ID: 1152532542

View in Genome Browser
Species Human (GRCh38)
Location 17:80927819-80927841
Sequence AGATGAGGGCAGGCGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 767
Summary {0: 1, 1: 0, 2: 6, 3: 67, 4: 693}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152532542_1152532556 26 Left 1152532542 17:80927819-80927841 CCCTCCTCCGCCTGCCCTCATCT 0: 1
1: 0
2: 6
3: 67
4: 693
Right 1152532556 17:80927868-80927890 CGCCCGCACGGAGGAGCTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 157
1152532542_1152532551 14 Left 1152532542 17:80927819-80927841 CCCTCCTCCGCCTGCCCTCATCT 0: 1
1: 0
2: 6
3: 67
4: 693
Right 1152532551 17:80927856-80927878 TCTGAGAATTCCCGCCCGCACGG 0: 1
1: 0
2: 0
3: 2
4: 43
1152532542_1152532553 23 Left 1152532542 17:80927819-80927841 CCCTCCTCCGCCTGCCCTCATCT 0: 1
1: 0
2: 6
3: 67
4: 693
Right 1152532553 17:80927865-80927887 TCCCGCCCGCACGGAGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 358
1152532542_1152532552 17 Left 1152532542 17:80927819-80927841 CCCTCCTCCGCCTGCCCTCATCT 0: 1
1: 0
2: 6
3: 67
4: 693
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532542_1152532557 27 Left 1152532542 17:80927819-80927841 CCCTCCTCCGCCTGCCCTCATCT 0: 1
1: 0
2: 6
3: 67
4: 693
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152532542 Original CRISPR AGATGAGGGCAGGCGGAGGA GGG (reversed) Intronic
900391519 1:2435997-2436019 AGAGGAGGGAAGCGGGAGGAAGG - Intronic
900471373 1:2856669-2856691 AGAGAAGGGGAGGCGGAGGGAGG - Intergenic
900528530 1:3141170-3141192 AGAAGCGGGCGGACGGAGGATGG - Intronic
900601056 1:3502787-3502809 AGGTCAGGGCAGGCGTGGGAGGG - Intronic
900658275 1:3770830-3770852 AGAAGAGGGAAGACAGAGGATGG + Intronic
900789898 1:4672915-4672937 AGATGAGGGCAGGAGGGTGAGGG + Intronic
901213448 1:7539747-7539769 TGATGAGGGCAGACATAGGAAGG + Intronic
901220953 1:7583513-7583535 AGATGTGAGCAGGCAGAGGCTGG + Intronic
901427395 1:9191172-9191194 AGATGAGCACAGGCAGAGGCGGG - Intergenic
901666857 1:10831074-10831096 GGATGAGGACAGGAAGAGGAAGG + Intergenic
902490832 1:16779365-16779387 AGAGGAGAGCAGGGGGAGTAGGG + Intronic
902616689 1:17627529-17627551 AGGTGAGGGCAGGCAGGTGAGGG - Intronic
902922742 1:19676767-19676789 AGATGAGGTCAGAAGGAGGCAGG - Intronic
903191839 1:21660939-21660961 AGCTGGGGACAGGAGGAGGAGGG + Intronic
903288337 1:22291040-22291062 AGGTGAGGGGAGTCGGGGGATGG - Intergenic
904449020 1:30599140-30599162 AGATGGGGGCAGTGGGAGGAAGG - Intergenic
904642940 1:31944400-31944422 AGAAGGAGGCAGGGGGAGGAAGG + Intronic
905734058 1:40314299-40314321 AGAGGAGGGCAAGAGCAGGAAGG + Intronic
905773609 1:40654113-40654135 ATGGGAGGGCAGGCGGGGGAGGG - Intronic
905881971 1:41469929-41469951 AGATGAGGGCAGGGGAGGGGCGG - Intergenic
907012873 1:50979086-50979108 GGATGAGGGCTGGGGGAGAAAGG - Intergenic
907654368 1:56327380-56327402 AAATGAGGACAGGCTGGGGAAGG + Intergenic
907770750 1:57461043-57461065 AGATAAGGGCAGGGGAAGGAAGG - Intronic
907865516 1:58396111-58396133 AGAAGAGGGCAGGGGAGGGAGGG + Intronic
908199677 1:61781407-61781429 AAATGGGGCCAGGCTGAGGAAGG - Intronic
908491414 1:64647996-64648018 AGAGAAGGGCAGGCTGAAGACGG - Exonic
908883342 1:68758684-68758706 AGATGAGGGCAGGTGGGGAGGGG + Intergenic
910337909 1:86155327-86155349 AGCTGAGGGCAGGCGGAGGCAGG - Intronic
910378116 1:86595400-86595422 AGATGAGGACAGGAAGATGAGGG - Intergenic
910582868 1:88847768-88847790 AGATGAGGGCAGGCTGCCTAGGG + Intergenic
910649987 1:89556275-89556297 ATTTGAGGGCAGTGGGAGGATGG - Intronic
911137697 1:94458966-94458988 AGGAGAGGGGAGGTGGAGGAGGG - Intronic
911348114 1:96721578-96721600 AGAGGACGGCAGGCGGAGGGCGG + Intergenic
911581324 1:99636485-99636507 AGAGGAGGGGAGGGGAAGGAAGG + Intergenic
912215695 1:107608658-107608680 AGAGGAGGGAAGGTGGAGGAGGG + Intronic
912873307 1:113329415-113329437 AGAGCAGGGCAGGTGCAGGAAGG + Intergenic
913046535 1:115078132-115078154 AGCTAGGGGGAGGCGGAGGAGGG - Intronic
914912530 1:151799401-151799423 AGAGGAGAGGAGTCGGAGGAGGG - Intergenic
914937767 1:151994976-151994998 AAAAGAGGGCGGGCGGGGGAGGG - Intergenic
915100374 1:153495043-153495065 AGGAGAGGGCAGGCAGAGGAAGG - Intergenic
915117503 1:153609932-153609954 GGGTTTGGGCAGGCGGAGGAGGG - Intronic
915167736 1:153958063-153958085 AGATGAAGTCCGGCGGAGGTAGG - Intronic
915285043 1:154847096-154847118 AAGTGAGGGCAGGCAGGGGAGGG - Intronic
915363474 1:155300320-155300342 AGACGAAGGCATGGGGAGGAAGG - Intronic
915516505 1:156415876-156415898 GGATTAGGGCAGGAGGAGGAGGG + Intronic
915555428 1:156658270-156658292 GGGTGAGGGCAGGCAAAGGAGGG + Exonic
915902203 1:159855131-159855153 AGACGAGGGCAGGTGGAGGGAGG - Intronic
916509519 1:165459672-165459694 AGAAGAGAGGAGGAGGAGGAGGG - Intergenic
916935595 1:169625017-169625039 AGATGTGGGCAGGAGGACAAAGG - Intronic
917034308 1:170730178-170730200 AAATGAGGGGAGGAGAAGGATGG - Intronic
917061412 1:171045288-171045310 AGATCAGGGCAGGCCGAGCACGG - Intronic
917565323 1:176207033-176207055 AGGGGAGGGGAGGCGGCGGAGGG - Exonic
917641762 1:176989927-176989949 AGATGGGGGCAGGGGGAGGGCGG - Intronic
917853256 1:179082614-179082636 GGATCAGGGGAGGCGGGGGACGG - Intronic
918006060 1:180543152-180543174 AGAAGAGGGGAGGGGGAGGAGGG + Intergenic
919176718 1:194028426-194028448 AGGGGAGGGGAGGGGGAGGAAGG - Intergenic
919825816 1:201502398-201502420 AGCTGAGGGCAGAGAGAGGAGGG + Intronic
919968585 1:202554941-202554963 AAATGAGAGCATGTGGAGGAAGG - Intronic
920154532 1:203937642-203937664 AGGGGAGGGGAGGGGGAGGAAGG + Intergenic
920258295 1:204671609-204671631 AGAGAAGGGAAGGCAGAGGAAGG + Intronic
920434549 1:205939602-205939624 AGGTGAGGGCAAGAGGTGGAGGG + Intronic
921174683 1:212583749-212583771 AGAGGAGGGCAGGAAGTGGATGG + Intronic
921264370 1:213410332-213410354 AGATGAGGGAAGCAGAAGGAAGG + Intergenic
921266151 1:213422177-213422199 AGATGAGGGCTGGAGGAAGGAGG - Intergenic
921330567 1:214031480-214031502 TGGGGAGGGCGGGCGGAGGAGGG - Intronic
922001427 1:221482524-221482546 AGTTGAGGGCATGTGGAGGATGG - Intergenic
922160972 1:223078987-223079009 AGAAGAGGCCAGAGGGAGGAGGG + Intergenic
922648683 1:227318384-227318406 AGGAGAGGGAAGGCGGGGGAGGG - Exonic
922799458 1:228358354-228358376 AGCTGAGGGCTGGAGGAGGCAGG + Intronic
922856375 1:228778530-228778552 AGACCAGGGCAGGGGGAGGGGGG - Intergenic
922936339 1:229425924-229425946 GGATGAGAGGAGGAGGAGGAGGG + Intergenic
923052194 1:230396561-230396583 AGATGAATGCAGGGGGAGGGGGG - Intronic
923127769 1:231047342-231047364 AAAGGAGGGAAGGAGGAGGAAGG - Intergenic
923338877 1:232991417-232991439 AGATGGGGGCCTGCGGGGGAGGG + Intronic
924920704 1:248626445-248626467 AGCAGAGGGCATGCGGTGGATGG + Exonic
1062907281 10:1187409-1187431 GGATGGGAGCAGGAGGAGGAGGG - Intronic
1062956438 10:1543227-1543249 AGATGAGGCCTGGTAGAGGAGGG - Intronic
1063230795 10:4063943-4063965 AGCTGAGGGCAGCAGGAGGCAGG - Intergenic
1063331718 10:5166120-5166142 AGAAGAGTGCAGGCTGAAGATGG - Intergenic
1063343238 10:5288139-5288161 AGATGAGAGCAGCCTGAGCATGG + Intergenic
