ID: 1152532543

View in Genome Browser
Species Human (GRCh38)
Location 17:80927820-80927842
Sequence GAGATGAGGGCAGGCGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 976
Summary {0: 1, 1: 0, 2: 3, 3: 76, 4: 896}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152532543_1152532557 26 Left 1152532543 17:80927820-80927842 CCTCCTCCGCCTGCCCTCATCTC 0: 1
1: 0
2: 3
3: 76
4: 896
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1152532543_1152532552 16 Left 1152532543 17:80927820-80927842 CCTCCTCCGCCTGCCCTCATCTC 0: 1
1: 0
2: 3
3: 76
4: 896
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532543_1152532556 25 Left 1152532543 17:80927820-80927842 CCTCCTCCGCCTGCCCTCATCTC 0: 1
1: 0
2: 3
3: 76
4: 896
Right 1152532556 17:80927868-80927890 CGCCCGCACGGAGGAGCTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 157
1152532543_1152532553 22 Left 1152532543 17:80927820-80927842 CCTCCTCCGCCTGCCCTCATCTC 0: 1
1: 0
2: 3
3: 76
4: 896
Right 1152532553 17:80927865-80927887 TCCCGCCCGCACGGAGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 358
1152532543_1152532551 13 Left 1152532543 17:80927820-80927842 CCTCCTCCGCCTGCCCTCATCTC 0: 1
1: 0
2: 3
3: 76
4: 896
Right 1152532551 17:80927856-80927878 TCTGAGAATTCCCGCCCGCACGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152532543 Original CRISPR GAGATGAGGGCAGGCGGAGG AGG (reversed) Intronic
900117886 1:1036253-1036275 GGGATGATGGCTGGAGGAGGTGG + Intronic
900300799 1:1976174-1976196 GAGGTGACGGCAGGAAGAGGTGG - Intronic
900374337 1:2346720-2346742 GAGATGGGGGAAGGAGAAGGGGG - Intronic
900789897 1:4672914-4672936 GAGATGAGGGCAGGAGGGTGAGG + Intronic
901045380 1:6393022-6393044 GAGATGCGGCCAGGAGGAGCCGG + Intronic
901232494 1:7648977-7648999 GCGAGGAGGGCAGGCGTTGGAGG + Intronic
901427396 1:9191173-9191195 AAGATGAGCACAGGCAGAGGCGG - Intergenic
901621899 1:10595303-10595325 GAGAGGAGGGGAGGCGAAGAGGG - Intronic
901799862 1:11701730-11701752 GGGCTGCGGGGAGGCGGAGGGGG + Intronic
902705199 1:18199669-18199691 GAGACCAGGGAAGGGGGAGGGGG - Intronic
902726231 1:18337972-18337994 GAGGGGAGGGCCGGGGGAGGCGG + Intronic
902762018 1:18587437-18587459 GGGATGAGGGCAGGGAAAGGAGG + Intergenic
902837805 1:19058149-19058171 GACCTGAGGGAAGGGGGAGGGGG + Intergenic
903034715 1:20486239-20486261 GGGAGGAGGGCGGGAGGAGGCGG + Intergenic
903088227 1:20883329-20883351 GAAATGAGGGCCGGGGGTGGTGG + Intronic
903140784 1:21338057-21338079 GGGATGAGGGAGGGCAGAGGGGG - Intronic
903191838 1:21660938-21660960 GAGCTGGGGACAGGAGGAGGAGG + Intronic
903846607 1:26282844-26282866 GAGGTGAGGGCGGGATGAGGAGG - Exonic
904010042 1:27384048-27384070 GAGAGGAGGGGAGGAGGAAGAGG - Intergenic
904013873 1:27405905-27405927 GGGCTGGGGGCAGGAGGAGGTGG - Exonic
904657127 1:32057507-32057529 GAGATGAGGTCAGCCGGGCGTGG + Intronic
905735029 1:40318946-40318968 AAGATGAGAGCAAGAGGAGGAGG + Intergenic
905773610 1:40654114-40654136 GATGGGAGGGCAGGCGGGGGAGG - Intronic
905900087 1:41575599-41575621 GAGGAGAGGGGAGCCGGAGGAGG - Exonic
906044431 1:42817107-42817129 GGGAAGAGGGCAGGAGGCGGGGG - Intronic
906610544 1:47198896-47198918 GAGAAGATTGCAGGAGGAGGAGG + Intergenic
906627825 1:47339996-47340018 GGGAAGAGGGCAGCCGGATGCGG - Intronic
906668084 1:47635760-47635782 AAGAAGAGGGGAGGCAGAGGAGG - Intergenic
906672722 1:47668457-47668479 GAGGTGAGAGAAGGAGGAGGTGG + Intergenic
906711101 1:47930508-47930530 GGGAGGAGGGCAGGCAGAGCAGG - Intronic
907241389 1:53083200-53083222 GAGATGAGAGAGGGCAGAGGTGG + Intronic
