATGATGGCAGCCAGGGGAGGGG - Intronic
930752234 2:54945155-54945177 AAAGAGGGGAGGGGGAGGAGGGG - Intronic
930826330 2:55700301-55700323 GCTGAGGGGAGGGGGAGGGGAGG - Intergenic
931177765 2:59870750-59870772 CATGAGCACAGGGGGAGGAGGGG - Intergenic
931962294 2:67495299-67495321 GAGGAAGGGAGGTGGAGGAGAGG + Intergenic
932137698 2:69245301-69245323 GATGGGGGCAGGAGGCGGCGAGG - Exonic
932369893 2:71178252-71178274 GATCTGGACAGGCAGAGGAGAGG - Intergenic
932435511 2:71700673-71700695 GGTGGGGGGAGGCGGGGGAGGGG + Intergenic
932463413 2:71897856-71897878 GCTGAGGGCAGCAGGAGGGGTGG + Intergenic
933979460 2:87538547-87538569 GCAGAGGGCAGGGGGACGAGGGG - Intergenic
934122847 2:88856904-88856926 TATGAGGGCTTGCTGAGGAGGGG + Intergenic
934144416 2:89077506-89077528 GGTGGGGGGAGGTGGAGGAGGGG + Intergenic
934173404 2:89558522-89558544 GATGAAGGCAAGCAGAAGAGAGG - Intergenic
934224835 2:90123043-90123065 GGTGGGGGGAGGTGGAGGAGGGG - Intergenic
934230913 2:90181146-90181168 GAGGGGGGGAGGTGGAGGAGGGG - Intergenic
934283719 2:91632875-91632897 GATGAAGGCAAGCAGAAGAGAGG - Intergenic
934765794 2:96879399-96879421 GATGAGGGCAGGGGAAGCTGGGG - Intronic
934969141 2:98748990-98749012 CATGAGGGCAGGGGTGGGAGTGG - Intergenic
935263441 2:101374828-101374850 GATGGAGGCTGGGGGAGGAGTGG + Intronic
935387644 2:102517457-102517479 AATGAGGGCAGACTGAAGAGAGG + Intronic
935558830 2:104540377-104540399 GAGGGGGGCAGGGAGAGGAGTGG - Intergenic
935622793 2:105144022-105144044 GAGGAGGACGGGAGGAGGAGGGG - Intergenic
935695284 2:105766131-105766153 AATGAGGGGAGGCGCAGGTGGGG + Intronic
936314363 2:111412244-111412266 GCAGAGGGCAGGGGGACGAGGGG + Intergenic
936371266 2:111904149-111904171 TATGGGGGCAGGAGTAGGAGGGG - Intronic
936520599 2:113210035-113210057 GAGGAGTGGAGGCGGGGGAGGGG - Intergenic
936521536 2:113214862-113214884 GGTGAGGGCAGGTGGGAGAGGGG + Intergenic
937794380 2:125999576-125999598 GATGAGAGCCTGCAGAGGAGTGG + Intergenic
937981833 2:127620288-127620310 GCTGGGGGCTGGAGGAGGAGAGG - Intronic
938242343 2:129753091-129753113 GATGAGGGAAAGCGGAGAGGAGG - Intergenic
938262001 2:129903154-129903176 AATGAGGGGATGGGGAGGAGGGG - Intergenic
938528531 2:132161373-132161395 GAGGGGAGCAGGTGGAGGAGTGG - Intronic
939002588 2:136753596-136753618 GAAGGGGGCAGTAGGAGGAGAGG - Intergenic
939618392 2:144386911-144386933 GGGGGGGGCAGGGGGAGGAGTGG - Intergenic
940322226 2:152389681-152389703 GCGGAGAGCAGGAGGAGGAGCGG + Intronic
940650551 2:156436317-156436339 GAAGAGGGAAGGCGGGGGCGCGG + Intronic
941589634 2:167403606-167403628 GATGATGGCATGAGGAGTAGTGG + Intergenic
941642894 2:168008189-168008211 GATGAGGACAGGCTGAAGGGAGG + Intronic
942482266 2:176402474-176402496 GACTAGGGCAGGAGGTGGAGAGG - Intergenic
942611536 2:177747008-177747030 GAAGTGGGCAGGCACAGGAGAGG + Intronic
942848261 2:180452647-180452669 AATGAAGGGAGGCAGAGGAGGGG + Intergenic
942875607 2:180793150-180793172 GATGAGGGGAGGTGAAGAAGGGG - Intergenic
943208279 2:184928467-184928489 GGTTAGGGGAGGGGGAGGAGTGG + Intronic
943524002 2:188994094-188994116 GATGAGATAAGGCTGAGGAGTGG - Intronic
943567581 2:189534682-189534704 GAAGAGGGCAGGTGAAGGTGGGG - Intergenic
945869721 2:215214004-215214026 GATGAGAGAAGGAGGAGAAGAGG + Intergenic
946027631 2:216681388-216681410 AGTGAGGGCAGGTGGGGGAGTGG + Intronic
946177936 2:217933237-217933259 GAGGAGGGCAAACGGAGGGGCGG + Intronic
946178326 2:217935423-217935445 GGTGGGGGCTGGGGGAGGAGAGG - Intronic
946324936 2:218980466-218980488 GCTGAGGGAAGGCTGAGGTGGGG + Intergenic
946750681 2:222893197-222893219 GATGAGGACAGGGGGAAGAGAGG - Intronic
946859262 2:223984829-223984851 GATGATGGCAGACAGCGGAGTGG + Exonic
946913998 2:224496698-224496720 CATGGGGGCTGGGGGAGGAGGGG + Intronic
947497756 2:230650811-230650833 GGTGGGGACAGGCAGAGGAGAGG + Intergenic
947854100 2:233311642-233311664 GATGGGGGCAGGTAGAGAAGTGG - Intronic
947914612 2:233823225-233823247 TATGAGGGCAGAAAGAGGAGGGG + Intronic
947983730 2:234431060-234431082 GATGATGGGAGGAGGAGAAGAGG + Intergenic
948027406 2:234789231-234789253 GACCAGGGCAGGCAGGGGAGGGG - Intergenic
948139331 2:235661221-235661243 GAGATTGGCAGGCGGAGGAGAGG + Intronic
948207512 2:236170012-236170034 GAGGAGGCGAGGAGGAGGAGAGG - Intergenic
948266359 2:236637931-236637953 GAGGAGGGAAGGAGGTGGAGAGG - Intergenic