1063967634 10:11359347-11359369 AGAGGAGGGGAGGTGGAGGATGG - Intergenic
1064194533 10:13234354-13234376 AGAGGAAGGAAGGCGGGGGAGGG + Intergenic
1065345743 10:24746407-24746429 AGATGAGGTGAGGGGGAGAATGG + Intergenic
1065368002 10:24953203-24953225 AGGTGAGGGGAGGTGGAGGGAGG - Intergenic
1066361838 10:34738766-34738788 AGAAGAGGTCAGGGGGAGGATGG + Intronic
1067151651 10:43740050-43740072 AGATGAGGTCAGGCATGGGACGG - Intergenic
1067667265 10:48289053-48289075 ACAGGTGGGCAGGCGGAGGGTGG - Intergenic
1067684111 10:48457002-48457024 ACATTAGCGCAGGCGGAGGGTGG + Intronic
1068839017 10:61589402-61589424 AGATGGGGCCAGGAGGTGGAGGG + Intergenic
1068946578 10:62735539-62735561 AGAGGAGGTCTGGGGGAGGAAGG + Intergenic
1069635032 10:69919848-69919870 AGATGAGGGGAGTGGCAGGACGG + Intronic
1070539285 10:77404607-77404629 AGATTAGGGCATGCTGAGGAGGG + Intronic
1070720257 10:78752060-78752082 AGAGGAGGGCAGGGAGAGGCTGG - Intergenic
1071480036 10:86058172-86058194 ATAGGAGGGCTGGGGGAGGAAGG - Intronic
1071571785 10:86701165-86701187 AGATGAAGGCAGCGGGATGAAGG - Intronic
1072148769 10:92667812-92667834 AGAGGGGGGGAGGAGGAGGAAGG + Intergenic
1072497835 10:95980160-95980182 AGAAGAGGGAGGGAGGAGGAAGG + Intronic
1072552158 10:96487320-96487342 GGATGAGGACAGGTGGGGGAGGG - Intronic
1073110666 10:101061457-101061479 AGATGAGGGAAGGCGGATGTAGG + Intergenic
1073178259 10:101569469-101569491 AGATGCCGGCAGGCAGGGGATGG + Intergenic
1074078823 10:110151960-110151982 GGGAGAGGGCAGGAGGAGGAAGG - Intergenic
1074160927 10:110835837-110835859 AGAAGAGGGGAAGTGGAGGAAGG - Intronic
1074270465 10:111948673-111948695 GGATGAGGGAAGGGGCAGGAGGG + Intergenic
1074779425 10:116790431-116790453 GGCTGAGGGCAGGAAGAGGAGGG - Intergenic
1075015219 10:118905721-118905743 AGAGGAATGCAGGCAGAGGAGGG + Intergenic
1075464679 10:122642601-122642623 GGCTCAGGGCAGGCTGAGGAGGG + Intronic
1075726428 10:124613090-124613112 TGAGTAGGGCAGGGGGAGGAGGG + Intronic
1076121402 10:127939788-127939810 AGATGTGGGCAGGTGGAGGCAGG + Intronic
1076121415 10:127939848-127939870 AGATGTGGGCAGGTGGAGGCAGG + Intronic
1076121427 10:127939908-127939930 AGATGTAGGCAGGTGGAGGCAGG + Intronic
1076121443 10:127939968-127939990 AGATGTGGGCGGGTGGAGGCAGG + Intronic
1076121453 10:127940028-127940050 AGATGTGGGCAGATGGAGGCAGG + Intronic
1076121469 10:127940108-127940130 AGATGTGAGCAGGTGGAGGCAGG + Intronic
1076259170 10:129051905-129051927 GTAGGAGGGCAGGGGGAGGAGGG + Intergenic
1076259419 10:129054018-129054040 AGAGGAGGGGAGGCGTGGGAAGG + Intergenic
1076536964 10:131184981-131185003 AGATTACGGCAGGCTGAGGTGGG + Intronic
1076596048 10:131624237-131624259 AGGTGGGGGGAGGTGGAGGAGGG + Intergenic
1076802270 10:132836090-132836112 GGAGCAGGGCAGGCGGAGCATGG - Intronic
1077015918 11:399224-399246 AGAGGGGCGCAGGTGGAGGAAGG - Intronic
1077358384 11:2129006-2129028 AGAAGAGGGAAGGGGAAGGAAGG - Intergenic
1078529466 11:12125781-12125803 AGATGGGGACAGGAGTAGGAGGG + Intronic
1078600319 11:12724758-12724780 AGGAGAGGGCAGGGAGAGGATGG - Intronic
1079121109 11:17685908-17685930 AGAGGAGGTCAGGGGAAGGAGGG - Intergenic
1079934495 11:26600401-26600423 AGAGGAGGGCAGGGGAAGGGAGG - Intronic
1080232826 11:30036913-30036935 AGAAGAGAGCAGGAGGATGAAGG + Intergenic
1080365835 11:31573031-31573053 AGAAGGGGGCAGGAGGAGGAAGG + Intronic
1080397459 11:31903092-31903114 GGAAGAGGGCAGGAGGAGGGAGG + Intronic
1081105759 11:39067185-39067207 AAATGAGTGAAGGTGGAGGAAGG - Intergenic
1081671475 11:44945048-44945070 AGATGAGGGAGGGAAGAGGAAGG + Intronic
1081762318 11:45584971-45584993 AGAAGAGGACAGGCAGAAGAAGG - Intergenic
1082097548 11:48143770-48143792 GGAGGAGGGGAGGGGGAGGAGGG - Intronic
1082097556 11:48143784-48143806 AGGAGAGGGGAGGGGGAGGAGGG - Intronic
1082269563 11:50155264-50155286 AGCTGAGGGGATGGGGAGGAAGG - Intergenic
1083097716 11:60268588-60268610 AGATGAGGGAAGACGTAGGGAGG - Intergenic
1083206372 11:61152018-61152040 AGAAGTGGGCTGGGGGAGGATGG - Intronic
1083365806 11:62140869-62140891 AGAAGTGGGCAGGCGGGGCAGGG - Intronic
1083780345 11:64914317-64914339 AGGTGAGGGCAGGGCGAGGCTGG - Exonic
1084092229 11:66886203-66886225 GGAGGGGGGCAGGCAGAGGAGGG + Intronic
1084256525 11:67946658-67946680 AAAAGAGGACAGGAGGAGGAGGG - Intergenic
1084372125 11:68751205-68751227 AGGTGAGGGGCGGCCGAGGAGGG + Intronic
1084550141 11:69836224-69836246 AGATGAGGGCATGCTGGGGGAGG - Intergenic
1084742712 11:71149929-71149951 AGAGGAGGGGAGGGGAAGGAGGG + Intronic
1085243751 11:75080436-75080458 AGGTGGGGGCAGTAGGAGGAGGG - Intergenic
1085267476 11:75245809-75245831 AGATGAGGGCAGTGAGAGAAGGG + Intergenic
1085299561 11:75450247-75450269 GGATGGGGACAGGAGGAGGAGGG + Intronic
1086077727 11:82872402-82872424 AGATGAGGGCATGCTGGAGAGGG + Intronic
1086125629 11:83345658-83345680 AGATGAGGGCAGGAGGAGTGAGG + Intergenic
1087560620 11:99785043-99785065 AGGTGGAGGCAGGCGGAGGCAGG - Intronic
1089009941 11:115123975-115123997 AGATGAGGGCAGGGCGGGGCAGG - Intergenic
1089056823 11:115592310-115592332 TGATGAGGGCTGGGGCAGGAAGG - Intergenic
1089072372 11:115710557-115710579 AGATGGGGGGAGGCGATGGAGGG + Intergenic
1089201267 11:116725972-116725994 GGCTGAGGGCAGGCCCAGGAGGG + Intergenic
1089257358 11:117200881-117200903 ACATGAGGGCAGGTGGAGTGGGG + Intronic
1089320146 11:117620357-117620379 AGGAGAGGGGAGGAGGAGGAGGG - Intronic
1089331030 11:117689040-117689062 AGATGAGGGGAGGAGGATGGTGG - Intronic
1089399707 11:118157353-118157375 GGAGGAGGGCAGAGGGAGGAGGG + Intergenic
1089705449 11:120274593-120274615 AGATGATGGGAGGAGAAGGAGGG + Intronic
1089749785 11:120642775-120642797 AGATGAGGTGAGGAGGAGGACGG - Intronic
1089960944 11:122616891-122616913 AAATGCTGGCAGGAGGAGGAAGG - Intergenic
1090270096 11:125379989-125380011 TGATGAGGGTAGGGGGTGGAGGG + Intronic
1090278453 11:125435905-125435927 AGATGCGGGCAGGTGGGGGCGGG - Intergenic
1090518375 11:127452433-127452455 AGATGAGAGATGGCTGAGGAAGG - Intergenic
1090612116 11:128480473-128480495 GGAAGAGGACAGGGGGAGGAGGG + Intronic
1091042457 11:132294608-132294630 AGTTGAGGACAGGAGGAGGCAGG + Intronic
1091070516 11:132558416-132558438 GGAGGAGGGGAGGAGGAGGAGGG - Intronic
1091221897 11:133934733-133934755 AGCTGAGGACAAGTGGAGGATGG - Intronic
1091301255 11:134509658-134509680 GGCTGAGGGCAAGGGGAGGAGGG - Intergenic
1091320874 11:134648913-134648935 AGATGAGGTCAGGAGGGTGAGGG + Intergenic
1091546236 12:1503114-1503136 AGAGCAAGGCAGGGGGAGGAGGG + Intergenic
1092248446 12:6877193-6877215 AATTGAGGGCAGGGGCAGGAGGG + Intronic
1092742240 12:11641014-11641036 AGAGGAGGGGAGGGGGAGGGAGG - Intergenic
1092985980 12:13846945-13846967 AAAGGAGTGCAGGCAGAGGAAGG + Intronic
1094079400 12:26516177-26516199 AGGGGAGGGGAGGCGGGGGAGGG + Intronic
1096280857 12:50252200-50252222 AAGTGAAGGCAGGAGGAGGAAGG + Intronic
1097369457 12:58758942-58758964 AGGTGGGGGGAGGGGGAGGATGG - Intronic
1097872249 12:64610930-64610952 AGGCGAGGGAAGGCGGAGGAAGG + Intronic
1097950810 12:65426342-65426364 ATATAAGTGCAGGGGGAGGACGG - Intronic