907464803 1:54627920-54627942 GAAATGTGGGGAGGCGGAGGGGG + Intronic
907766867 1:57421888-57421910 GAGATGGGGGGTGGCGGGGGGGG + Intronic
907865515 1:58396110-58396132 GAGAAGAGGGCAGGGGAGGGAGG + Intronic
908320397 1:62972810-62972832 GAGGAGAGGGAAGGAGGAGGAGG + Intergenic
908883341 1:68758683-68758705 AAGATGAGGGCAGGTGGGGAGGG + Intergenic
910777713 1:90892554-90892576 GAGGGGAGGGGAGGGGGAGGGGG + Intergenic
911095297 1:94049946-94049968 GAGAGGAAGGCAGGGGCAGGAGG + Intronic
912203623 1:107485893-107485915 GTGATGAGAGAAGGCAGAGGGGG - Intergenic
912215694 1:107608657-107608679 CAGAGGAGGGAAGGTGGAGGAGG + Intronic
912405051 1:109430687-109430709 GGGATGAGAGCAGGAGAAGGTGG - Intergenic
912406515 1:109443135-109443157 GAGAAGAGGGCAGGCTTATGGGG + Intergenic
912762763 1:112383735-112383757 GGGCTGAGGGGAGGGGGAGGTGG - Intergenic
913056017 1:115160081-115160103 GAGGGGAGGGCAGGGGAAGGGGG + Intergenic
913118068 1:115714807-115714829 GAGGTGAGGGCAGGGGGATAGGG - Intronic
913169853 1:116222062-116222084 GAGAGGAGGGGAGGTGGAGCTGG + Intergenic
913302575 1:117387957-117387979 GAGATGACGGCGGGGGGTGGGGG - Intronic
914801422 1:150965458-150965480 GAGAAGAGGGAAGGGGGAAGAGG + Exonic
914912531 1:151799402-151799424 GAGAGGAGAGGAGTCGGAGGAGG - Intergenic
915277740 1:154801119-154801141 GAGATGAGGAAAGGAGGTGGGGG + Intronic
915465276 1:156093966-156093988 CAGATGAGGGCAGGCTGCGAGGG - Intronic
915476202 1:156154207-156154229 GAGAAGAGGGAAGGCAAAGGAGG + Intronic
915516504 1:156415875-156415897 GGGATTAGGGCAGGAGGAGGAGG + Intronic
915592883 1:156880566-156880588 GCTAGGAGGGCAGGGGGAGGGGG - Intronic
915626965 1:157119835-157119857 GAGATGAGGCCTGGAGGATGAGG - Intergenic
915881192 1:159673389-159673411 GAGAAGAGGGCAAGGGGTGGGGG - Intergenic
915910817 1:159914151-159914173 GGGAGGAGGGCAGGAGGAAGAGG - Intergenic
916332052 1:163628297-163628319 GGGAGGAGGGGAGGAGGAGGGGG - Intergenic
917565324 1:176207034-176207056 GAGGGGAGGGGAGGCGGCGGAGG - Exonic
917820504 1:178758529-178758551 GGGATGAGGGCAGGGGGGGTAGG - Intronic
918006059 1:180543151-180543173 AAGAAGAGGGGAGGGGGAGGAGG + Intergenic
918065337 1:181096883-181096905 GTGATGTGGGGAGGTGGAGGAGG + Intergenic
918142582 1:181731959-181731981 GAGATGAGGGGGAGAGGAGGAGG + Intronic
920051748 1:203168552-203168574 GAGAGGAGGCCAGGAGCAGGGGG - Intronic
920082285 1:203383567-203383589 GGGATGATGGCAGGAGGAAGAGG + Intergenic
920099418 1:203507715-203507737 GAGAATGGGGCAGGCAGAGGGGG - Intronic
920350867 1:205337074-205337096 GAGATGGGGGTGGGGGGAGGTGG + Exonic
920423884 1:205857941-205857963 GAGGTGAGGGCATGAGGACGTGG - Intergenic
920835035 1:209502717-209502739 AGGATGAGGGCAGGGGTAGGTGG + Intergenic
921397081 1:214679850-214679872 GAGAAGGGGGGAGGAGGAGGAGG - Intergenic
922006014 1:221531462-221531484 GAGAAGAGAGCAGGGGGAGGGGG - Intergenic
922160971 1:223078986-223079008 GAGAAGAGGCCAGAGGGAGGAGG + Intergenic
922648684 1:227318385-227318407 GAGGAGAGGGAAGGCGGGGGAGG - Exonic
922697422 1:227737776-227737798 GATATGAGGGCAGGGACAGGAGG + Intronic
922856376 1:228778531-228778553 GAGACCAGGGCAGGGGGAGGGGG - Intergenic
922936338 1:229425923-229425945 GGGATGAGAGGAGGAGGAGGAGG + Intergenic
923052195 1:230396562-230396584 CAGATGAATGCAGGGGGAGGGGG - Intronic
923452185 1:234128499-234128521 GAGGTGAGGAATGGCGGAGGTGG + Intronic
923482533 1:234397629-234397651 GGGAAGAGGGGAGGGGGAGGGGG + Intronic
923569571 1:235101611-235101633 GAGGGGAGGGGAGGGGGAGGCGG + Intergenic
923811020 1:237316020-237316042 GAGATGGGGGCAGGGGGATCAGG + Intronic