948440241 2:237982316-237982338 GATGTGGTAGGGCGGAGGAGTGG - Intronic
948458812 2:238119415-238119437 GAGGAGGGTAGATGGAGGAGGGG + Intronic
948458816 2:238119429-238119451 GAGGAGGGGAGGTGGAGGAGAGG + Intronic
948458867 2:238119597-238119619 GAGGAGGGGAGCTGGAGGAGGGG + Intronic
948600722 2:239106193-239106215 GCTGAGGGCGGGCGGAGGAGCGG + Intronic
948856291 2:240732064-240732086 GAGGAGGGAAGGAGGAAGAGGGG + Intronic
948856321 2:240732138-240732160 GATGAGGGATTGGGGAGGAGGGG + Intronic
1168798520 20:628611-628633 CATGAAGGCAGGCAGAGTAGTGG + Intergenic
1172153318 20:32806033-32806055 GGAGAGGGCAGGCGCGGGAGAGG - Intronic
1172240268 20:33408399-33408421 GCTGAGGGAAGGGAGAGGAGAGG - Exonic
1172303504 20:33865671-33865693 GGTGGGGGCAGGTGAAGGAGAGG + Intergenic
1172557721 20:35856978-35857000 GTTGAGGACTGGCGGTGGAGGGG + Intronic
1172577056 20:36017585-36017607 GAACAGGGCAGGGAGAGGAGAGG - Intronic
1172600106 20:36177522-36177544 GAAGCGGGCAGGGGGAGAAGGGG - Intronic
1172608201 20:36229994-36230016 GGTGAGGGGAGGCGGGAGAGAGG - Exonic
1173002079 20:39111732-39111754 GAAAAGGGGAGGAGGAGGAGGGG + Intergenic
1173137986 20:40457374-40457396 GAGGAGGGCAGGCTAAGGGGAGG - Intergenic
1173255464 20:41391683-41391705 CATGAGGGCAGGAGGTGGCGGGG + Intergenic
1173481893 20:43407848-43407870 GACCAGAGCAGGGGGAGGAGAGG - Intergenic
1173581457 20:44149603-44149625 GAAGAGGGCAGAAGGAGGTGGGG - Intronic
1173759276 20:45545588-45545610 GGTGAGGACAGGGGGAGGAGGGG + Intronic
1173855910 20:46250852-46250874 GAGGAGGGCATGGGGCGGAGTGG + Intronic
1173869550 20:46332782-46332804 GAGGAGGGCTAGAGGAGGAGAGG - Intergenic
1174106654 20:48167026-48167048 GCTGAGGGAAGGCGAAGGAAGGG - Intergenic
1174317116 20:49712452-49712474 GCTTGGGGCAGGCGGGGGAGGGG + Intronic
1174396188 20:50248196-50248218 CATCAGGGCAGGCCAAGGAGGGG - Intergenic
1174485689 20:50859739-50859761 GAGGGGGGCAGGAGGAGGTGGGG + Intronic
1174539071 20:51275110-51275132 GGTGAGGGCGGGGGGTGGAGGGG + Intergenic
1174960513 20:55151750-55151772 GGGGAGGGGAGGGGGAGGAGCGG - Intergenic
1175119539 20:56707558-56707580 GAGGACGGCAGGCGGGGGATGGG + Intergenic
1175221734 20:57421211-57421233 AATGAGTGCAGGTGGAGGAGAGG + Intergenic
1175402980 20:58711109-58711131 GAGGAGGAGAGGGGGAGGAGGGG - Intronic
1175442726 20:59002602-59002624 GAGGAGGCCAGGTGGAGGAGCGG - Intronic
1175644047 20:60656534-60656556 GCTGTGGGCAGGCAGATGAGAGG + Intergenic
1175724522 20:61308746-61308768 GATGATTGCAGGCGGAGGAGAGG + Intronic
1175779454 20:61673060-61673082 GATGAAGGCAGGACCAGGAGTGG + Intronic
1175815581 20:61881648-61881670 GCAGAGGGCAGGAAGAGGAGGGG + Intronic
1176063130 20:63180884-63180906 GGTGTGAGCAGGAGGAGGAGAGG - Intergenic
1176075864 20:63247967-63247989 GTCGAGGGCAGGCGCAGGAGCGG - Intronic
1176177213 20:63734404-63734426 GAGAAGGGCAGGGGCAGGAGAGG + Intronic
1176767965 21:13038517-13038539 GAGGGGAGCAGGTGGAGGAGTGG + Intergenic
1177047051 21:16183826-16183848 GAGGAGGGCAGGGGGTGGAGGGG - Intergenic
1179520666 21:41942266-41942288 GAGGAGGGCATGCACAGGAGGGG + Intronic
1179553181 21:42156236-42156258 GACCAGGGTGGGCGGAGGAGGGG + Intergenic
1179714299 21:43279874-43279896 GTCGAGGGCAGGTGGAGGGGAGG + Intergenic
1179922514 21:44514807-44514829 TTTGAGGGCAGGCGGAAGAATGG + Intronic
1179955386 21:44735389-44735411 AATCACGGCAGGCGGAAGAGCGG + Intergenic
1180432526 22:15264799-15264821 GAGGGGAGCAGGTGGAGGAGTGG + Intergenic
1180515097 22:16132779-16132801 GAGGGGAGCAGGTGGAGGAGTGG + Intergenic
1180920416 22:19518754-19518776 GTGGAGGGCAGGCAGCGGAGGGG + Intronic
1180935374 22:19622028-19622050 GAGGAGGGCAGGCGGGGCACGGG - Intergenic
1180949526 22:19714878-19714900 GGTGAGGGCCGGCGGGGGCGGGG - Intronic
1181278115 22:21699462-21699484 GTGGAGGGCAGGTGGATGAGTGG + Exonic
1181306726 22:21921333-21921355 GAGCAGTGCAGGGGGAGGAGAGG - Exonic
1181463390 22:23098257-23098279 GATAAGGGCAGGGGTACGAGAGG - Intronic
1181548258 22:23617780-23617802 GAAGAGGGATGGCAGAGGAGGGG + Intronic
1181548727 22:23622317-23622339 GAAGAGGGATGGCAGAGGAGGGG + Intronic
1181584568 22:23845967-23845989 GATGAGGACAGGAGGAGGAGGGG + Intergenic
1181635508 22:24172541-24172563 GATGAGGGCAGGGGCAGGTCAGG + Intronic
1181639661 22:24189960-24189982 GGTGCGGGGAGGCGGAGGGGTGG - Intergenic