1097964428 12:65563621-65563643 GGAGGAGGGGAGGAGGAGGAGGG + Intergenic
1098465759 12:70784081-70784103 AGCTGAGGGCAGAGGGAGCAGGG + Intronic
1098584913 12:72143367-72143389 AGATGAGAGGAGTAGGAGGAAGG + Intronic
1099284829 12:80704687-80704709 AGTTGAGGGCAGGAGGTGGGAGG - Intergenic
1101001377 12:100361505-100361527 AGAAGAGGGCAGGAGGAGGAGGG - Intronic
1102011228 12:109619792-109619814 AGATGAGGCCATGAGGAAGATGG + Intergenic
1102019344 12:109670837-109670859 AGGTGAGGGGAGGAGAAGGAGGG - Intergenic
1102088088 12:110160501-110160523 AGAACAAGGCAGGGGGAGGAAGG - Intronic
1102219660 12:111186060-111186082 AACAGAGGGCAGGAGGAGGAAGG - Intronic
1102318607 12:111911385-111911407 AGTTGAGGGTAGGGGGAGGTAGG + Intergenic
1102481566 12:113227331-113227353 AGATGGGGACAGACGGAGGCTGG - Intronic
1102648742 12:114421387-114421409 GGATGAGGACAGAAGGAGGAGGG + Intergenic
1103344837 12:120242315-120242337 AGATGGGTGCGGGCAGAGGAAGG - Intronic
1103510612 12:121471189-121471211 AGATGAGGTCAGACGGAGGGAGG - Intronic
1103743812 12:123108824-123108846 GGATGAGGGCACCCGGAGAAGGG + Intronic
1104042242 12:125138207-125138229 AGATGCGGGCAGGCGCCGGGAGG - Intronic
1104874553 12:132024833-132024855 AGGTGAGGGAAGGTGGGGGAAGG - Intronic
1104914398 12:132257433-132257455 GGATGAGGGCATGGGGACGAGGG - Intronic
1104914420 12:132257487-132257509 GGATGAGGGCATGAGGACGAGGG - Intronic
1104926931 12:132318710-132318732 AGAGGAGGGCAGGCGGCCCACGG - Intronic
1104964246 12:132501845-132501867 AGATCTGGGCAGTCGAAGGAAGG - Intronic
1105007378 12:132729608-132729630 AGGTGAGGGGAGGGGGAGGGGGG + Intronic
1105225577 13:18428501-18428523 AGATTATGGTAGGAGGAGGAAGG - Intergenic
1105388988 13:19958502-19958524 AGTCGAGGGCCGGCGGAGGCGGG + Intergenic
1105544032 13:21338998-21339020 AGATGAGGGCAGGTGAGGGCAGG - Intergenic
1106092462 13:26609439-26609461 AGAAGAGGGGAAGAGGAGGAGGG - Intronic
1106665575 13:31847157-31847179 ACATGGAGGCAGGAGGAGGACGG - Intergenic
1107034919 13:35891882-35891904 AGATCAGGGCAGATGGAGGGGGG + Intronic
1107614112 13:42146820-42146842 AGCTGGGGGCAGGCTTAGGAGGG + Intronic
1107631480 13:42347629-42347651 AGATGAGGGGAGAGGGAGAAGGG - Intergenic
1108392085 13:49956494-49956516 AGAGGAAGGAAGGAGGAGGAGGG - Intergenic
1108544265 13:51475776-51475798 AGATAAGGGGATGCTGAGGATGG - Intergenic
1108696833 13:52909602-52909624 AGTGGAGGGCAGGAGGAAGATGG + Intergenic
1108934524 13:55868472-55868494 AGAGGAGTGCAGGCTGAAGAAGG + Intergenic
1109299387 13:60575195-60575217 AGAAGAAGGAAGGAGGAGGAAGG + Intergenic
1110295207 13:73856166-73856188 AGATGAAGGCAGGCACAGGGAGG + Intronic
1111469488 13:88659686-88659708 AGAGGAGGGCAGAGGGAGGGAGG + Intergenic
1112350161 13:98626380-98626402 AGGGGAGGGGAGGGGGAGGAGGG + Intergenic
1113726156 13:112603853-112603875 AGAAGAGGGCAGAGGGAGGATGG + Intergenic
1114010025 14:18356853-18356875 AGATTATGTCAGGAGGAGGAAGG - Intergenic
1114318399 14:21526576-21526598 AGGGGAGGGCGGGGGGAGGAGGG - Intronic
1115749864 14:36478573-36478595 AAAAGAGGGCATGAGGAGGAGGG + Intronic
1115797838 14:36959193-36959215 AGCTGTGGGCAGGCAGAGAAGGG - Intronic
1116298780 14:43148919-43148941 AGAGGATGTCAGGCAGAGGAAGG + Intergenic
1116868368 14:50049518-50049540 AGATGAGGCCAGGAAGAGGGAGG - Intergenic
1118908412 14:70040858-70040880 AGGTGAGGGAAGGCGAGGGAAGG - Intergenic
1119029640 14:71181756-71181778 AGCCAAGGGCAGGCGGTGGAGGG - Intergenic
1119636916 14:76280651-76280673 AGGTCAGGGCAGGAGGAGGCAGG + Intergenic
1120817144 14:88872904-88872926 AGATGAGAGCAGTCTGAAGAAGG - Intronic
1120835709 14:89036893-89036915 AGGTGGGGGCAGGCAGGGGAGGG - Intergenic
1120874486 14:89363092-89363114 AGATGAGCCCTGGGGGAGGAAGG + Intronic
1120903127 14:89593077-89593099 GAATGAGGGAAGGAGGAGGAAGG + Intronic
1121523284 14:94600695-94600717 AGTAGAAGGAAGGCGGAGGAAGG + Intronic
1121762024 14:96453971-96453993 GGATGATGGCAGGCAGTGGAAGG - Intronic
1122234402 14:100323663-100323685 GGCTGAGGGCAGGCTGGGGATGG + Intronic
1122469426 14:101956150-101956172 AGATAACAGGAGGCGGAGGAGGG - Intergenic
1122822955 14:104356252-104356274 AGATGAGGGAAGGCCCCGGACGG + Intergenic
1123049630 14:105534744-105534766 AGACGGGGGCAGGAGGAGGAAGG + Intergenic
1123116889 14:105898945-105898967 AGTTGTGGGCAGGAGGAGGTAGG + Intergenic
1123118940 14:105908221-105908243 AGCTGTGGGCAGGAGGAGCACGG + Intergenic
1123121169 14:105917810-105917832 AGTTGTGGGCAGGAGGAGGCAGG + Intergenic
1123154604 14:106212171-106212193 AGAGGAGGGAAGGCGTTGGAAGG - Intergenic
1202900604 14_GL000194v1_random:34361-34383 AGAACAAAGCAGGCGGAGGAAGG + Intergenic
1123883268 15:24695759-24695781 ATATGAGGACAGGAGCAGGAAGG + Intergenic
1123992069 15:25690860-25690882 AGATGACGGCGGGGGGAGTAAGG + Intronic
1126385938 15:48093472-48093494 AGATGAGGGAAGGGGGAGGAAGG - Intergenic
1126411129 15:48374194-48374216 AGATAATGGCAGCCGGGGGAAGG - Intergenic
1127303782 15:57682688-57682710 AGATGAGGCCTGGTGGAGAAGGG - Intronic
1127817619 15:62625610-62625632 AGGCGAGGGCTGGGGGAGGACGG + Intronic
1127967217 15:63931391-63931413 AGAGAAGGGCAGGGAGAGGAAGG + Intronic
1128072559 15:64806836-64806858 AGAGGAAGGCAGGCGGAGGAAGG + Intergenic
1128366644 15:67008289-67008311 AGCTGCAGGCAGGGGGAGGATGG - Intergenic
1128940885 15:71786790-71786812 GGAAGAGGGGAGGAGGAGGAGGG + Intergenic
1129776756 15:78241861-78241883 GGATTAGGGAAGGAGGAGGAAGG + Intronic
1130305293 15:82709353-82709375 AGATAGGGGCTGGCGGGGGATGG - Intronic
1130750057 15:86701921-86701943 AGAGGAGGGGAGGGGAAGGAAGG - Intronic
1131146383 15:90016189-90016211 AAAGGAGGGTAGGCGGAGGTGGG + Intronic
1131525137 15:93146556-93146578 TGGTAGGGGCAGGCGGAGGATGG - Intergenic
1132069780 15:98766010-98766032 GGGTTAGGGCAGGAGGAGGAAGG + Intronic
1132307666 15:100828301-100828323 AGATGGGTACAGGAGGAGGAGGG + Intergenic
1132520304 16:384187-384209 AGGGGAGGGCAGTGGGAGGAGGG - Intronic
1132851913 16:2028645-2028667 AGAGGAGGGCTGGGGGAAGATGG + Intronic
1133013029 16:2925369-2925391 GGATGAGGGCAGGACGAGGCAGG - Intronic
1133520217 16:6549351-6549373 GGAGGAGGGAAGGAGGAGGAGGG + Intronic
1133520283 16:6549532-6549554 GGAGGAGGGGAGGAGGAGGATGG + Intronic
1133620639 16:7522987-7523009 GGATGAGGCAAGGAGGAGGAGGG - Intronic
1133770509 16:8864899-8864921 ACATGCGGGCAGGCTGAGCAGGG - Intronic
1133839570 16:9395046-9395068 GGATGAGGACAGGCGGGAGATGG + Intergenic
1133964359 16:10519703-10519725 AGGGGAGGGCAGGAGAAGGAAGG - Intergenic
1134095681 16:11416877-11416899 AGATGAGGTCAGATGGGGGAAGG + Intronic
1134291793 16:12907336-12907358 AGAAGAGGGGAGGGGAAGGAAGG - Intronic
1134448088 16:14345857-14345879 AGCTGATGGCATGGGGAGGAAGG + Intergenic
1134691781 16:16195601-16195623 AGATGAGACCAGGCGGGGCACGG - Intronic
1135036646 16:19084033-19084055 AGATGATGGCAGGATGAGAAAGG + Intergenic
1135583825 16:23651786-23651808 AGACCAAGGCAGGCGGAGGCGGG + Intronic
1136417568 16:30113150-30113172 AGGTGAGGCCAGAGGGAGGATGG - Intronic
1136539104 16:30918733-30918755 AGAAGAAGGAAGGAGGAGGAAGG - Intergenic