1063462154 10:6221743-6221765 GAGGTGAGCGCAGGCTGGGGCGG + Exonic
1063477667 10:6343133-6343155 GAGAGGAGGCCAGGTGGAGTTGG + Intergenic
1063520639 10:6737577-6737599 GAGCTGAGTGCAGCTGGAGGTGG - Intergenic
1063652902 10:7957296-7957318 GAGATTAGGGCAGACGGCTGAGG + Intronic
1064194532 10:13234353-13234375 GAGAGGAAGGAAGGCGGGGGAGG + Intergenic
1065916561 10:30358380-30358402 GAGAAGAGGGAAGCCCGAGGGGG + Intronic
1068650522 10:59517762-59517784 GAGAAGTGGGAAGGAGGAGGGGG - Intergenic
1068839016 10:61589401-61589423 GAGATGGGGCCAGGAGGTGGAGG + Intergenic
1069049360 10:63776430-63776452 GAGATGTGAGAAGGAGGAGGAGG - Intergenic
1069716250 10:70523229-70523251 GAGCTGGGGGCAGGCAGGGGAGG + Intronic
1069750819 10:70744034-70744056 GAGGTGAGGTCAGTGGGAGGAGG - Intronic
1069994136 10:72332332-72332354 GAGAGGAGGGCGGGCTGCGGGGG + Intergenic
1070539284 10:77404606-77404628 AAGATTAGGGCATGCTGAGGAGG + Intronic
1071297849 10:84235312-84235334 GAGATGGGGTGAGGGGGAGGTGG - Intronic
1071526604 10:86363138-86363160 GAGAGGAGGGAAAGCAGAGGGGG + Intronic
1072327378 10:94311732-94311754 TAGATGAGGACAGACAGAGGTGG - Intronic
1072426763 10:95336744-95336766 GAGAGGGGGGCAGGCGAAAGAGG - Exonic
1072734316 10:97868745-97868767 GAGATGAGGTCCTGGGGAGGGGG + Exonic
1073066005 10:100759572-100759594 GGACTGAGGGCAGGCAGAGGAGG - Intronic
1073424439 10:103447783-103447805 GAGATGATGGCAGGGGAAGGAGG - Intronic
1073462124 10:103671836-103671858 GAGATGAAGGCAGGGACAGGAGG - Intronic
1073592161 10:104767711-104767733 AAGGGGAGGGGAGGCGGAGGGGG - Intronic
1073812349 10:107164644-107164666 GCGGTGGGGGCGGGCGGAGGCGG + Intergenic
1073956023 10:108872311-108872333 GAGGTAAGGGAAGGAGGAGGGGG + Intergenic
1074779426 10:116790432-116790454 GGGCTGAGGGCAGGAAGAGGAGG - Intergenic
1074884107 10:117681421-117681443 GAGATGTGTGGAGGCGGGGGTGG + Intergenic
1074923774 10:118046708-118046730 GAGCTGAGGCGAGGGGGAGGAGG - Intergenic
1075069513 10:119311452-119311474 GAGATGGGGGCAGTGGGTGGGGG + Intronic
1075077352 10:119360080-119360102 GAGATAGGGGGAGGCTGAGGAGG + Intronic
1075464678 10:122642600-122642622 GGGCTCAGGGCAGGCTGAGGAGG + Intronic
1075623774 10:123947164-123947186 GGGAGGAGGGCAGGCAGACGTGG + Intergenic
1075742660 10:124705298-124705320 GGCAGGAGGGAAGGCGGAGGCGG + Intronic
1075856996 10:125638156-125638178 GGGATGGGGGCTGGGGGAGGGGG - Intronic
1075934476 10:126327592-126327614 GAGATGAGGGGGTGGGGAGGGGG - Intronic
1076073931 10:127517044-127517066 GAGAGGGGGGCTGGTGGAGGGGG + Intergenic
1076236462 10:128867276-128867298 GAGCAGATGGCAGGAGGAGGAGG + Intergenic
1076406781 10:130217507-130217529 GAGATGAGGGGAGGGGCACGGGG - Intergenic
1076518792 10:131066388-131066410 GACATGAGGGCATGTAGAGGAGG - Intergenic
1076536963 10:131184980-131185002 GAGATTACGGCAGGCTGAGGTGG + Intronic
1076596047 10:131624236-131624258 GAGGTGGGGGGAGGTGGAGGAGG + Intergenic
1076882887 10:133248125-133248147 GAGATAAGGGTTGGAGGAGGCGG - Intergenic
1077299229 11:1839525-1839547 GAGGTGAGAGTAGGGGGAGGAGG + Exonic
1077307035 11:1873076-1873098 GAGATGGAGGCAGGGAGAGGTGG + Intronic
1077523743 11:3051447-3051469 GAGATCAGGGAGGACGGAGGCGG + Intronic
1078412742 11:11140916-11140938 GAGATGTGGGCACTGGGAGGTGG + Intergenic
1078548023 11:12260312-12260334 CTGATAAGGCCAGGCGGAGGTGG - Intronic
1078634069 11:13032753-13032775 GAATTGTGGGCAGGAGGAGGTGG + Intergenic
1079209511 11:18448878-18448900 GGGAAGAGGGTAGGCTGAGGAGG + Intronic
1079238303 11:18705139-18705161 GAGATGAGAGGTGGGGGAGGGGG + Intronic
1079403019 11:20121420-20121442 GAGAGGAGGGGAGGAGGAAGGGG - Intronic