1181799943 22:25339727-25339749 GAAGAGGGATGGCAGAGGAGGGG - Intergenic
1182065119 22:27425557-27425579 GGAGAGGGCAGGAGAAGGAGTGG - Intergenic
1182520711 22:30883123-30883145 GATGAGGGAGGGCGGGGCAGAGG + Intronic
1182551895 22:31105123-31105145 GATGCGCTGAGGCGGAGGAGGGG + Exonic
1182689972 22:32152775-32152797 GTTGAGGGAAGGCAAAGGAGAGG + Intronic
1183108338 22:35630299-35630321 GAGGAGGGAAGGAGGCGGAGGGG + Intronic
1183108352 22:35630333-35630355 GAGGGGGGGAGGAGGAGGAGGGG + Intronic
1183108358 22:35630347-35630369 GAGGAGGGGAGGAGGAGGGGAGG + Intronic
1183303658 22:37070658-37070680 GATGGGGGCAGGTGGTGGGGTGG + Intronic
1183601753 22:38844052-38844074 GAAGACGGCAGGCGGCGGGGAGG + Intergenic
1183727617 22:39598280-39598302 GATGAGGGCAGGGCGGGGCGGGG - Intronic
1183736380 22:39647031-39647053 GGAGAGGGCAGGCAGAGGTGGGG - Intronic
1183782393 22:40007245-40007267 GAGGAGGAAAGGAGGAGGAGAGG - Intronic
1183782421 22:40007371-40007393 GAAGAGGAGAGGAGGAGGAGAGG - Intronic
1183782451 22:40007498-40007520 GAGGAGGACAGGAGGAGGAGAGG - Intronic
1183782460 22:40007533-40007555 GAGGAGGAGAGGAGGAGGAGAGG - Intronic
1183782495 22:40007707-40007729 GAGGAGGACAGGAGGAAGAGAGG - Intronic
1184088219 22:42278636-42278658 GCTGAGGGAATGCTGAGGAGAGG + Intronic
1184235136 22:43179294-43179316 GATGAGGACAGGGGGCTGAGTGG + Intronic
1184390857 22:44202320-44202342 GAGGAGAGAAGGCGGAGGAAGGG + Intronic
1184697703 22:46149486-46149508 GCGGAGGGCAGGCAGTGGAGCGG + Intergenic
1184768811 22:46586418-46586440 GGGGAGGGCAGACAGAGGAGGGG - Intronic
1184813180 22:46851376-46851398 GATGAGTGCAGCAGCAGGAGGGG - Intronic
1184885451 22:47342298-47342320 GAGCAGGGCAGGTGGGGGAGAGG + Intergenic
1184887471 22:47355248-47355270 GAGGAGGGCAGGCAGACCAGGGG - Intergenic
1185244315 22:49765194-49765216 GATGAGTGAAGGAGGAGGAGAGG + Intergenic
1185323666 22:50215343-50215365 GATGGGTGGAGGCTGAGGAGTGG + Intronic
1185395311 22:50583665-50583687 GAGGTGCGCAGGCCGAGGAGGGG - Intronic
949480855 3:4493042-4493064 AAGGGGGGCAGCCGGAGGAGAGG + Intergenic
949549899 3:5104146-5104168 GAAGAGGACTGGGGGAGGAGGGG - Intergenic
949938526 3:9136135-9136157 GAGGAGGGCGGGCGGGGAAGGGG - Intronic
949940678 3:9151955-9151977 GATGTGGGGAGGAGCAGGAGGGG - Intronic
949961291 3:9314641-9314663 GAGGAGGGCAGGGTGGGGAGAGG - Intronic
950191267 3:10978083-10978105 GCTGAGGGGAGGTGGGGGAGGGG - Intergenic
950422147 3:12905534-12905556 AGAGAGGGCAGGCGGAGGTGGGG + Intronic
950489781 3:13296862-13296884 GATGAGAGCATGCGGGGGAAGGG - Intergenic
950552503 3:13675273-13675295 GATGAGGGGAGGAGGAGCTGAGG - Intergenic
950650312 3:14402938-14402960 GATGGGCGCACGCGGAGGGGAGG - Intronic
950712916 3:14826320-14826342 GATGAGGGCAGTGGGGAGAGGGG - Intronic
952229824 3:31418364-31418386 GATGAGGGTGGGAGGTGGAGAGG - Intergenic
953786801 3:45917209-45917231 GGAGAGGGCTGGCGGAGGAAGGG + Intergenic
953794844 3:45976601-45976623 GATGGGGGAAGGGGGAGCAGTGG + Intronic
953908269 3:46879228-46879250 GATGAGGGTGGGCTGTGGAGAGG - Intronic
953911238 3:46894037-46894059 GATGAGGTCAGGTGAGGGAGGGG + Intronic
954428400 3:50455903-50455925 GATGGGGGCAGAACGAGGAGAGG - Intronic
955171262 3:56567639-56567661 GATTATGGGAGGGGGAGGAGAGG + Intronic
955936034 3:64103504-64103526 GGTCAGGGCAGTGGGAGGAGGGG + Intronic
955953996 3:64269235-64269257 AGTGGTGGCAGGCGGAGGAGGGG + Intronic
956813532 3:72887956-72887978 GCTGCGGGCGGGCGGAGGGGCGG + Intergenic
958630549 3:96677235-96677257 GCTGAGGACAGGAGGAGGAGGGG + Intergenic
958970512 3:100605702-100605724 GATGAGGGTGGGGGGAGGGGAGG - Intergenic
960527419 3:118725620-118725642 GATGAGGGGAGGCAAAAGAGGGG + Intergenic
961132919 3:124485439-124485461 GCTGTGGGCAGTCGAAGGAGTGG + Intronic
961481516 3:127183751-127183773 GGGGAGGGGAGGTGGAGGAGGGG - Intergenic
961508215 3:127385580-127385602 TCTTAGGGCAGGTGGAGGAGAGG + Intergenic
962002896 3:131317789-131317811 GAGGAGAGAAGGAGGAGGAGAGG + Intronic
962449523 3:135500984-135501006 GAGGCGGGCAGGAGGAGAAGTGG + Intergenic
963222465 3:142826968-142826990 ATTGAGGGCAGGAGGAGGAGAGG - Intronic
963327339 3:143877115-143877137 GGTGTGGGGAGGGGGAGGAGGGG - Intergenic
963482629 3:145895735-145895757 GATGAGAACTGGAGGAGGAGGGG + Intergenic