1137735747 16:50721781-50721803 AAATGAGGTCAGGCTGAGCAAGG - Intronic
1137859313 16:51830440-51830462 GGAGGAGGGGAGGGGGAGGATGG - Intergenic
1138577139 16:57915255-57915277 ACAGCGGGGCAGGCGGAGGAGGG + Exonic
1139072787 16:63403717-63403739 AGACGAGGGGAGGCGGGGCAAGG + Intergenic
1139653080 16:68372264-68372286 AGTTGGGGGCAGCTGGAGGAGGG + Exonic
1139944178 16:70627454-70627476 AGGGGAGGGAAGGGGGAGGAGGG - Intronic
1139957696 16:70700945-70700967 ATGTGAGGGCAGGCTGAGGAGGG + Intronic
1140139217 16:72238936-72238958 TGCTGAGGGGAGGCAGAGGAGGG - Intergenic
1140559929 16:75967115-75967137 AGAGGAGGACAGACGGAAGAGGG + Intergenic
1141210157 16:81972321-81972343 AGATGAGGGAAGGAGAAGGAAGG - Intergenic
1141524310 16:84601894-84601916 AGAGAAGGGCTGGTGGAGGAAGG - Intronic
1141673155 16:85503360-85503382 AGCTGAGGGCAGGTGGAGGCTGG - Intergenic
1141673268 16:85504030-85504052 GGCAGAGGGCGGGCGGAGGATGG - Intergenic
1141841554 16:86577154-86577176 AGATGAGGGAAGGGGGAGGATGG - Intronic
1142008232 16:87700545-87700567 AGAAGAGGGCAGAGGGAAGAGGG + Intronic
1142690669 17:1604719-1604741 AGGTGAGGGCAGGGGGCAGATGG - Intronic
1142854499 17:2722338-2722360 AGGTGGGGGCAGGCAGAGCAAGG + Intergenic
1142865502 17:2788732-2788754 AGCTGAGGGCAGGAGAAGGCGGG + Intronic
1143433378 17:6903428-6903450 ACATGAGTGCAGGCGGACTAGGG - Intronic
1143503047 17:7350059-7350081 GGATGATGGCATGGGGAGGAAGG + Intronic
1144070182 17:11664477-11664499 AAGTGAGGGTAGGCAGAGGAAGG - Intronic
1144430964 17:15191437-15191459 AGATGAGGGAAGGCAGAAGGGGG + Intergenic
1144588783 17:16506069-16506091 AGATGGGGGCAGGAGGATCAGGG - Intergenic
1144679021 17:17180523-17180545 ACAGGAGGGCGGGCGGAGGTGGG + Intronic
1146269288 17:31473951-31473973 AGATGAGGGCTGCCCCAGGATGG - Intronic
1146503878 17:33387819-33387841 AGAAAAGGGGAGGCAGAGGAAGG + Intronic
1146559388 17:33855033-33855055 AGATGGGGGCAGGGGATGGAAGG + Intronic
1146911323 17:36650206-36650228 GGAGGAGGGCATGTGGAGGAGGG + Intergenic
1148111770 17:45148542-45148564 AGCTGTGGGAAGGGGGAGGAGGG + Exonic
1148233153 17:45949819-45949841 GGATGGTGGCAGGTGGAGGAAGG + Intronic
1148405992 17:47416576-47416598 AGAGGAGGGGAGGGGGAGAAGGG - Intronic
1148785795 17:50145668-50145690 AGAAGAGGGGAAGAGGAGGAGGG + Intronic
1148864421 17:50621071-50621093 GGCTGCAGGCAGGCGGAGGAGGG + Intronic
1149113713 17:53064970-53064992 AGATGACAGCAGGTGGAGGTGGG + Intergenic
1149259444 17:54863020-54863042 AAATAAGGGCAGGCAGAGCAAGG + Intergenic
1150089448 17:62310044-62310066 AGAGGAGGAGAGGAGGAGGAGGG - Intergenic
1150364860 17:64573214-64573236 GGAGGAGGGGAGGAGGAGGAGGG + Intronic
1151356649 17:73562572-73562594 AGAAGAAGGCAGGCGTGGGAGGG + Intronic
1151548979 17:74810507-74810529 AGATGAGGACAGGCGGAGGCTGG - Intronic
1151626274 17:75277802-75277824 AGATGGGGGCAGGGGGAGGCTGG - Intronic
1152212231 17:79008893-79008915 GGATGAGGGCAGGGAGAGCAAGG + Intronic
1152448778 17:80363321-80363343 TGCTCAGGGCAGGCGGAGGAGGG - Intronic
1152532542 17:80927819-80927841 AGATGAGGGCAGGCGGAGGAGGG - Intronic
1152610223 17:81311682-81311704 GGATGAGGGCAGGGAGAGGTGGG + Exonic
1152855364 17:82662526-82662548 AGGTGAGGGCAGGTGGGGGCAGG + Intronic
1152875501 17:82784422-82784444 AGGTCAGGGCAGGCTGAGGCTGG + Intronic
1153015908 18:582545-582567 ATCTGAGGGCAGGGGAAGGAGGG + Intergenic
1153026486 18:677475-677497 AGAGTAGGGCAGGGAGAGGAAGG + Intronic
1153238851 18:3013117-3013139 GGCTGAGGGCAGGCGGCGGCTGG + Intronic
1154527802 18:15311021-15311043 AGATTATGGTAGGAGGAGGAAGG + Intergenic
1155410635 18:25541117-25541139 AGAGAAGGCCAGGCAGAGGATGG + Intergenic
1156424598 18:36996640-36996662 GGATGAGGGCAGTAGGAGGAAGG + Intronic
1157272412 18:46286438-46286460 AGATTAGGGCAGGGGCAGGAGGG + Intergenic
1157520350 18:48341256-48341278 AGATGTGGGCAGAGGAAGGAAGG + Intronic
1157978504 18:52353420-52353442 AGAGGAGGGAGGGAGGAGGAGGG - Intronic
1158372190 18:56820624-56820646 AACTGAGGGCAGGGGGAGGAGGG - Intronic
1158453587 18:57587586-57587608 AGAAGAGGGGAGGCCGTGGAAGG - Intergenic
1158951512 18:62499568-62499590 AGAAGGGGGAAGGAGGAGGAGGG - Intergenic
1159522056 18:69538812-69538834 AGAAGAAGGGAGGAGGAGGAAGG - Intronic
1159950337 18:74478298-74478320 AGGTGGGGGCAGGAGCAGGAAGG - Intergenic
1160086050 18:75778326-75778348 AGGTGGGGGCAGGGGCAGGAGGG + Intergenic
1160202077 18:76804300-76804322 AGCTGAGGGGAGGCCGAGGCGGG + Intronic
1160295432 18:77632825-77632847 ACAGGAGGGCGGGCGGAGGGTGG + Intergenic
1160393956 18:78558605-78558627 GGATGAGGGAAGGCGCAGGCTGG - Intergenic
1160403695 18:78629693-78629715 AGATGGGAGGAGGCGGAGGTGGG + Intergenic
1160415948 18:78711012-78711034 AGAGGAGAGCAGGGTGAGGAGGG + Intergenic
1160569487 18:79807134-79807156 AGATGCAGGCAGGCTGAGGTGGG - Intergenic
1160573180 18:79832267-79832289 AGGTGAGGGCAGGTGAAGAAGGG - Intergenic
1160774485 19:848705-848727 GGAGGAGGGCAGGCAGGGGAGGG + Intergenic
1160816752 19:1039619-1039641 AGAGGATGGCAGGAGGGGGAGGG - Intergenic
1160825424 19:1078044-1078066 AGGTGAGGGCGGGTGGAGGCAGG + Exonic
1160953613 19:1679394-1679416 TGATGAAGGCAGGCGCAGGAAGG + Intergenic
1161101685 19:2424740-2424762 AGGGGAGGGCAGGCGGGGGGCGG + Intronic
1161107271 19:2450529-2450551 AGATGATGGGAGGCTGAGGCGGG + Intronic
1161260203 19:3333521-3333543 GGCTGAGGGGAGGCTGAGGAGGG - Intergenic
1161330106 19:3682933-3682955 AGGGGAGGGGAGGGGGAGGAGGG - Intronic
1161456665 19:4373092-4373114 GGATGAGGCCAGGAGGGGGAGGG + Intronic
1161637104 19:5395774-5395796 AGAGGAGGGCGGGGGGAGGAAGG + Intergenic
1161678200 19:5665089-5665111 AAATGCTGGCAGGAGGAGGAAGG - Intronic
1161764560 19:6199566-6199588 AGAGGCGCGCAGGCGCAGGAGGG - Intronic
1162013349 19:7830770-7830792 AGATCAGGGCAGAAGGTGGACGG - Intronic
1162237720 19:9321758-9321780 GGAGGAGGGCGGGGGGAGGAGGG - Intergenic
1162317015 19:9945664-9945686 GGAGGAGGGAAGGGGGAGGAGGG + Intergenic
1162345786 19:10117214-10117236 AGTTGAGGGCAGGGGCAGGCTGG + Intronic
1162861007 19:13505866-13505888 GGAAGAGGGGAGGCGGAGGGAGG + Intronic
1162972798 19:14191199-14191221 AGATGGGGACAGGCTGAGGCTGG - Intronic
1163677094 19:18660625-18660647 GGAGGTGGGCAGGCGGAGGAGGG - Intronic
1163785291 19:19272029-19272051 AGATCAGGGCAGGGGTAGGGTGG - Intronic
1163920939 19:20287907-20287929 AGATGAGGGTAGACGGTGGGAGG - Intergenic
1164176362 19:22778713-22778735 AGATGTGGGGAGGCTGAGCACGG + Intronic
1164518005 19:28952851-28952873 ACATGATGGCAGTAGGAGGAGGG + Intergenic
1164592671 19:29514718-29514740 AGATGGGGGGATGAGGAGGAAGG + Intergenic
1164718642 19:30415070-30415092 GGAAGAGAGCAGGAGGAGGAGGG - Intronic
1164731027 19:30504511-30504533 AGAGGGGGGCAGGAGGAGGGAGG - Intronic
1165149682 19:33753502-33753524 AGATGGGGGATGGTGGAGGATGG - Intronic
1165720799 19:38078274-38078296 AGAAGAGGGCAGGTGGAGAGTGG - Intronic
1165923133 19:39311008-39311030 AGATGAAGAGAGGAGGAGGAAGG - Intronic
1166459010 19:42969541-42969563 AGATGAGAGCAGGGGTAAGAAGG + Intronic