1079995783 11:27293624-27293646 GAGGGGAGGGGAGGCGGAGGGGG + Intergenic
1080160080 11:29163262-29163284 GAGATGAGCGCAGGGGATGGAGG - Intergenic
1080779802 11:35419587-35419609 GAGATGGGGGCGGGGGGCGGCGG - Intronic
1081527529 11:43936881-43936903 TAGAAGAGGGCAGGAGGGGGGGG - Intronic
1081831800 11:46121143-46121165 GAGAGGAGAGGAGGAGGAGGAGG - Intronic
1081845292 11:46237129-46237151 GAGGGGAGGGGAGGCGAAGGGGG + Intergenic
1082023982 11:47557820-47557842 GAGACAAGGGCAGGGCGAGGTGG - Intronic
1082097549 11:48143771-48143793 GGGAGGAGGGGAGGGGGAGGAGG - Intronic
1082097557 11:48143785-48143807 GAGGAGAGGGGAGGGGGAGGAGG - Intronic
1082770090 11:57201185-57201207 GAGATGAGGGTGGGCAGAAGGGG - Intergenic
1083484664 11:62975854-62975876 GAGAAGAGGGAAGGGGGAGTGGG - Intronic
1083583317 11:63839098-63839120 GAGCCGAGGGCCGGCGGTGGTGG + Exonic
1083599871 11:63939819-63939841 AAGATGCGGGGAGGCGGGGGCGG + Intronic
1083717788 11:64588440-64588462 GAGATGTGAGCAGGCAAAGGGGG + Intergenic
1083737324 11:64688863-64688885 GAGAGTAGGGAGGGCGGAGGGGG - Intronic
1083802241 11:65053376-65053398 GAGAGGTGGGCAGGGGGAGCTGG + Intronic
1083847562 11:65344957-65344979 GAGAGGATGGCAGGAGGAGGTGG - Intronic
1084092228 11:66886202-66886224 GGGAGGGGGGCAGGCAGAGGAGG + Intronic
1084369974 11:68734895-68734917 GAGGTGAGGGCAGGCCAAGTGGG - Intronic
1084742711 11:71149928-71149950 GAGAGGAGGGGAGGGGAAGGAGG + Intronic
1084858195 11:72002062-72002084 GAGAGAATGGCAGGAGGAGGAGG - Exonic
1085243752 11:75080437-75080459 GAGGTGGGGGCAGTAGGAGGAGG - Intergenic
1085463549 11:76709490-76709512 GTGCTGAGGGCTGGGGGAGGAGG + Intergenic
1085529501 11:77183155-77183177 GAGGTGAGGGCAGACGCTGGGGG + Exonic
1085555865 11:77421133-77421155 GAGATGAGGGGAGGAGGTAGAGG - Intronic
1086073818 11:82828846-82828868 GAGAAGATGGCAGGAGGAGCTGG - Intronic
1086144961 11:83541607-83541629 GAGATGAGGGAAGAAGAAGGTGG - Intronic
1087137386 11:94734660-94734682 GAGAGGAGGGGAGGAGGAGCGGG + Intronic
1088359810 11:108978335-108978357 GGGATGAGGAGAGGAGGAGGCGG - Intergenic
1088510085 11:110565201-110565223 GAGATGAGGGCAGGATGAAGTGG + Intergenic
1089072371 11:115710556-115710578 GAGATGGGGGGAGGCGATGGAGG + Intergenic
1089111797 11:116063129-116063151 GGGATGGGGGTAGGAGGAGGTGG + Intergenic
1089201266 11:116725971-116725993 GGGCTGAGGGCAGGCCCAGGAGG + Intergenic
1089216357 11:116836962-116836984 GGGTTGAGGGCAGGGGTAGGGGG - Intronic
1089257357 11:117200880-117200902 GACATGAGGGCAGGTGGAGTGGG + Intronic
1089320147 11:117620358-117620380 GAGGAGAGGGGAGGAGGAGGAGG - Intronic
1089505304 11:118958341-118958363 GAGAGGAGGGCAGGAGGAGGAGG - Exonic
1090178680 11:124674138-124674160 CAGAGGAGGGCGGGCGGAGGGGG - Exonic
1090270095 11:125379988-125380010 GTGATGAGGGTAGGGGGTGGAGG + Intronic
1090278454 11:125435906-125435928 GAGATGCGGGCAGGTGGGGGCGG - Intergenic
1090423946 11:126594185-126594207 GAGAAGAAGGCAGGCAGAAGAGG + Intronic
1090693741 11:129215160-129215182 GAGATGAGGGCTGGGGGTTGTGG - Intronic
1090933323 11:131319394-131319416 GAGGGGAGGGGAGGGGGAGGAGG - Intergenic
1090935905 11:131342062-131342084 GAGGTGCAGGCAGGCAGAGGGGG + Intergenic
1091070517 11:132558417-132558439 GGGAGGAGGGGAGGAGGAGGAGG - Intronic
1091301256 11:134509659-134509681 GGGCTGAGGGCAAGGGGAGGAGG - Intergenic
1091568292 12:1663085-1663107 GACAGGAGGGCAGGCTGGGGCGG - Intergenic
1092261548 12:6955800-6955822 GAGATGAGGGGAGGCAGCTGGGG - Intronic
1092777793 12:11959432-11959454 GGGAGGAGGACAGGCGGTGGTGG - Intergenic