963672657 3:148271509-148271531 GTGGAGAGCAGGAGGAGGAGAGG - Intergenic
963799006 3:149658387-149658409 GCGGAGGGCACGCGGATGAGGGG + Intronic
964535438 3:157716255-157716277 GCTGAGGGTAGGAAGAGGAGGGG + Intergenic
965293352 3:166912383-166912405 GATGGGAGCAGGGAGAGGAGCGG - Intergenic
966957245 3:184895603-184895625 GAGGAGGGGGGGAGGAGGAGGGG - Intronic
967974863 3:195028143-195028165 GAGGAAGGCAAGAGGAGGAGTGG - Intergenic
968039891 3:195579993-195580015 GACGAGGGCAGGGGGAGGGATGG - Intronic
968106816 3:196007135-196007157 GATGGGGGCATGCTGGGGAGGGG - Intergenic
968187570 3:196643765-196643787 GATCAGGGCTGGAGCAGGAGAGG - Intronic
968571762 4:1346024-1346046 GAAGGGGTGAGGCGGAGGAGCGG + Intergenic
968599926 4:1503970-1503992 GATGAGGGCAGGCCGTGGTGAGG - Intergenic
968620122 4:1600191-1600213 GCTGAGGGCTGGGGCAGGAGGGG + Intergenic
968741743 4:2334766-2334788 GAAGAGGGGAGGCGGAAGTGGGG - Intronic
968741748 4:2334780-2334802 GAAGAGGGGAGGGGGAAGAGGGG - Intronic
968741755 4:2334794-2334816 GAAGAGGGGAGGGGGAAGAGGGG - Intronic
968741762 4:2334808-2334830 GAAGAGGGGAGGGGGAAGAGGGG - Intronic
968741769 4:2334822-2334844 GAAGAGGGGAGGGGGAAGAGGGG - Intronic
968889296 4:3359192-3359214 GAGAAGGGGAGGAGGAGGAGGGG - Intronic
969294787 4:6263422-6263444 GGTGAGGGCTGGGGGAGGTGGGG + Intergenic
969713560 4:8857952-8857974 GGGGAGAGGAGGCGGAGGAGGGG + Intronic
969827261 4:9767336-9767358 GATGAAGGCAAGCAGAAGAGAGG - Intergenic
969893572 4:10281875-10281897 GATCATGGCAGGCAGAGGTGGGG - Intergenic
971508497 4:27394137-27394159 GATGAGGGCAGGTGGGAGAGGGG - Intergenic
971646317 4:29209231-29209253 GAGGAGGGCAGAAGGAGAAGAGG - Intergenic
971994051 4:33941053-33941075 GAGGAAGGCAGTGGGAGGAGAGG + Intergenic
973704076 4:53564428-53564450 GATGAGGGGATGAGGAGGAGTGG + Intronic
974103600 4:57443412-57443434 CAAGAGGGCAGGGGGAAGAGAGG - Intergenic
975267660 4:72390000-72390022 GAAGAGGGCAGGAAAAGGAGAGG + Intronic
975300887 4:72790093-72790115 GATGTGGGAAAGGGGAGGAGAGG - Intergenic
978611128 4:110541387-110541409 GATGTGGACAGTCAGAGGAGGGG - Intronic
979573752 4:122261849-122261871 GATGAGGAAAGGTGGAGGAAGGG - Intronic
979979790 4:127240629-127240651 GATGAGGGCATGCTGAGAAAAGG + Intergenic
980140655 4:128912696-128912718 GAGGAGGGGAAGAGGAGGAGGGG - Intronic
980190686 4:129520502-129520524 GAGGAGGGAGGGGGGAGGAGGGG + Intergenic
981025075 4:140069552-140069574 GAGGAGGGGAGGAGGAGGAGGGG + Intronic
981178701 4:141714097-141714119 GATGGGGACAGGAGGAGGATGGG - Intronic
981300844 4:143184827-143184849 GAGGCGGACAGGCGGAGGGGCGG + Intergenic
981586692 4:146310959-146310981 GATGGGGGGAGGGGGATGAGGGG + Intronic
982687211 4:158505252-158505274 GAGGAGGACAGGAGGAAGAGAGG + Intronic
984432756 4:179668964-179668986 GATAAAGGCAGGCAGAGGAGTGG + Intergenic
985141019 4:186840641-186840663 GAAGAGGGAGGGAGGAGGAGGGG - Intergenic
985733403 5:1564048-1564070 GAGGAGGACAGGGGGAGGTGCGG - Intergenic
985835674 5:2270226-2270248 GGTGAGGGCAGGCAGAGGCAGGG + Intergenic
986221750 5:5774829-5774851 GAGGAGGAAAGGAGGAGGAGGGG - Intergenic
986694516 5:10339873-10339895 CTTGAAGGCAGGCAGAGGAGTGG + Intergenic
986725766 5:10595190-10595212 GAGGAGGCCAGGTGGAGGAGCGG + Intronic
987387860 5:17347344-17347366 GAGGAAGGCAGGTGGGGGAGAGG - Intergenic
990274357 5:54179583-54179605 GAGCAGGGGAGGAGGAGGAGAGG + Intronic
991650501 5:68847738-68847760 TATGAGGGCAGACAGAGAAGAGG + Intergenic
992187256 5:74256272-74256294 GATGGAGCCAGGTGGAGGAGGGG - Intergenic
992365142 5:76083286-76083308 GGAGGAGGCAGGCGGAGGAGAGG + Exonic
992708237 5:79420475-79420497 GAAGAGGGCAGGCGGTGGTATGG - Intronic
993149568 5:84143677-84143699 AATGAGGGGAGGTAGAGGAGGGG + Intronic
993352500 5:86867513-86867535 AATGAGGGTAGGGGGTGGAGTGG + Intergenic
993625460 5:90219350-90219372 GAGGGGGGGAGGAGGAGGAGCGG + Intergenic
993728236 5:91392625-91392647 GATGAGAGGAGTGGGAGGAGCGG + Intergenic
994710065 5:103255943-103255965 GATGATGGCAGGGAGTGGAGGGG - Intergenic
995224782 5:109690085-109690107 GCGCGGGGCAGGCGGAGGAGAGG - Exonic
995540059 5:113176836-113176858 GATGCTGGCATGGGGAGGAGTGG - Intronic
995657442 5:114442844-114442866 GATGTGGGCAGGGGGAAAAGAGG + Intronic
996082565 5:119271798-119271820 GATGTGGGCAGTGTGAGGAGGGG - Intronic