1166475953 19:43124817-43124839 AGATGAGAGCAGGGGTAAGAAGG + Intronic
1167313556 19:48751324-48751346 TGAGGAGGGGAGGCTGAGGAGGG + Intronic
1167510544 19:49893394-49893416 GGAGGAGGTCAGGAGGAGGATGG + Intronic
1167575676 19:50316359-50316381 AGGTGAGGGCAGATGTAGGAGGG + Intronic
1167667016 19:50828234-50828256 ACAACAGGGCAGGCGGAGCATGG - Intronic
1167799211 19:51729510-51729532 AGATAAGGGAAGAAGGAGGAAGG + Intergenic
1168289772 19:55351952-55351974 GGATGATGGGAGGAGGAGGAAGG + Intronic
1168527789 19:57102710-57102732 AGATGAAGGCAGGAGCAGGCTGG - Intergenic
925032499 2:661555-661577 AGATAAGGTCAAGCGAAGGAGGG + Intergenic
925091107 2:1156663-1156685 AGGTGAGGGCAGAAGGACGAGGG + Intronic
925130104 2:1488569-1488591 AGAGGAGGGAAGGCTGAGGTGGG - Intronic
925909932 2:8567178-8567200 AGGTGGGGGCAGGTGGAGGAAGG - Intergenic
925937116 2:8774719-8774741 AGATGAGGTCAGAAGGAGGAAGG + Intronic
926238411 2:11067393-11067415 AGAGGAGCGCAGGGAGAGGAAGG - Intergenic
926421879 2:12707935-12707957 AGATGCTGGCAGGCTGTGGATGG + Intergenic
926686526 2:15702718-15702740 TGATTAGGGCAGGTGGAGAATGG - Intronic
926972046 2:18475936-18475958 AGAGGAGGGAAGGCGGGGGAAGG + Intergenic
927696739 2:25244465-25244487 AGAGGAGGGGAGGCGGTGGGCGG + Intronic
927908632 2:26880616-26880638 AAAAGAGGGGAGGCGGAGGTAGG - Intronic
927943193 2:27118651-27118673 CCCTGAGGGCAGGTGGAGGAAGG - Intronic
928387681 2:30884082-30884104 GGATGGGGGCATGTGGAGGAGGG - Intergenic
929314613 2:40462516-40462538 AGATCAGAGCAGGCGGGGCATGG + Intronic
931825655 2:65997926-65997948 AATTTAGGGCAGACGGAGGAGGG - Intergenic
932044388 2:68332824-68332846 AGATGAGGGAAGTTGGGGGAAGG + Intergenic
932133939 2:69212208-69212230 AGGGGAGGGGAGGAGGAGGATGG + Intronic
932223984 2:70024599-70024621 AGAGGAGGGAAGGAGGAAGAGGG - Intergenic
933180631 2:79222643-79222665 AAAAGAAGGCAGGAGGAGGAAGG - Intronic
933979461 2:87538548-87538570 AGCAGAGGGCAGGGGGACGAGGG - Intergenic
934230914 2:90181147-90181169 AGAGGGGGGGAGGTGGAGGAGGG - Intergenic
934307726 2:91840663-91840685 AGTGGAGGGCATGCGAAGGAAGG + Intergenic
934506266 2:94897187-94897209 AGAACAAAGCAGGCGGAGGAAGG - Intergenic
935196579 2:100820024-100820046 AGGCGAGGGGAGGAGGAGGAGGG + Intergenic
935655418 2:105418687-105418709 AGATAAGGGGAGCGGGAGGAGGG - Intronic
936073713 2:109388106-109388128 AGGCGTGGGCAGGCGTAGGATGG - Intronic
936314362 2:111412243-111412265 AGCAGAGGGCAGGGGGACGAGGG + Intergenic
936508872 2:113129831-113129853 ATATGAGGGCAGCCTGAAGAGGG + Intronic
936965357 2:118122643-118122665 AGATGAGGAAAAGGGGAGGATGG + Intergenic
937907152 2:127058001-127058023 AGAGGTGGGCAGGGGGAGGCTGG - Intronic
938526898 2:132142478-132142500 AGATTATGGTAGGAGGAGGAAGG + Intergenic
939961463 2:148569369-148569391 AGGTGAGGCCAGGCTGAGGGTGG + Intergenic
940864489 2:158804479-158804501 AGAAGGGGGCAGGAGGGGGAGGG + Intronic
940990087 2:160087836-160087858 AGAGGAGTGCAGGCTGAAGATGG + Intergenic
941045340 2:160669325-160669347 AGCTGAGGGCAGGGGGAATAAGG - Intergenic
941687484 2:168461999-168462021 ACAAGAGGGCAGCCTGAGGATGG - Intronic
942312414 2:174667833-174667855 GGAGGAGGGCAGGAAGAGGAGGG - Intronic
942875608 2:180793151-180793173 AGATGAGGGGAGGTGAAGAAGGG - Intergenic
944865183 2:203852854-203852876 AGAGGAGGGAAGAGGGAGGAAGG - Intergenic
946043949 2:216805335-216805357 AGATGTGGGCAGGCGGGGTGGGG - Intergenic
946374477 2:219299791-219299813 AGATGGGAGAAGGCAGAGGAAGG + Intronic
946620715 2:221559956-221559978 GGATGAGGGCAGGGGGATGGTGG - Intronic
947317370 2:228875618-228875640 AGAAGAGGGAAGTGGGAGGATGG - Intronic
947914611 2:233823224-233823246 ATATGAGGGCAGAAAGAGGAGGG + Intronic
947966369 2:234284983-234285005 TGATGAGGTCAGGCTGAGCACGG + Intergenic
948040251 2:234895998-234896020 TGAGTAGGGCAGGCTGAGGAAGG + Intergenic
948382379 2:237559746-237559768 AGAAGAGGACAGGTGGCGGAGGG - Intergenic
948465028 2:238148169-238148191 AGAGGAGGGGATGTGGAGGAAGG + Intronic
948856286 2:240732049-240732071 GGATGAGGGATGGGGGAGGAGGG + Intronic
1168752180 20:290454-290476 AGATGTGGGCGGGGAGAGGACGG + Intronic
1170375216 20:15692613-15692635 AGGTGAGGGCAGGGGTAGGGTGG + Intronic
1170781654 20:19430976-19430998 TCCTGAGGGCAGGCAGAGGATGG - Intronic
1171321452 20:24248040-24248062 AAAGGAGGGCAGGGGAAGGAGGG - Intergenic
1171333581 20:24362476-24362498 AGTTGAGGGCAAGTGGGGGAAGG - Intergenic
1171812680 20:29757882-29757904 AGTTGAGGGTTGGGGGAGGATGG + Intergenic
1172595732 20:36149802-36149824 AGGTGAGGTCATGGGGAGGAGGG - Intronic
1172600107 20:36177523-36177545 AGAAGCGGGCAGGGGGAGAAGGG - Intronic
1172643363 20:36455140-36455162 AGAGGAGGGAGGGAGGAGGAGGG - Intronic
1172899634 20:38325031-38325053 AGATGCTGGCAGGAGGTGGAGGG + Intronic
1173002789 20:39116920-39116942 AGAGGAGGGTAGGCAGGGGATGG - Intergenic
1173255463 20:41391682-41391704 ACATGAGGGCAGGAGGTGGCGGG + Intergenic
1173759275 20:45545587-45545609 AGGTGAGGACAGGGGGAGGAGGG + Intronic
1174043177 20:47714473-47714495 AGATGGTGACAGGCGGATGATGG - Intronic
1174106655 20:48167027-48167049 TGCTGAGGGAAGGCGAAGGAAGG - Intergenic
1175119538 20:56707557-56707579 GGAGGACGGCAGGCGGGGGATGG + Intergenic
1175519154 20:59588606-59588628 AGATGGCGGGAGGCTGAGGATGG - Intronic
1175891483 20:62317930-62317952 GTATGAGGGAAGGAGGAGGATGG + Intronic
1176117741 20:63440333-63440355 GGATGAGGGGAAGCGAAGGACGG + Intronic
1176619979 21:9049139-9049161 AGAACAAAGCAGGCGGAGGAAGG + Intergenic
1176769631 21:13057524-13057546 AGATTATGGTAGGAGGAGGAAGG - Intergenic
1177047052 21:16183827-16183849 AGAGGAGGGCAGGGGGTGGAGGG - Intergenic
1177070227 21:16495717-16495739 TGTAGAGGGCAGGAGGAGGAGGG + Intergenic
1179151360 21:38811410-38811432 AAAAGAGGGCAGGCAGAGGCTGG - Intronic
1179553180 21:42156235-42156257 AGACCAGGGTGGGCGGAGGAGGG + Intergenic
1180074959 21:45457544-45457566 AGTTGGGGGCAGGAAGAGGAGGG + Intronic
1180434523 22:15287662-15287684 AGATTATGTCAGGAGGAGGAAGG - Intergenic
1180920415 22:19518753-19518775 AGTGGAGGGCAGGCAGCGGAGGG + Intronic
1180931116 22:19592633-19592655 AGAAGAGGGACGGTGGAGGAGGG - Intergenic
1180935375 22:19622029-19622051 AGAGGAGGGCAGGCGGGGCACGG - Intergenic
1181164153 22:20974471-20974493 GGATGATGGCATGCAGAGGATGG + Intronic
1181584567 22:23845966-23845988 TGATGAGGACAGGAGGAGGAGGG + Intergenic
1181584945 22:23848110-23848132 TGGTGAGGGCAGACGCAGGAAGG + Intergenic
1182032740 22:27172696-27172718 AGATGGGGGAAGGTGGATGAAGG - Intergenic
1182063123 22:27412033-27412055 AGTTGTGGGCAGGGCGAGGAAGG - Intergenic
1182414168 22:30210371-30210393 ACATGAGGGCAGCAGCAGGAAGG + Intergenic
1182550872 22:31100163-31100185 AGAAGGGGGCAGAGGGAGGATGG - Intronic
1183034283 22:35129361-35129383 GGATGAGGGGAGGCCGAGGCGGG + Intergenic
1183084985 22:35481163-35481185 AGGTGAGGGCAGAGGGAGGCAGG + Intergenic
1183280719 22:36930634-36930656 AGCTGAGGGCAGGGAGAGGGAGG - Intronic
1183354174 22:37349601-37349623 AGGGCAGGGCAGGAGGAGGAAGG - Intergenic
1183404464 22:37623674-37623696 AGGTGGGGGCAGGAGGTGGAGGG - Intronic