1093256216 12:16871514-16871536 GAGAGGAGGTCAGGAGTAGGTGG + Intergenic
1094079399 12:26516176-26516198 GAGGGGAGGGGAGGCGGGGGAGG + Intronic
1096115641 12:49053400-49053422 AAAATGAGGGCAGTCGGAGAAGG - Intronic
1096159852 12:49367392-49367414 GAGAAGTGGGGAGGCGGCGGTGG + Intronic
1096319411 12:50598743-50598765 GAGGGGAGGGGAGGGGGAGGGGG - Intronic
1096413136 12:51391464-51391486 GAGGCGAAGGCTGGCGGAGGAGG + Intronic
1096515180 12:52151815-52151837 GAGTTGTGGGCAGGAGGAGTGGG + Intergenic
1097161747 12:57051075-57051097 GAGAGGATGGTAGGCAGAGGGGG - Intronic
1097990102 12:65825047-65825069 GAGAAGAGGGGAGGAGGAGGAGG - Exonic
1098635962 12:72783949-72783971 GAGATGAGGCCATGTGGAGAAGG - Intergenic
1099016371 12:77348388-77348410 GAGCAGAGGGAAGGGGGAGGAGG + Intergenic
1099313298 12:81054410-81054432 GAGTGGAGGGTAGGAGGAGGGGG + Intronic
1100256332 12:92886621-92886643 GAGAGGAGGGGAGGGGGAAGGGG + Intronic
1100308876 12:93376701-93376723 GAGCTGAGGGCTGAAGGAGGAGG - Intergenic
1100782082 12:98037784-98037806 GAAATGAGGGAAGGAGGAGATGG + Intergenic
1100875320 12:98955746-98955768 GAGATGGGGGAAGGCTGCGGTGG + Intronic
1101001378 12:100361506-100361528 GAGAAGAGGGCAGGAGGAGGAGG - Intronic
1101039925 12:100745012-100745034 AAGTGGAGGGCAGGAGGAGGTGG - Intronic
1101843101 12:108341937-108341959 GAGGAGAGGGGAGGGGGAGGAGG + Intergenic
1101930086 12:109006690-109006712 GTGATGAGGGCAGGTAGATGTGG + Intronic
1102019345 12:109670838-109670860 GAGGTGAGGGGAGGAGAAGGAGG - Intergenic
1102115691 12:110401525-110401547 GAGATGAGGACCGTCGCAGGAGG + Intronic
1102482833 12:113235780-113235802 AAGATGGGGGCAGGAGGAGATGG + Intronic
1103760843 12:123249401-123249423 GGGAGCAGGGCAGGGGGAGGGGG + Intronic
1103902456 12:124310485-124310507 GAGCTGTGGGGAGGGGGAGGTGG + Intronic
1104451763 12:128874769-128874791 GACATGAGGGCTGGGTGAGGTGG - Intronic
1104503619 12:129310041-129310063 TAGATGAGGGCTGGCCGAGGAGG + Intronic
1104503624 12:129310070-129310092 TAGATGAGGGCTGGCCGAGAAGG + Intronic
1104544456 12:129698636-129698658 GAGGGGAGGGGAGGGGGAGGGGG + Intronic
1104788559 12:131467405-131467427 GAGATTGGGGCAGACGGAGATGG + Intergenic
1104914399 12:132257434-132257456 GGGATGAGGGCATGGGGACGAGG - Intronic
1104914421 12:132257488-132257510 GGGATGAGGGCATGAGGACGAGG - Intronic
1104933748 12:132353766-132353788 GGGATGGTGGCAGGAGGAGGGGG - Intergenic
1105007340 12:132729528-132729550 GAGGTGAGGGAAGGGGGAGGGGG + Intronic
1105007377 12:132729607-132729629 GAGGTGAGGGGAGGGGGAGGGGG + Intronic
1105251973 13:18707354-18707376 GAAATTAGGGCAGGCAGAAGGGG - Intergenic
1105388987 13:19958501-19958523 GAGTCGAGGGCCGGCGGAGGCGG + Intergenic
1105700668 13:22933489-22933511 GGGATGGGTGCAGGTGGAGGTGG - Intergenic
1105853463 13:24355644-24355666 GGGATGGGTGCAGGTGGAGGTGG - Intergenic
1106301348 13:28469063-28469085 GGGAAGAGGGGAGGAGGAGGAGG - Intronic
1106408834 13:29497035-29497057 GAGCCGAGGGCAGGCGTTGGGGG + Intronic
1106512219 13:30421848-30421870 GAGGTGGGGGAGGGCGGAGGAGG + Intergenic
1106796163 13:33208212-33208234 GATATGAGGACAGTGGGAGGTGG + Intronic
1107034918 13:35891881-35891903 GAGATCAGGGCAGATGGAGGGGG + Intronic
1107851663 13:44577401-44577423 GGGGAGGGGGCAGGCGGAGGAGG + Intergenic
1108135175 13:47349065-47349087 AAAATGAGGGGAGGTGGAGGGGG + Intergenic
1110053918 13:70940757-70940779 GAGATGAGATCAGGAGGAGAAGG + Intergenic
1110552864 13:76827911-76827933 GGGAAGAGGGAAGGGGGAGGGGG + Intergenic
1110681852 13:78323156-78323178 GAAATGAGTGCAGGAAGAGGTGG - Intergenic
1110759772 13:79218817-79218839 GAGATGGAGGCAGGATGAGGGGG - Intergenic