997124233 5:131209775-131209797 GATGAGGGCAGGGGGACAGGTGG + Intergenic
997361148 5:133295828-133295850 GAAGAGGTCAGGAAGAGGAGTGG - Intronic
997419595 5:133755509-133755531 GTGGTGGGCAGGGGGAGGAGAGG - Intergenic
997422490 5:133780218-133780240 GATGTGGGCACTGGGAGGAGGGG + Intergenic
997613556 5:135231436-135231458 GAAGAGGGCTGGCTGAGGACTGG + Intronic
997655157 5:135548932-135548954 GATGAGGGTGGGAGGTGGAGGGG + Intergenic
998203482 5:140143540-140143562 GGTGAGGGAAGGAGGAGAAGAGG - Intergenic
998394717 5:141811438-141811460 AATGAGGCCAGGGGGAGGAAGGG - Intergenic
998485077 5:142494882-142494904 GATGGGGGCAGGAGGATGAAGGG + Intergenic
998760432 5:145426112-145426134 GATGAGAGCTGGCAGATGAGTGG + Intergenic
999076856 5:148804510-148804532 AATGACAGCAGGGGGAGGAGGGG + Intergenic
999134598 5:149310107-149310129 GCCGAGAGCAGGCCGAGGAGTGG + Exonic
999161295 5:149501725-149501747 ATTGAGGGCAGGCAGAGGTGGGG - Intronic
999327250 5:150650915-150650937 GGGGAGCGCAGGCGGAGGCGAGG - Exonic
999693821 5:154170921-154170943 GAGGAGGGCAAGAAGAGGAGAGG + Intronic
999755483 5:154661264-154661286 CAGCAGGGCAGGCAGAGGAGGGG - Intergenic
999782324 5:154859266-154859288 GATGATGGGAGACGGAGTAGTGG + Intronic
1000312593 5:160059626-160059648 GAAGAGGGAAGCCTGAGGAGAGG + Intronic
1001110661 5:168893488-168893510 GGGGAAGGCAGGGGGAGGAGAGG + Intronic
1001476984 5:172057539-172057561 GAGGAGGCCAGGCAGAGGTGGGG - Intronic
1001654121 5:173336392-173336414 GATGGGGGATGGCGAAGGAGGGG - Intergenic
1001873812 5:175182039-175182061 GATTGGGGGAGGAGGAGGAGAGG - Intergenic
1002042282 5:176523482-176523504 GGGGAGGGGAGGAGGAGGAGGGG - Intergenic
1002094439 5:176822795-176822817 AATGAGGGGAGGAGAAGGAGTGG + Intronic
1002102344 5:176863757-176863779 GAGGAGGGGAGGGGGAGGAGGGG - Intronic
1002434792 5:179224587-179224609 CATGTGGGCAGGGGGATGAGAGG + Intronic
1002879926 6:1242288-1242310 GGAGAGGGCAAGCGGAGGACTGG + Intergenic
1003175454 6:3750442-3750464 GGAGGGGGCAGGCCGAGGAGAGG - Intronic
1003687631 6:8320281-8320303 GATGATGGCATGAGGAGGTGGGG - Intergenic
1004065884 6:12243320-12243342 GAGGAGAGGAGGAGGAGGAGGGG + Intergenic
1004203094 6:13568396-13568418 CATGTGGGGAGGCGAAGGAGAGG - Intergenic
1004423257 6:15489879-15489901 GAACAGGGAAGGAGGAGGAGAGG - Intronic
1004875634 6:19950267-19950289 GAGGAGGGGAGGATGAGGAGAGG - Intergenic
1004924545 6:20403902-20403924 GGTGAGGGTAGGCGGTTGAGCGG + Intronic
1004985590 6:21078762-21078784 GATCAGGGAAGGCTGAAGAGAGG - Intronic
1005136048 6:22570429-22570451 GAGGAGGACGGGCTGAGGAGAGG - Exonic
1005871228 6:29975496-29975518 AGTGAGAGGAGGCGGAGGAGAGG + Intergenic
1005883048 6:30074822-30074844 GAGGAGAGCTGGCGGAGGGGAGG - Intronic
1006145040 6:31953840-31953862 GAAGAGGGGAGGCAGAGGATGGG + Intronic
1006145197 6:31954747-31954769 GGGGAGGGGAGGCTGAGGAGTGG + Exonic
1006170111 6:32087596-32087618 GATCAGGGCTGGCGGTGGGGCGG + Intronic
1006173662 6:32109379-32109401 GATGAGGTCAGGGAGGGGAGCGG + Intronic
1006332894 6:33405069-33405091 GAGGAGGCCAGGGGGTGGAGTGG - Exonic
1006403157 6:33829558-33829580 GATGAGGGAGGGGAGAGGAGGGG - Intergenic
1006407897 6:33855850-33855872 GGTGAGGGCAGGGAGGGGAGTGG + Intergenic
1006445047 6:34075314-34075336 GGTGAAGTGAGGCGGAGGAGAGG - Intronic
1006457963 6:34142820-34142842 GAGGAGGGGGGGAGGAGGAGCGG + Intronic
1006510771 6:34519978-34520000 GATGAGGGGAGGGGTAGGCGAGG + Intronic
1006782185 6:36639496-36639518 GATGAGTGAGGCCGGAGGAGTGG - Intergenic
1006812784 6:36830905-36830927 GATGGTGGCATGGGGAGGAGTGG - Intronic
1007116953 6:39349549-39349571 GCAGAGGGCAGGGGGAGCAGTGG + Intronic
1007348126 6:41248466-41248488 GCTTAGGGCAGGCAGAGGGGTGG + Intergenic
1007367558 6:41405778-41405800 GATGAGGTCATGTGGTGGAGAGG - Intergenic
1007590943 6:43020753-43020775 GATGACAGCAGGCTCAGGAGGGG - Exonic
1007774249 6:44216003-44216025 GAGGAAAGCAGGTGGAGGAGAGG + Intergenic
1007831581 6:44642974-44642996 GTAGAGGGGAGGCGGAGGTGGGG + Intergenic
1007941849 6:45789001-45789023 GTTGAGGTCAGGTGGAGCAGTGG + Intergenic
1010083098 6:71886711-71886733 GGGGCGGGCAGGCGGAGGCGCGG - Intronic
1011221784 6:85062216-85062238 GATGAGGAAAGGTGGAGAAGAGG + Intergenic
1013600563 6:111700275-111700297 GAGCAGGGCAGGGGCAGGAGAGG + Intronic
1014999782 6:128200842-128200864 GAGGAGGGGGGGAGGAGGAGGGG + Intronic