1183472835 22:38018782-38018804 AGATGAGGCCAGATGCAGGAGGG + Intronic
1183549583 22:38474058-38474080 AGACCAGAGCAGGCAGAGGAAGG - Intronic
1183611126 22:38907139-38907161 AGATGGGGGAAGGTGGGGGAGGG - Intergenic
1183736381 22:39647032-39647054 AGGAGAGGGCAGGCAGAGGTGGG - Intronic
1184019979 22:41814273-41814295 AGATGAGGACAGGCCGGGCACGG + Intronic
1184096359 22:42318419-42318441 AGGAGAGGGGAGGAGGAGGAGGG + Intronic
1184173388 22:42772517-42772539 AGATGAGAGGAGGGGAAGGAAGG - Intergenic
1184390856 22:44202319-44202341 TGAGGAGAGAAGGCGGAGGAAGG + Intronic
1184768812 22:46586419-46586441 AGGGGAGGGCAGACAGAGGAGGG - Intronic
1184813181 22:46851377-46851399 AGATGAGTGCAGCAGCAGGAGGG - Intronic
1185199362 22:49492146-49492168 AGATGGGGCCAGGCACAGGAGGG - Intronic
1185309201 22:50144314-50144336 AGGGGAGGGCAGGGGTAGGAGGG + Intronic
950453676 3:13079885-13079907 AGATGAGGGAAGGAGGGGCAAGG + Intergenic
950489782 3:13296863-13296885 AGATGAGAGCATGCGGGGGAAGG - Intergenic
950638930 3:14335492-14335514 GGATGAGGGCATGCAGAGCAGGG + Intergenic
950863565 3:16171459-16171481 AGTTGAGAGAAGGCAGAGGAGGG + Intergenic
951546361 3:23829967-23829989 AGTGGAGGGAAGGGGGAGGAAGG - Intronic
952196950 3:31085704-31085726 AGAAGAGGGCAGCCAGTGGAAGG + Intergenic
952849123 3:37713397-37713419 AGCTGAGGGTTGGTGGAGGAGGG - Intronic
952889848 3:38032464-38032486 AGAGGAGGCCAGGCAGAGGATGG - Intergenic
953470164 3:43159534-43159556 ACATCAGAGCAGGCCGAGGAGGG - Intergenic
953786800 3:45917208-45917230 AGGAGAGGGCTGGCGGAGGAAGG + Intergenic
953981940 3:47417672-47417694 CGAAGAGGGAAGGCGGCGGAGGG + Exonic
954876463 3:53805953-53805975 AGATGAGGGAGGGAGGAGGAGGG - Intronic
954876525 3:53806187-53806209 AGATGAGGGAGGAGGGAGGAGGG - Intronic
955084514 3:55689679-55689701 AAATGAGGGGAGGCTGAGGCAGG + Intronic
955099244 3:55831320-55831342 AGAAGAGGGGAGGGGAAGGAAGG + Intronic
955144368 3:56301486-56301508 AGAAGAGGGGAGAGGGAGGATGG - Intronic
955936033 3:64103503-64103525 AGGTCAGGGCAGTGGGAGGAGGG + Intronic
956432179 3:69198126-69198148 AGTTGGGGGCGGGCGGAGGGGGG + Intronic
957071429 3:75570687-75570709 AAAAGAGGACAGGAGGAGGAAGG - Intergenic
957573470 3:81979505-81979527 AAATGAGGGGAGGATGAGGAAGG - Intergenic
957624713 3:82642875-82642897 AGAGGAGTGCAGGCTGAAGATGG - Intergenic
957807982 3:85176038-85176060 AGATTAGGACAGGCTGAGGCAGG - Intronic
958630548 3:96677234-96677256 CGCTGAGGACAGGAGGAGGAGGG + Intergenic
958913464 3:100021742-100021764 AGTTAAGGGTAGGCTGAGGAAGG - Intronic
958946820 3:100371745-100371767 GGATGGGGGTAGGAGGAGGAGGG + Intronic
959784414 3:110276656-110276678 AGATGAGGGGAGGGGAAGGGAGG - Intergenic
960885029 3:122384571-122384593 AGCTCAGGGGAGGCTGAGGACGG - Intronic
961012550 3:123446287-123446309 AGAAGAGGGGAGACAGAGGAAGG + Intronic
961074731 3:123971652-123971674 AGATGAGGTCAGTGGGAGAATGG + Intronic
961481517 3:127183752-127183774 AGGGGAGGGGAGGTGGAGGAGGG - Intergenic
961493887 3:127276536-127276558 AGGGGAGTGCAGGCTGAGGATGG - Intergenic
962632009 3:137286819-137286841 AGATGGGGGCAGGGTGAGGTAGG - Intergenic
962756391 3:138468250-138468272 AGGTGTGTGCAGGTGGAGGAAGG + Intronic
963327340 3:143877116-143877138 AGGTGTGGGGAGGGGGAGGAGGG - Intergenic
963643098 3:147881938-147881960 AGAGGAGTGCAGGCTGAAGATGG + Intergenic
964148684 3:153497756-153497778 AGCTGAGGGGAGAGGGAGGAGGG - Intronic
964274412 3:154993906-154993928 AGGTGAGGACAGGTAGAGGAAGG + Intergenic
964602826 3:158521328-158521350 AGATGTGGGCAGTAGAAGGAAGG - Intronic
966413867 3:179669541-179669563 GGAAGATGGCAGGAGGAGGAGGG - Intronic
966842027 3:184097612-184097634 TGATGGGGGAAGGCGGAAGAAGG + Intronic
968106817 3:196007136-196007158 AGATGGGGGCATGCTGGGGAGGG - Intergenic
968494206 4:906558-906580 AGATCAGGGTAGGAGCAGGATGG - Intronic
968620121 4:1600190-1600212 AGCTGAGGGCTGGGGCAGGAGGG + Intergenic
968781152 4:2582452-2582474 AGAGGAGGGAAGGAGAAGGAAGG - Intronic
969294786 4:6263421-6263443 AGGTGAGGGCTGGGGGAGGTGGG + Intergenic
969342927 4:6553570-6553592 AGATGAGGGCAGGGGAAAAAGGG + Intronic
969370349 4:6727707-6727729 AGGGGAGGGGAGGGGGAGGATGG - Intergenic
969454808 4:7294944-7294966 AGAGGAGGGGAGGGGGAGGGGGG - Intronic
969472715 4:7399018-7399040 AGCTGAGGGCAGGAAGGGGACGG + Intronic
969673561 4:8602738-8602760 TGAGGAGGGCAGGAGAAGGAAGG + Intronic
969873480 4:10118850-10118872 AGATGAGGGGAGGCGGACAACGG - Intergenic
969955201 4:10882373-10882395 AGATGAGAGAAGGAAGAGGAAGG - Intergenic
970240203 4:14001364-14001386 ATTTGAGGGCAGGAGCAGGAGGG - Intergenic
970618812 4:17796055-17796077 AACTGAGGACAGGGGGAGGATGG - Intergenic
971508498 4:27394138-27394160 GGATGAGGGCAGGTGGGAGAGGG - Intergenic
972993250 4:44848482-44848504 AGATCAGGGAAGGCAGGGGAAGG + Intergenic
973308617 4:48682003-48682025 ACAAGAGGGCAGGCAAAGGAAGG - Intronic
975219624 4:71799372-71799394 AGGTGAGGGCAGGAGAAGAAAGG - Intronic
976068395 4:81215251-81215273 AGAGGAGGGAAGGAGGAGGGAGG + Intergenic
976911489 4:90312490-90312512 AGATGAGAGTAGGCAGAGGTAGG + Intronic
977064707 4:92299898-92299920 AGGGGAGGGAAGGCGAAGGAAGG + Intronic
979573753 4:122261850-122261872 AGATGAGGAAAGGTGGAGGAAGG - Intronic
980400435 4:132277267-132277289 AGAGGAGGGGAGGGGGAAGAAGG - Intergenic
981025074 4:140069551-140069573 GGAGGAGGGGAGGAGGAGGAGGG + Intronic
981076721 4:140599823-140599845 GGATCAGGGTAGGAGGAGGAAGG + Intergenic
981178702 4:141714098-141714120 GGATGGGGACAGGAGGAGGATGG - Intronic
983029581 4:162783141-162783163 GGATGAGGGAGGGAGGAGGAGGG - Intergenic
983461249 4:168027979-168028001 AGAGGAGTGCAGGCTGAAGATGG + Intergenic
983495782 4:168441019-168441041 AGATGAGAGGAGGGGGAGGATGG + Intronic
984629013 4:182040165-182040187 AGAAGAGGGCAGGGGAGGGAAGG + Intergenic
984783216 4:183544862-183544884 AGTTGAGGGCAGGCAGGAGATGG - Intergenic
985141020 4:186840642-186840664 AGAAGAGGGAGGGAGGAGGAGGG - Intergenic
1202771199 4_GL000008v2_random:209209-209231 AGAATAAAGCAGGCGGAGGAAGG - Intergenic
985835673 5:2270225-2270247 AGGTGAGGGCAGGCAGAGGCAGG + Intergenic
986581459 5:9270701-9270723 GGGTGGGGGCAGGGGGAGGAGGG + Intronic
986658635 5:10039401-10039423 GCATGAGGGCAGGAGGAGGATGG + Intergenic
987367729 5:17164177-17164199 AGGTGAGGGAAAGCGGAGAATGG - Intronic
987373817 5:17217181-17217203 AGGAGAGGGGAGGCGGAGGGGGG + Intronic
988422615 5:31024621-31024643 GGAGGAGGGTAGGAGGAGGAAGG - Intergenic
988896294 5:35678172-35678194 AGATTAGGGCAGACTGAGGAAGG + Intronic
989592152 5:43121597-43121619 AGAAGAGGGAGGGCGGGGGAGGG + Exonic
990731334 5:58812186-58812208 AGATGGGGGCTGGTGGAGGCAGG + Intronic
992187257 5:74256273-74256295 AGATGGAGCCAGGTGGAGGAGGG - Intergenic
992748232 5:79839413-79839435 AAATGAGGGCAGGAGAAGCAGGG + Intergenic
993149567 5:84143676-84143698 AAATGAGGGGAGGTAGAGGAGGG + Intronic
993302922 5:86235605-86235627 GGATGGGGGAAGGAGGAGGAGGG + Intergenic
994099882 5:95880752-95880774 AGAGGAGGGAAGGAGGAGGGTGG + Intergenic