1112350160 13:98626379-98626401 GAGGGGAGGGGAGGGGGAGGAGG + Intergenic
1113086072 13:106570598-106570620 GAGATGACGGTATGAGGAGGTGG - Intergenic
1113086080 13:106570630-106570652 GAGATGACGGTATGAGGAGGTGG - Intergenic
1113257986 13:108528619-108528641 GAGAGGAGGGGAGGGGGAGAGGG - Intergenic
1113385633 13:109845160-109845182 GGGATGCGGGCTGGCGGAAGGGG - Intergenic
1113651878 13:112039288-112039310 GAGTTGAGGGCCGCTGGAGGAGG - Intergenic
1113655106 13:112063079-112063101 GAGAGGAGGGCGGGCGGAGAAGG - Intergenic
1113671680 13:112179714-112179736 GTGATGAGTGCGGGAGGAGGCGG - Intergenic
1113706154 13:112434176-112434198 GCCATGAGGGGAGGAGGAGGAGG + Intronic
1113742828 13:112723288-112723310 GACAAGAGGGCGGGGGGAGGTGG - Intronic
1113868232 13:113543097-113543119 GGGCTGGGGGCAGGGGGAGGAGG - Intronic
1113909722 13:113836339-113836361 GGGAGGAGGGGAGGAGGAGGGGG + Intronic
1114318400 14:21526577-21526599 GAGGGGAGGGCGGGGGGAGGAGG - Intronic
1115498196 14:34027256-34027278 GAGGAGAGGGGAGGAGGAGGGGG + Intronic
1115724503 14:36198485-36198507 GGGAGGAGGGGAGGGGGAGGGGG + Intergenic
1115797839 14:36959194-36959216 GAGCTGTGGGCAGGCAGAGAAGG - Intronic
1116416959 14:44689789-44689811 GAGAGGAGAGGAGGAGGAGGAGG + Intergenic
1116426565 14:44798854-44798876 GGGAGGTGGGGAGGCGGAGGCGG - Intergenic
1118420005 14:65591650-65591672 GACATGAGGGGAAGCTGAGGAGG + Intronic
1118459562 14:65976062-65976084 GAGAAGGGGGAAGGAGGAGGAGG + Intronic
1118887715 14:69880157-69880179 GAGTTGTTGGCAGGCGGCGGGGG + Intronic
1119707507 14:76793417-76793439 GAGGAGAGGGGAGGAGGAGGAGG + Intronic
1121009467 14:90511554-90511576 GAGATCAGGGAAGGCCAAGGAGG + Intergenic
1121235203 14:92387058-92387080 GAGTGGAGGGCTGGTGGAGGTGG - Intronic
1121333075 14:93060050-93060072 GACCAGAGGGCAGGAGGAGGGGG + Intronic
1121423914 14:93834760-93834782 GAGATGATGGCAGCCTGATGGGG + Intergenic
1121501630 14:94442725-94442747 GAGATGGGGGCTGGGAGAGGAGG + Exonic
1122418493 14:101561333-101561355 GGGCTGAGGGCGGGCGCAGGCGG - Exonic
1122426274 14:101607857-101607879 GAGAGGAGGAGAGGTGGAGGAGG - Intergenic
1122469427 14:101956151-101956173 GAGATAACAGGAGGCGGAGGAGG - Intergenic
1122862118 14:104587410-104587432 GACATGTGGACAGGGGGAGGGGG - Intronic
1122937300 14:104966158-104966180 GAGGTGAGGGCAGGCAGGGCTGG + Intronic
1123121790 14:105920165-105920187 GAGAGGAGAGCAGAGGGAGGAGG + Intronic
1123975118 15:25546156-25546178 GAGATGGGGGAAGAAGGAGGTGG + Intergenic
1124720263 15:32105492-32105514 GAGAGGAGGAAAGGAGGAGGAGG + Intronic
1125580701 15:40783408-40783430 GAGAGGAAGGGAGGGGGAGGCGG + Intronic
1125609535 15:40961116-40961138 GAGGCCAGGGCAGGCTGAGGAGG - Intergenic
1125664205 15:41417311-41417333 CAGGTGAGGGCAGGCCGCGGAGG + Exonic
1125769412 15:42154882-42154904 GAGGTGAGGGCAGGCAGGGCTGG - Intronic
1126532186 15:49723154-49723176 GAAGTGAGGGCAGGCAAAGGAGG + Intergenic
1127005888 15:54569901-54569923 GATAGGAGGGCTGGAGGAGGTGG - Intronic
1127496672 15:59519434-59519456 GGGAGGAAGGCAGGCCGAGGCGG - Intronic
1127507585 15:59610949-59610971 GAGGGGAGGGGAGGGGGAGGGGG - Intronic
1127758322 15:62113948-62113970 GCCCTGAGGGCAGGTGGAGGGGG - Intergenic
1128373068 15:67054911-67054933 TAGAGGAGGGAAGGTGGAGGAGG + Intergenic
1128933281 15:71724763-71724785 GACATGAAGAGAGGCGGAGGAGG + Intronic
1129064991 15:72894946-72894968 GAGGTGGGGGCAGTGGGAGGGGG - Intergenic
1129154208 15:73707661-73707683 AAGATGGGGGAAGGCGGAGGAGG - Intronic
1129314414 15:74732522-74732544 GAGATGAGGGGAGGAAGCGGGGG + Intergenic