1015135387 6:129863495-129863517 AAAGAGGGCAGGCGGAGGCCAGG + Intergenic
1015850700 6:137568810-137568832 AAGGAGGGGAGGGGGAGGAGGGG + Intergenic
1015863321 6:137702874-137702896 GCTGAAGGCAGCCAGAGGAGGGG - Intergenic
1016199918 6:141394732-141394754 GATCAGAGCAGGCGCAGGAGCGG - Intergenic
1017041873 6:150314445-150314467 GAAGAGGGAAGGAGGAGGAAAGG + Intergenic
1017592232 6:155990067-155990089 AATGGAGGGAGGCGGAGGAGGGG - Intergenic
1017637453 6:156456376-156456398 GAGGAGGGGAGGAGGGGGAGGGG - Intergenic
1018089536 6:160333688-160333710 AATGAGGGCAAGGGGAGAAGTGG + Intergenic
1018233745 6:161702533-161702555 AATGGGGGGAGGGGGAGGAGAGG + Intronic
1018627282 6:165792164-165792186 GATGAGGGCAAGTGGGGCAGGGG - Intronic
1019125891 6:169839966-169839988 GATGTGGGCATGGGGTGGAGTGG - Intergenic
1019223500 6:170493247-170493269 GAGGAGGGGAGGAGGAGGGGAGG + Intergenic
1019223552 6:170493377-170493399 GAGGAGGGGAGGAGGAGGGGAGG + Intergenic
1019223571 6:170493434-170493456 GAGGAGGGCAGGAGGGGAAGAGG + Intergenic
1019532503 7:1510829-1510851 GGTGGGGGCAGGGGGAGCAGAGG + Intergenic
1019729549 7:2622678-2622700 GGTGGGGGCAGGAGGAGCAGGGG - Intergenic
1019729560 7:2622703-2622725 GATGGGGGCAGGAGGAGCAGGGG - Intergenic
1020461767 7:8435396-8435418 GAGGCGGGCGGGCGGACGAGAGG - Intronic
1020560643 7:9726518-9726540 GCGGCTGGCAGGCGGAGGAGGGG + Intergenic
1020876585 7:13702456-13702478 GAGGAGGGAAGAAGGAGGAGAGG + Intergenic
1021104047 7:16616722-16616744 GATGAGGGCTGGGGGACCAGCGG + Intronic
1021486682 7:21175628-21175650 GATGAAGGCAGGATGAGGAGGGG + Intergenic
1021677643 7:23097345-23097367 GATGAGGGCAGGAGGCAGACAGG + Intergenic
1022015229 7:26343787-26343809 GAGGAGGCCAGGAGGAGGAGCGG - Intronic
1022477921 7:30723806-30723828 AATGAGGGCAGGGGCTGGAGGGG + Intronic
1022758896 7:33326231-33326253 GAAGAGGGGAGGGGGAGGGGAGG - Intronic
1023280327 7:38562662-38562684 GAAGAGGGGAGGGAGAGGAGAGG + Intronic
1023620921 7:42071743-42071765 GATGAGAGCAGGGAGATGAGAGG - Intronic
1024009895 7:45258702-45258724 GCTGAGGTCAGGGGGAGGATGGG + Intergenic
1024980710 7:55155521-55155543 GGTGAGAGCAGGTGGAGGAGAGG + Intronic
1025945039 7:66099037-66099059 GAGGAGGAGAGGAGGAGGAGAGG + Intronic
1025945043 7:66099051-66099073 GAGGAGAGGAGGAGGAGGAGAGG + Intronic
1025945053 7:66099089-66099111 GAGGAGGAGAGGAGGAGGAGAGG + Intronic
1025945058 7:66099100-66099122 GAGGAGGAGAGGAGGAGGAGGGG + Intronic
1025945062 7:66099114-66099136 GAGGAGGGGAGGAGGAGGAGAGG + Intronic
1025945072 7:66099141-66099163 GAGGAGGGGAGGAGAAGGAGGGG + Intronic
1025945100 7:66099250-66099272 GAGGAGGAGAGGAGGAGGAGAGG + Intronic
1025945105 7:66099261-66099283 GAGGAGGAGAGGAGGAGGAGGGG + Intronic
1025945111 7:66099275-66099297 GAGGAGGGGAGGAGGAGGAGGGG + Intronic
1025945114 7:66099289-66099311 GAGGAGGGGAGGAGAAGGAGCGG + Intronic
1025945134 7:66099339-66099361 GAGGAGGGGAGGAGGAGGGGAGG + Intronic
1025945139 7:66099350-66099372 GAGGAGGGGAGGAGGAGGAGGGG + Intronic
1025945152 7:66099397-66099419 AAGGAGGGGAGGAGGAGGAGAGG + Intronic
1025945165 7:66099430-66099452 GAGGAGGAGAGGAGGAGGAGGGG + Intronic
1025945169 7:66099444-66099466 GAGGAGGGGAGGAGGAGGAGAGG + Intronic
1026205669 7:68255320-68255342 GAGGAGGGGAGAAGGAGGAGGGG - Intergenic
1026631753 7:72043923-72043945 GATGTTGGCAGGCAAAGGAGAGG + Intronic
1026938028 7:74270252-74270274 GAGGAGGGGAGGGAGAGGAGGGG - Intergenic
1026938034 7:74270266-74270288 GAGGAGGGGAGGGAGAGGAGGGG - Intergenic
1027464948 7:78503622-78503644 GAGGAGGGGAGGGAGAGGAGTGG - Intronic
1027686963 7:81290132-81290154 GGTGAGGGCAGGAGGAAGAAAGG + Intergenic
1027883186 7:83869357-83869379 GATAACGGCAGGAGAAGGAGTGG + Intergenic
1029217209 7:98959197-98959219 GTGGAGGTCAGGCGGAAGAGAGG + Intronic
1029598242 7:101548967-101548989 GCTGTGGGCAGCCGGTGGAGAGG + Intronic
1029653953 7:101912206-101912228 GAAGAGGGGAGGGGGAAGAGGGG - Intronic
1030167679 7:106571275-106571297 CAGGTGGGAAGGCGGAGGAGAGG + Intergenic
1031088143 7:117323396-117323418 GATGAGGTGAGGCGGGGAAGGGG + Intergenic
1031484097 7:122307511-122307533 GGAGAGGGGAGGGGGAGGAGAGG - Intronic
1032174320 7:129611585-129611607 GCTGCGGGCAGGCAGCGGAGAGG - Intergenic
1032908119 7:136396132-136396154 GAAGAAGGGAGGAGGAGGAGAGG + Intergenic