995417491 5:111926667-111926689 AGAGGAGTGCAGGCTGAAGATGG + Intronic
995831482 5:116360198-116360220 AGATGGGGGCAGGAGCAGGGTGG + Intronic
996458966 5:123719373-123719395 AGATAGGGGAAGGAGGAGGATGG - Intergenic
996476273 5:123925889-123925911 GGTTGAGGGCAGGCAGAAGAAGG - Intergenic
996909166 5:128635696-128635718 AGAAGAAAGCAGGCGGAAGATGG - Intronic
997202917 5:132023568-132023590 AGATCAGGGCAGGAGGTGAAGGG - Intergenic
997422489 5:133780217-133780239 AGATGTGGGCACTGGGAGGAGGG + Intergenic
997606125 5:135176924-135176946 GGCTGTGGGCATGCGGAGGAGGG + Intronic
997743945 5:136282276-136282298 AGGTCAGGGCAGGCTGATGAAGG + Intronic
998394718 5:141811439-141811461 GAATGAGGCCAGGGGGAGGAAGG - Intergenic
998485076 5:142494881-142494903 GGATGGGGGCAGGAGGATGAAGG + Intergenic
998737183 5:145155531-145155553 AGATGGCAGCAGGCTGAGGATGG - Intergenic
999076855 5:148804509-148804531 AAATGACAGCAGGGGGAGGAGGG + Intergenic
999161296 5:149501726-149501748 AATTGAGGGCAGGCAGAGGTGGG - Intronic
999283499 5:150380179-150380201 GGATGACAGCAGACGGAGGAGGG - Intronic
1000216612 5:159163635-159163657 AGATCAGGGCTGGAGGAGGGAGG - Intronic
1000329922 5:160198268-160198290 AGAGGAAGGCAGGAAGAGGAAGG + Intronic
1000633920 5:163621886-163621908 AGATAAGGGCAGGGGATGGAGGG - Intergenic
1000910247 5:167013225-167013247 AGATCAGGACAAGGGGAGGATGG - Intergenic
1001076009 5:168628678-168628700 GAAGGAGGGCAGGAGGAGGAAGG - Intergenic
1001132917 5:169079578-169079600 AGAGAAGGGGAGGAGGAGGAGGG + Intronic
1001654122 5:173336393-173336415 AGATGGGGGATGGCGAAGGAGGG - Intergenic
1002073641 5:176695542-176695564 AGAAGAGGGCTAGCAGAGGAAGG - Intergenic
1002102345 5:176863758-176863780 GGAGGAGGGGAGGGGGAGGAGGG - Intronic
1002501933 5:179652303-179652325 ACATGCAGGCAGGCGGAGGCAGG + Intergenic
1002570068 5:180135124-180135146 GGATTAGGGGATGCGGAGGAGGG + Intronic
1002659114 5:180778469-180778491 AAATGCGGGCAGGCAGGGGAGGG - Intergenic
1003060897 6:2861338-2861360 AGAGGAAGGGAGGGGGAGGAAGG - Intergenic
1003490691 6:6618938-6618960 GTATGAGGGGAGGAGGAGGAGGG + Intronic
1003687632 6:8320282-8320304 AGATGATGGCATGAGGAGGTGGG - Intergenic
1003867985 6:10381060-10381082 AGCTGAAGGGAGGCAGAGGAAGG - Intergenic
1003879381 6:10466339-10466361 ATTTGAAGGCAGGAGGAGGAGGG + Intergenic
1004505840 6:16246041-16246063 GGATAAGAGCAGGCTGAGGATGG + Intronic
1005207924 6:23426364-23426386 AGGTGAGGGCTGGGGAAGGAGGG - Intergenic
1005358770 6:25010313-25010335 AGAGGAGGAAAGGGGGAGGAAGG - Intronic
1005994399 6:30922606-30922628 AGAGGAAGGCAGGCTGAGGGAGG + Intronic
1006084433 6:31586381-31586403 AGATGAGGGGAGGGAGAGTATGG + Intronic
1006145039 6:31953839-31953861 AGAAGAGGGGAGGCAGAGGATGG + Intronic
1006403158 6:33829559-33829581 AGATGAGGGAGGGGAGAGGAGGG - Intergenic
1006411472 6:33876482-33876504 TGCTGAGGGCAGGCGGACGTTGG - Intergenic
1006433039 6:34009928-34009950 AGATGAGGGCCTGGGGACGAGGG - Intergenic
1006582861 6:35086788-35086810 CCCTGGGGGCAGGCGGAGGAGGG - Intronic
1006798829 6:36746745-36746767 GGAGGAGGAGAGGCGGAGGAGGG - Intronic
1007179971 6:39922923-39922945 AGATGGGTGCTGGTGGAGGAAGG - Intronic
1007590944 6:43020754-43020776 AGATGACAGCAGGCTCAGGAGGG - Exonic
1007713457 6:43839131-43839153 TGATGAGGGCGGGAGCAGGAAGG + Intergenic
1008645944 6:53514898-53514920 AGATGAGGGAGGGAGGAGCAAGG - Intronic
1009828392 6:68897593-68897615 AGGGGAGGGCAGGAAGAGGAAGG + Intronic
1009828422 6:68897724-68897746 AGGGGAGGGCAGGAAGAGGAAGG + Intronic
1011111168 6:83837925-83837947 AGCTTAGGTCAGGCTGAGGACGG - Intergenic
1015212489 6:130714036-130714058 AGATAAGAGCCAGCGGAGGATGG + Intergenic
1016896580 6:149059832-149059854 AGATGAGGGCAGCTGTTGGACGG - Intronic
1017010259 6:150058483-150058505 AGAGGAGAGCAGGCGGGAGAGGG - Intergenic
1017542631 6:155418372-155418394 GGATGAGGGAAGGCTGAGGGTGG - Intronic
1017778758 6:157700042-157700064 AGATAAGGGCAGGTGGATGGTGG + Intergenic
1018101720 6:160446252-160446274 GGAGGAGGGCAGGCAGAGGCAGG + Intronic
1018768533 6:166952794-166952816 AGAGGAGGGGAAGCGGAGGCAGG + Intronic
1019058890 6:169241957-169241979 AGCTGAGGGCAAGCGTAGAAGGG + Exonic
1019224377 6:170498231-170498253 TGATGAGGGCAGGTTGATGACGG + Intergenic
1019427368 7:983964-983986 AGTTGGGGGCAGCCGGAGGCAGG - Intronic
1019603539 7:1897346-1897368 AGATGAGGACAGGCAGAGACGGG - Intronic
1019729550 7:2622679-2622701 AGGTGGGGGCAGGAGGAGCAGGG - Intergenic
1019729561 7:2622704-2622726 AGATGGGGGCAGGAGGAGCAGGG - Intergenic
1020329443 7:7002792-7002814 AGAACAAAGCAGGCGGAGGAAGG - Intergenic
1021239041 7:18178067-18178089 AGGGGAGGGGAGGTGGAGGAGGG - Intronic
1021486681 7:21175627-21175649 AGATGAAGGCAGGATGAGGAGGG + Intergenic
1021604630 7:22397543-22397565 AGATGGGGAAAGGCCGAGGAAGG + Intergenic
1021807933 7:24375336-24375358 TGATGAGAGCAGGTGGATGATGG - Intergenic
1022233743 7:28440901-28440923 AGAAGAGGGCACGCTGAGGTTGG + Intronic
1023517011 7:41011210-41011232 AGATGAGATCAGGCAGAGGGAGG + Intergenic
1023876108 7:44287111-44287133 AGCTGGGGGAAGGCGCAGGAGGG + Intronic
1023878683 7:44306727-44306749 GGGTGTGGGCAGGAGGAGGAGGG + Intronic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878835 7:44307296-44307318 GGGTGTGAGCAGGCGGAGGAGGG + Intronic
1023982995 7:45080466-45080488 AGCTGAGGGAAGGCGTAGGATGG + Exonic
1024009894 7:45258701-45258723 GGCTGAGGTCAGGGGGAGGATGG + Intergenic
1024404690 7:48964715-48964737 AGATTATGGCAGATGGAGGATGG - Intergenic
1025709023 7:63890861-63890883 AGATGGGGAGAGGAGGAGGAGGG + Intergenic
1025945110 7:66099274-66099296 GGAGGAGGGGAGGAGGAGGAGGG + Intronic
1025945138 7:66099349-66099371 GGAGGAGGGGAGGAGGAGGAGGG + Intronic
1026360650 7:69598892-69598914 AGGAGAAGGGAGGCGGAGGAAGG - Intergenic
1026479744 7:70767236-70767258 AGATGGGGGGAGGGAGAGGAAGG - Intronic
1026938029 7:74270253-74270275 AGAGGAGGGGAGGGAGAGGAGGG - Intergenic
1026938035 7:74270267-74270289 AGAGGAGGGGAGGGAGAGGAGGG - Intergenic
1026976041 7:74499071-74499093 GGAGGAGGGCAGGCGGAGCCTGG + Intronic
1026977507 7:74507520-74507542 AGATGATGGCAGGACCAGGAAGG + Intronic
1028417610 7:90596456-90596478 AGCAGCAGGCAGGCGGAGGACGG - Intronic
1028952004 7:96646659-96646681 AGAGGATGGCAGTCGGAGGTGGG - Intronic
1029117624 7:98245317-98245339 TGAGCAGGGCAGGCGGTGGAGGG + Intronic
1029426255 7:100495815-100495837 AGATGGGGGCAGGGGGAGGTAGG + Intergenic
1030185041 7:106753433-106753455 TGCTGAGGGCTGGGGGAGGAAGG - Intergenic
1030716728 7:112816275-112816297 AGGTGAGGGCAGGTGGGGGGAGG - Intergenic
1031361728 7:120856899-120856921 TGCTGAGGGCGGGTGGAGGAGGG - Intronic
1031806683 7:126316166-126316188 ACATGGTGGCAGGAGGAGGAGGG + Intergenic
1032240135 7:130153719-130153741 AGAAGACGGCAGGCCGAGGCCGG - Intergenic
1032401969 7:131629980-131630002 TGGGGAGGGCAGGCAGAGGAGGG + Intergenic
1032410738 7:131692023-131692045 AAAGGAGAGCAGGGGGAGGAGGG - Intergenic
1032492066 7:132331223-132331245 AGCTGAGAGCAGGAGGAAGATGG + Intronic
1032848604 7:135773011-135773033 AGCCAATGGCAGGCGGAGGATGG - Intergenic