1129403611 15:75300534-75300556 GAGAAGAGGGAAGCCCGAGGGGG - Intergenic
1129488864 15:75904104-75904126 GTGAGGAGAGGAGGCGGAGGCGG + Intronic
1129666182 15:77580740-77580762 GAGCTGAGGGCAGGCCTTGGAGG - Intergenic
1129672968 15:77617258-77617280 GAGAAGAGGGAAGGAGGAGATGG - Intronic
1129760319 15:78125420-78125442 GAGAAGAGGGGAGGGGAAGGAGG - Intronic
1130015550 15:80183399-80183421 GAGGAGCGGGCAGGTGGAGGTGG + Intronic
1130136816 15:81188382-81188404 GAGCTGAGGGAAGGCAGAGCTGG + Intronic
1130226091 15:82059146-82059168 GAGAGGAGGGGAGGGGGAGGAGG - Intergenic
1130976837 15:88782979-88783001 GAGATGAGGTGAGGCAGAGTGGG - Intergenic
1131146382 15:90016188-90016210 GAAAGGAGGGTAGGCGGAGGTGG + Intronic
1131335104 15:91541366-91541388 GAGTTGAGGGCAGTGGGAGAGGG + Intergenic
1131372457 15:91894228-91894250 GAGAGGAGGGCAGGGGTGGGGGG + Intronic
1131521521 15:93119608-93119630 GAGATGGGAGCAGGCTGGGGTGG + Intergenic
1131751025 15:95508508-95508530 GAGGAGAGGGGAGGAGGAGGGGG - Intergenic
1131751587 15:95514614-95514636 TGGATTAGGGCAGGCGGAAGTGG - Intergenic
1132855545 16:2043037-2043059 GAGATGAGGGCAGAGTGGGGAGG - Intronic
1132922559 16:2405875-2405897 GAGATGAGGTCAGGCTGATATGG + Intergenic
1133520216 16:6549350-6549372 GGGAGGAGGGAAGGAGGAGGAGG + Intronic
1133620640 16:7522988-7523010 GGGATGAGGCAAGGAGGAGGAGG - Intronic
1133770510 16:8864900-8864922 GACATGCGGGCAGGCTGAGCAGG - Intronic
1134236239 16:12468553-12468575 GAGATGAGGGCTGCGGGAGGGGG - Intronic
1134290709 16:12901547-12901569 GGGAGGAGGGCGGGCAGAGGAGG - Intergenic
1135066548 16:19314926-19314948 GGGATGAGTGGAGGGGGAGGAGG + Intronic
1135082248 16:19446085-19446107 GAGTTGGGGGGAGGTGGAGGGGG + Intronic
1135133106 16:19868771-19868793 GAGATCTGGCCAGGGGGAGGGGG + Intronic
1135527953 16:23228347-23228369 GAGTTTAGGGAAGGCCGAGGGGG - Intergenic
1135583824 16:23651785-23651807 GAGACCAAGGCAGGCGGAGGCGG + Intronic
1135641113 16:24120546-24120568 GAGATGAGAAGAAGCGGAGGAGG - Intronic
1135660462 16:24292099-24292121 GATAACCGGGCAGGCGGAGGAGG + Intronic
1136013366 16:27379213-27379235 AAGATGAGGGTAGGGGGAGGAGG + Intergenic
1136219836 16:28821865-28821887 GATAAGAGGGCAGGGGGAGATGG - Intergenic
1136410859 16:30076206-30076228 GATGTGAGGGGAGGCGGGGGTGG + Intronic
1136655784 16:31708441-31708463 AAGCTGAGGTCAGGGGGAGGGGG - Intergenic
1137517124 16:49156167-49156189 GCAATGAGGGGAGGCAGAGGTGG + Intergenic
1138452929 16:57104499-57104521 GTGATGTGTGCAGGGGGAGGTGG + Intronic
1138572601 16:57885148-57885170 GAGATGGGGTCAGGCAGAGTGGG - Intronic
1138645056 16:58418668-58418690 GAGATGAGGGAGTGGGGAGGAGG + Intergenic
1138667693 16:58586256-58586278 GAGGCGAGGGGAGGGGGAGGGGG + Intronic
1138667751 16:58586363-58586385 GAGGGGAGGGCAGGGGGAGGGGG + Intronic
1139354873 16:66361431-66361453 GAGATGAGGGTGCCCGGAGGAGG - Intergenic
1139653079 16:68372263-68372285 GAGTTGGGGGCAGCTGGAGGAGG + Exonic
1139676295 16:68526264-68526286 GAGATGAGGGATGGGAGAGGAGG - Intergenic
1139944179 16:70627455-70627477 GAGGGGAGGGAAGGGGGAGGAGG - Intronic
1139957695 16:70700944-70700966 CATGTGAGGGCAGGCTGAGGAGG + Intronic
1139974436 16:70797676-70797698 GAGATGGGGCCTGGTGGAGGTGG + Intronic
1140073150 16:71670722-71670744 GAGAGGAGGGGAAGAGGAGGGGG + Intronic
1140559928 16:75967114-75967136 GAGAGGAGGACAGACGGAAGAGG + Intergenic
1141571588 16:84937283-84937305 GGGAGGAGGGCGGGAGGAGGTGG - Intergenic
1141645528 16:85365373-85365395 GAGAAGAGTGAAGGTGGAGGCGG - Intergenic
1141900393 16:86986959-86986981 GAGGGGAGGGGAGGGGGAGGGGG + Intergenic