1033535379 7:142307548-142307570 GTTGATGGCTGGCAGAGGAGAGG + Intergenic
1033785283 7:144722624-144722646 GGAGAGGGCAGGCAGAGCAGAGG + Intronic
1034422209 7:150995996-150996018 GATGGGAGCAGAGGGAGGAGGGG - Intronic
1034451597 7:151139927-151139949 GAAGAAGGGAGGCAGAGGAGGGG - Intronic
1034530431 7:151693067-151693089 GGTGAGGGCGGGTGAAGGAGTGG - Intronic
1034556887 7:151855734-151855756 GGTGGGGGCAGGCAGAGGGGTGG + Intronic
1034720727 7:153290076-153290098 GAGGGGGGGAGGGGGAGGAGGGG + Intergenic
1034820429 7:154211815-154211837 GATGAGGGCAGGTGGAAGCCTGG - Intronic
1035233230 7:157479045-157479067 GAGGAGGGGAAGAGGAGGAGAGG + Intergenic
1035251420 7:157599935-157599957 GATGTGGGCAGGTGGAGAGGTGG - Intronic
1035251476 7:157600125-157600147 GATGTGGGCAGGTGGAGAGGTGG - Intronic
1035251513 7:157600253-157600275 GATGTGGGCAGGTGGAGATGTGG - Intronic
1036445996 8:8822389-8822411 GATGGGGGCAGGGGATGGAGCGG + Intronic
1036588199 8:10144597-10144619 GGAGAGGGAAGGGGGAGGAGGGG - Intronic
1037760432 8:21738208-21738230 GAAGAGGGGAGGAGGAGGAGGGG - Intronic
1037889230 8:22614733-22614755 GATGAAGGCAGCCGGAAGTGGGG - Intronic
1038064794 8:23952346-23952368 GTTTGGGGCAGGAGGAGGAGCGG - Intergenic
1039083365 8:33755760-33755782 GGAGAGGGCAGCCAGAGGAGTGG - Intergenic
1039100885 8:33940782-33940804 GAAAAGGACAGACGGAGGAGCGG + Intergenic
1039908798 8:41807948-41807970 GAGGAGGGGAAGAGGAGGAGGGG + Intronic
1039977738 8:42381607-42381629 GATCAGGGCAGACAGGGGAGAGG - Intergenic
1040079804 8:43275011-43275033 GACGGGGGAAGGAGGAGGAGGGG - Intergenic
1040640371 8:49327286-49327308 GCTGATGGCAGGCCTAGGAGAGG + Intergenic
1041016210 8:53594976-53594998 AGTGAGGGCAGGCTGAGCAGAGG - Intergenic
1041650431 8:60296992-60297014 GATGAAGGTAGGCTGAGGAGGGG - Intergenic
1042012801 8:64267054-64267076 GAAGAGGGCAGGCGGATGACTGG - Intergenic
1042729022 8:71910772-71910794 GAGGAGGGCAAGTGGTGGAGAGG - Intronic
1043400863 8:79882932-79882954 GAAGAGGGCAGGAGAGGGAGAGG - Intergenic
1043463833 8:80486507-80486529 GAAGGGGGCGGGCGGCGGAGAGG - Exonic
1043808390 8:84702979-84703001 GAAGAGGGCAGGAAGAAGAGTGG + Intronic
1044641596 8:94388231-94388253 GAGGAGAGGAGGCAGAGGAGGGG - Intronic
1044765796 8:95572544-95572566 GCTGAGGGCAGTTGGAGGAGTGG + Intergenic
1044767963 8:95597156-95597178 GAGGAGGGGAGGGGGAGGGGAGG - Intergenic
1044767975 8:95597180-95597202 GAGGAGGGGAGGAGGGGGAGGGG - Intergenic
1046399332 8:113684319-113684341 GAGGAAGGCAGGTGGAGGTGGGG - Intergenic
1047409764 8:124614768-124614790 GAAAAGGGCAGGGGGAGGAAAGG + Intronic
1048223087 8:132561348-132561370 GAACAGGGCAGGAGGAGGGGAGG - Intergenic
1048255319 8:132901131-132901153 CTTGAGGGCAGGCAGTGGAGGGG + Intronic
1048321589 8:133404394-133404416 GATGGGGGCAGGGAGAGGTGGGG + Intergenic
1048325266 8:133434293-133434315 GATGAGGGCAGGAGGAAGGAAGG - Intergenic
1048461302 8:134623767-134623789 GAGGAGGGCAGGGAGAAGAGGGG - Intronic
1048922673 8:139245464-139245486 GGTGAAGGCAGGAGGAAGAGAGG + Intergenic
1049083162 8:140458011-140458033 GAGGAGAGTAGGAGGAGGAGGGG + Intronic
1049371911 8:142272000-142272022 CCAGAGGGCAGGCGGACGAGCGG - Intronic
1049510208 8:143023389-143023411 GAAGAGGTCAGCGGGAGGAGGGG + Intronic
1049547977 8:143243390-143243412 GATGAGGGGGAGGGGAGGAGGGG + Intergenic
1049692724 8:143969699-143969721 CATGAGTGCAGGCCGGGGAGTGG + Intronic
1049748285 8:144272193-144272215 GCTCAGAGCAGGCCGAGGAGGGG - Intronic
1049854898 8:144855263-144855285 GAGGAGGGCAGTAGGAGAAGTGG + Intergenic
1050535351 9:6626024-6626046 GCTGAAGGCAGGCAGAGGGGTGG - Intronic
1051149965 9:14069554-14069576 CATGAAGGCAGTCGGGGGAGGGG - Intergenic
1051311550 9:15779325-15779347 GTTGGTGGCAGGCGGGGGAGTGG + Intronic
1051774864 9:20622300-20622322 GCTGAGGGGGGGCGGAGGAGGGG - Exonic
1051906128 9:22096804-22096826 GAGAAGGCCAGGTGGAGGAGGGG - Intergenic
1052276106 9:26678485-26678507 TATAAGGGCAGGAGGAGGGGTGG + Intergenic
1053286924 9:36855695-36855717 GATGTGGGCAGTGGGAGGTGTGG - Intronic
1053373230 9:37580219-37580241 GATGAGGGCAGAAAGAAGAGAGG - Intronic
1053502514 9:38611495-38611517 AATGTGGGGAGGCAGAGGAGGGG - Intergenic
1053707149 9:40767713-40767735 GAGGGGAGCAGGTGGAGGAGTGG - Intergenic
1054417062 9:64888481-64888503 GAGGGGAGCAGGTGGAGGAGTGG - Intergenic