1033327395 7:140390874-140390896 AAATGAGGACAGGAGGGGGATGG - Intronic
1033478670 7:141716391-141716413 AGAGGAGGGGAGGGTGAGGAAGG - Intronic
1034228648 7:149501835-149501857 AGCAGAGGCCAGTCGGAGGAGGG - Intergenic
1034374510 7:150630477-150630499 AGGTGGGGGGAGGTGGAGGAAGG + Intronic
1034789591 7:153956191-153956213 AGATGTGGGCAGGTGGGGGCTGG + Intronic
1034975948 7:155449386-155449408 AGGGGAGGGGAGGGGGAGGAAGG - Intergenic
1035230597 7:157463649-157463671 AGATGAGGATGGGGGGAGGATGG - Intergenic
1036442970 8:8797571-8797593 GGATGGGGGCAGGGGGAGAAGGG + Intronic
1037192695 8:16146492-16146514 AGATTAGGGTATGCGGAGAAGGG - Intronic
1037362739 8:18091125-18091147 AGCTGAGGGCAGGGTGAGGATGG - Intergenic
1037525863 8:19723583-19723605 AGATGAAGGCATGAAGAGGAAGG + Intronic
1037760433 8:21738209-21738231 GGAAGAGGGGAGGAGGAGGAGGG - Intronic
1037769137 8:21788920-21788942 AGAAGGGGGCGGGCGGAGGGAGG - Intronic
1037804507 8:22051546-22051568 AGCTGAGGGCAGGCCGAGGGGGG - Intronic
1038542607 8:28402207-28402229 AGAAGAGGGGAGGAGGAGGGAGG + Intronic
1038637643 8:29300504-29300526 ATACGGGGGCAGGGGGAGGAGGG - Intergenic
1038708773 8:29921533-29921555 AGATGACAGAAGGCTGAGGATGG + Intergenic
1039081366 8:33737212-33737234 AAATGAGGGCGGAGGGAGGAGGG + Intergenic
1040030565 8:42819893-42819915 AGCTGAGGGCAGGCAGAGCGCGG - Intergenic
1040526151 8:48226829-48226851 AGAGGAGTGCAGACTGAGGATGG - Intergenic
1040677276 8:49765699-49765721 AGAACAAGGCAGGCCGAGGAAGG + Intergenic
1041383834 8:57278971-57278993 AGCTGAGCCCAGGCGGAGGCTGG - Intergenic
1041650432 8:60296993-60297015 GGATGAAGGTAGGCTGAGGAGGG - Intergenic
1041673838 8:60517693-60517715 AGATGCGTGCTGGTGGAGGAAGG - Intronic
1042959462 8:74288170-74288192 AGAAGAGGGCAGATGGAGGCGGG + Intronic
1044016527 8:87053417-87053439 AGAGGAGTGCAGGCTGAGGATGG + Intronic
1044641597 8:94388232-94388254 AGAGGAGAGGAGGCAGAGGAGGG - Intronic
1044767976 8:95597181-95597203 AGAGGAGGGGAGGAGGGGGAGGG - Intergenic
1045883582 8:107069531-107069553 AGATGTGGGCTGCCCGAGGAAGG + Intergenic
1046195350 8:110856706-110856728 ACATGAGGGCAGAGGGTGGAAGG + Intergenic
1047224894 8:122947922-122947944 AGATCATGGCAGGCGGAGGCTGG + Intronic
1048461303 8:134623768-134623790 AGAGGAGGGCAGGGAGAAGAGGG - Intronic
1048610002 8:136011911-136011933 AGTTTGGGGCAGGGGGAGGAGGG - Intergenic
1048924462 8:139259087-139259109 ATATGAGGGCAGGAGGGGAAAGG - Intergenic
1049241796 8:141541562-141541584 ACATGTGTGCAGGCGGAGCAAGG + Intergenic
1049313506 8:141946690-141946712 AGATGAGGGCGAGAGGGGGAAGG + Intergenic
1049541545 8:143211339-143211361 AGATGACGGGAGGCGGTGCACGG + Intergenic
1050412919 9:5385022-5385044 AGATGAGGTCAGATGGAGGTGGG + Intronic
1051149966 9:14069555-14069577 ACATGAAGGCAGTCGGGGGAGGG - Intergenic
1051774865 9:20622301-20622323 AGCTGAGGGGGGGCGGAGGAGGG - Exonic
1054925641 9:70586031-70586053 AGATGAGAGCAGGAGGTGTAAGG - Intronic
1054961582 9:70975988-70976010 AGATAGGGGCTGGGGGAGGAAGG - Intronic
1054962428 9:70983595-70983617 ACTTGTGGGCAGGCAGAGGAAGG + Intronic
1054971277 9:71090497-71090519 AGATGAGGGCATGATGTGGAGGG - Intronic
1055654100 9:78436530-78436552 AGATGAGGCCAGGAGAAGCAGGG + Intergenic
1055804331 9:80076148-80076170 AGAGGAGGGGAGGTGGGGGATGG - Intergenic
1055956186 9:81775827-81775849 GGAGGAGGGGAGGAGGAGGATGG - Intergenic
1056379142 9:86041559-86041581 AGGTGAGGGCAGGCGCCGGGGGG - Intronic
1056381746 9:86062601-86062623 GGAGGAGGGCAAGAGGAGGATGG + Intronic
1056902790 9:90615792-90615814 AGATGAGGTCATGAGGAGGCTGG - Intronic
1057423548 9:94930550-94930572 AGAAGAGGTCAGGAGGAAGAGGG + Intronic
1059640297 9:116210146-116210168 AGAAGGGGGCAGGCAGAGGCAGG - Intronic
1060638900 9:125222058-125222080 AGAGGTGGGCAGGCAGAGGCAGG - Intronic
1061192083 9:129087922-129087944 AAATGAAGGCAGGTGGAGGCCGG - Intronic
1061374492 9:130215939-130215961 GGTTGAGGGGAGGAGGAGGATGG - Intronic
1061411743 9:130425653-130425675 AGAGGAGGGGAGGAGGAGGAGGG - Intronic
1061512165 9:131068057-131068079 AGCTGGGGGCAGGAGCAGGAAGG - Exonic
1061860451 9:133465207-133465229 GGATGAGGGCAGGAGGGTGAGGG + Intronic
1061865315 9:133489085-133489107 AGAGCAGGGCAGCAGGAGGATGG + Intergenic
1061917394 9:133762602-133762624 AAATGAGGGGAGGTGGAGGCAGG - Exonic
1062080828 9:134622551-134622573 AGAGAAGGGCAGACAGAGGAGGG - Intergenic
1062102925 9:134737852-134737874 AGGTGAGGGCCAGAGGAGGAGGG + Intronic
1062266838 9:135690447-135690469 AGCTGAGGGCAGGCAGGGGGAGG + Intergenic
1062340746 9:136092968-136092990 AGAACAGGGCTGGCTGAGGAAGG + Intronic
1062636435 9:137493995-137494017 ACCTGAGGGGAGGCGGTGGAGGG + Intronic
1203566926 Un_KI270744v1:99918-99940 AGAACAAAGCAGGCGGAGGAAGG - Intergenic
1185822538 X:3219302-3219324 AGATGGGGGCAGGAGGGGGCAGG + Intergenic
1185887121 X:3792732-3792754 GGAGGAGGGGAGGAGGAGGAAGG + Intergenic
1186455739 X:9708510-9708532 AGGTGAGTGGAGGCGGAGGGAGG - Intronic
1186637023 X:11417322-11417344 GGATGAGGGCAGGAGTAGGGTGG + Intronic
1187013879 X:15307378-15307400 AGATGAGGGTGGGCAGGGGATGG + Intronic
1187466825 X:19534829-19534851 AGAGGAAGGCAGGGGGAGGAAGG + Exonic
1187508704 X:19898516-19898538 AGACGGGGGCAGGGGGTGGAGGG - Intergenic
1189185189 X:39048829-39048851 AGATGAGTGTAGCCAGAGGAAGG + Intergenic
1189801845 X:44698794-44698816 AGATGAGGGCAGACAGGTGATGG - Intergenic
1190123049 X:47679320-47679342 GGATGAGGGCAGAAGCAGGAAGG + Intergenic
1190248885 X:48707669-48707691 AGGTGGGGGCAGGTGGAGGCAGG - Exonic
1190260365 X:48793423-48793445 AGATGGGGGAAGGGGGAGGAAGG - Intronic
1192141503 X:68650460-68650482 GGAGGAGGGGAGGAGGAGGAGGG + Intronic
1193103016 X:77636982-77637004 AGAAGAAGGAAGGAGGAGGAAGG + Intronic
1193103025 X:77637022-77637044 AGAAGAAGGAAGGAGGAGGAAGG + Intronic
1194098354 X:89671988-89672010 AGGAGAGGGAACGCGGAGGATGG - Intergenic
1195056286 X:101148618-101148640 ATATGCAGGCAGGTGGAGGAGGG + Intronic
1196128194 X:112122448-112122470 AGGTGAGGGAAGGCGAGGGATGG + Intergenic
1196783246 X:119400842-119400864 TGATGAGGGCAAGCAGAGGTGGG - Intronic
1196804627 X:119573855-119573877 AGCTTAAGGCAGGCGGAGTAGGG - Intergenic
1196965182 X:121047666-121047688 ACATCGCGGCAGGCGGAGGAGGG - Exonic
1197270777 X:124422777-124422799 AGTGGAGGGCAGGGGGAGGATGG + Intronic
1198683504 X:139205059-139205081 AGGTGTGGGCACGCGGAGGGTGG + Intronic
1198759579 X:140017542-140017564 ATAGGAGTGCAGGCTGAGGAAGG - Intergenic
1198779209 X:140216508-140216530 ATAGGAGTGCAGGCTGAGGAAGG + Intergenic
1198799176 X:140432114-140432136 AGATGAAGGAAGGTGGAGAAAGG + Intergenic
1199580073 X:149351927-149351949 GGTTGGGGGCAGTCGGAGGAGGG - Intergenic
1199717770 X:150518503-150518525 AGAGGAGGGCAGGCAGGAGAGGG + Intergenic
1199860528 X:151797037-151797059 AGATGAAGCCAGGCTTAGGAGGG - Intergenic
1200251065 X:154554044-154554066 AGCTCAGGTCAGGCGGAGCAGGG - Intronic
1202304390 Y:23452916-23452938 AAATGAGAGCACGTGGAGGAAGG - Intergenic
1202566420 Y:26217675-26217697 AAATGAGAGCACGTGGAGGAAGG + Intergenic