1054910800 9:70453510-70453532 GATGAGCGCAGTCAGGGGAGAGG + Intergenic
1055460182 9:76512076-76512098 GATGAGGGCAGGCGGAAGGCAGG + Intergenic
1055654101 9:78436531-78436553 GATGAGGCCAGGAGAAGCAGGGG + Intergenic
1055941243 9:81652064-81652086 GATAAGGGTGGGAGGAGGAGAGG - Intronic
1055956185 9:81775826-81775848 GAGGAGGGGAGGAGGAGGATGGG - Intergenic
1056622192 9:88223803-88223825 GATGAGGGCAGGGAGCAGAGAGG + Intergenic
1056730302 9:89160284-89160306 GATCTGGGTAGGTGGAGGAGTGG - Intronic
1056811917 9:89771691-89771713 GGTGACGGCAGGTGGAGGACAGG + Intergenic
1057110892 9:92469760-92469782 GCTGAGGGGAGGCGGTGGCGGGG + Intronic
1057131551 9:92657707-92657729 GAGGCAGGCAGGCGGAGGATAGG - Intronic
1057423549 9:94930551-94930573 GAAGAGGTCAGGAGGAAGAGGGG + Intronic
1057682342 9:97200739-97200761 AATGTGGGGAGGCAGAGGAGGGG - Intergenic
1057693920 9:97310404-97310426 GATGAGAGCAGGCGGGGGTCAGG + Intronic
1060150857 9:121287231-121287253 GCTGAGGACAGGGGGAGGAGTGG + Intronic
1060531046 9:124347143-124347165 TATCAGGGCAGGGGGAGCAGGGG - Intronic
1060679265 9:125546866-125546888 GAGGCGAGCAGGAGGAGGAGCGG - Intronic
1060813092 9:126620893-126620915 GAAGGGGGTAGGTGGAGGAGAGG + Intronic
1060822040 9:126666819-126666841 GATGAGGGCCTGCAGAGGGGCGG + Intronic
1060840987 9:126793032-126793054 GATGAGGGCAGGTCCAGGGGAGG - Intergenic
1060894888 9:127211259-127211281 GCTGTGGGCAGGTGGAGGAGAGG + Intronic
1061225115 9:129276888-129276910 GATGGGGGCCGGGGGAGGAGCGG - Intergenic
1061374491 9:130215938-130215960 GTTGAGGGGAGGAGGAGGATGGG - Intronic
1061411742 9:130425652-130425674 GAGGAGGGGAGGAGGAGGAGGGG - Intronic
1061826427 9:133261035-133261057 GAGGATGGCTGGTGGAGGAGGGG + Intronic
1061947137 9:133914718-133914740 GATCACGGGAGGGGGAGGAGAGG + Intronic
1062194144 9:135263910-135263932 GGAGAGGGCAGGAGGGGGAGAGG - Intergenic
1062441338 9:136571053-136571075 GGTGACGGCAGGCGAGGGAGGGG - Intergenic
1062564894 9:137159926-137159948 CCTGAGGGCAGGTGGAGCAGAGG - Intronic
1062567778 9:137170949-137170971 GCTGAGGGCAGCTGGGGGAGGGG - Exonic
1185575553 X:1169231-1169253 GAGGAAGGTAGGAGGAGGAGGGG + Intergenic
1186444996 X:9619743-9619765 GATGGGGACAGGTGGAGGTGCGG + Intronic
1186532513 X:10311523-10311545 GAGGAGGAGAGGAGGAGGAGAGG - Intergenic
1186669924 X:11758102-11758124 GCTCGGGGCGGGCGGAGGAGGGG + Intergenic
1186888341 X:13937422-13937444 GATTAGGGGAAGCGGAGGAGCGG + Intronic
1187466826 X:19534830-19534852 GAGGAAGGCAGGGGGAGGAAGGG + Exonic
1187469146 X:19552879-19552901 GATTTGGCCAAGCGGAGGAGTGG + Intronic
1187483773 X:19682822-19682844 GCTGAGGGCGGGTGGAGGGGTGG + Intronic
1187704271 X:21993894-21993916 GGAGAGGGAAGGAGGAGGAGAGG - Intronic
1187704276 X:21993910-21993932 AGAGAGGGCAGGAGGAGGAGAGG - Intronic
1188872276 X:35387684-35387706 CACGAGGCCAGGGGGAGGAGAGG + Intergenic
1189491676 X:41475193-41475215 GATGAGGGGAAGGGGAGGGGAGG - Exonic
1190132038 X:47756897-47756919 GATGAGAGCAGGAGCAGGAAAGG + Intergenic
1190137060 X:47807040-47807062 GCTGGGGGCAGGAGGAGGTGGGG + Intergenic
1190887582 X:54543163-54543185 GATGAGGGCAGGAAAAGGATAGG - Intronic
1192141504 X:68650461-68650483 GAGGAGGGGAGGAGGAGGAGGGG + Intronic
1192170957 X:68854397-68854419 TGTGAGGGCAGGGGGAGAAGAGG - Intergenic
1192589530 X:72348284-72348306 GGTGAGGGGAGGTGGAGGGGAGG + Intronic
1195057807 X:101163487-101163509 GATGAGGGAAGGAAGGGGAGAGG + Exonic
1195379103 X:104254533-104254555 GCTGATGGCAAGGGGAGGAGAGG - Exonic
1196657323 X:118232180-118232202 GAGGAGGAGAGGAGGAGGAGGGG + Intergenic
1196752507 X:119130566-119130588 GATGAATGCAGGGGGTGGAGAGG + Intronic
1196783245 X:119400841-119400863 GATGAGGGCAAGCAGAGGTGGGG - Intronic
1196965181 X:121047665-121047687 CATCGCGGCAGGCGGAGGAGGGG - Exonic
1197767451 X:130068467-130068489 GAGGAGGGCAGGCAGTAGAGTGG - Intronic
1198183595 X:134233498-134233520 GATGAGGGCCAGAGGAGGGGTGG + Intergenic
1198657922 X:138934984-138935006 CCTGAGGGCAGGGGGAGAAGAGG - Intronic
1199717771 X:150518504-150518526 GAGGAGGGCAGGCAGGAGAGGGG + Intergenic
1200251064 X:154554043-154554065 GCTCAGGTCAGGCGGAGCAGGGG - Intronic
1201300212 Y:12498655-12498677 GAGGAGGGGAGGAGGAGGGGAGG - Intergenic
1201492499 Y:14557461-14557483 GATGATGGGAGGGGGAGAAGAGG + Intronic