1141900862 16:86989249-86989271 GAGGTGAGGGCAGGCGTGGTCGG + Intergenic
1142141356 16:88474190-88474212 GAGAGAAAGGGAGGCGGAGGAGG - Intronic
1142290582 16:89192138-89192160 GCGAGGAGGGCAGGCGAAGTGGG + Intronic
1142350031 16:89575658-89575680 GAAATGAGGGCAGGGGGCAGAGG - Intergenic
1142383684 16:89748742-89748764 CAGACGAAGGCAGGCGGAGGAGG + Exonic
1142570374 17:869706-869728 GTGAGGAGGGAAGGCGGACGTGG + Intronic
1142586957 17:979810-979832 GTGGCGCGGGCAGGCGGAGGGGG - Intergenic
1142865501 17:2788731-2788753 TAGCTGAGGGCAGGAGAAGGCGG + Intronic
1142977816 17:3656081-3656103 GGGGTGAGGGCTGGCGGGGGTGG - Intronic
1142977848 17:3656159-3656181 GGGGTGAGGGCTGGCGGGGGTGG - Intronic
1143035228 17:3991362-3991384 GGGATGGGAGCAGGAGGAGGAGG - Intergenic
1143100855 17:4503930-4503952 GAGCTGGGTGCAGGAGGAGGGGG + Intronic
1143183579 17:4998154-4998176 GAGGTGAGGGCTGGGGAAGGGGG + Exonic
1143457693 17:7078364-7078386 GAGCTGGGGGCAGGGGCAGGAGG + Intronic
1143704614 17:8687732-8687754 GAGAGGTGGGGAGGGGGAGGGGG - Intergenic
1143957158 17:10679951-10679973 GAGATGGGGGCGGGGGGGGGGGG + Exonic
1144430963 17:15191436-15191458 CAGATGAGGGAAGGCAGAAGGGG + Intergenic
1144461585 17:15463008-15463030 GAGATGGGGGTGGGAGGAGGTGG + Intronic
1144679020 17:17180522-17180544 CACAGGAGGGCGGGCGGAGGTGG + Intronic
1145246959 17:21275734-21275756 CAGCTCAGGGCAGGCGGATGGGG - Intergenic
1146632578 17:34481490-34481512 AAGAAGAGGGCAGGCGGGGCAGG - Intergenic
1146809329 17:35890744-35890766 CAGAAGAGGGGAGGGGGAGGGGG - Intergenic
1146955814 17:36935933-36935955 GGGAAGAGGGAAGGAGGAGGGGG - Intergenic
1147121746 17:38339188-38339210 GGAATGAGGGCAGGAGCAGGAGG + Intronic
1147141946 17:38465092-38465114 GAGCTGGGGGTGGGCGGAGGCGG + Intronic
1147315307 17:39617594-39617616 GACAGGAGGGCAGACGGGGGCGG - Intergenic
1147441004 17:40447219-40447241 GACAGGAGGGCAGGCAGGGGTGG - Intronic
1148086147 17:44995002-44995024 GAGGAGAGGGGAGGCAGAGGAGG + Intergenic
1148111769 17:45148541-45148563 GAGCTGTGGGAAGGGGGAGGAGG + Exonic
1148217177 17:45839672-45839694 GAGCTGAGGGCAGGGGTGGGAGG - Intergenic
1148228961 17:45919351-45919373 GGGAGGAGGGCAGGCGGGGGGGG - Intronic
1148466957 17:47870815-47870837 GAGTTCAGCGCAGGAGGAGGTGG - Intergenic
1148698589 17:49575537-49575559 GAGAGGACGGCACGCGGGGGCGG - Intergenic
1148864061 17:50619468-50619490 GGGAAGAGGGAAGGCGAAGGAGG - Intronic
1148864420 17:50621070-50621092 GGGCTGCAGGCAGGCGGAGGAGG + Intronic
1149113712 17:53064969-53064991 CAGATGACAGCAGGTGGAGGTGG + Intergenic
1149315132 17:55431859-55431881 GAGGGGAGGGCAGGGGGAGGGGG + Intergenic
1149591652 17:57834336-57834358 GAGATGAGGGATGGCTGAGCAGG - Intergenic
1150089449 17:62310045-62310067 GAGAGGAGGAGAGGAGGAGGAGG - Intergenic
1150137411 17:62703567-62703589 GAGCTGGGGGCAGGTGGAGATGG + Intronic
1150219167 17:63486460-63486482 GAGCTGAGGGCTGGAGGTGGTGG - Intronic
1150373621 17:64662284-64662306 GACAAGAGGGCGGGTGGAGGAGG - Intergenic
1150613100 17:66749276-66749298 GGGTGGAGGGCAGGGGGAGGAGG - Intronic
1150745902 17:67816375-67816397 GAGATGAGGGCTGGGTGCGGTGG + Intergenic
1150764759 17:67994002-67994024 GAGAGGCGGGAAGGCGGTGGGGG + Intergenic
1150964184 17:69948501-69948523 GAGGAGAGGGGAGGGGGAGGGGG + Intergenic
1151340050 17:73465362-73465384 CAGATGAGGGCTGGGGGAAGGGG + Intronic
1151356648 17:73562571-73562593 GAGAAGAAGGCAGGCGTGGGAGG + Intronic
1151490141 17:74427890-74427912 GAGATGAGGGCAGGAGGCCCTGG - Intronic
1151755462 17:76072943-76072965 GAGGAAAGGGCAGGCAGAGGCGG - Intronic
1151990566 17:77571398-77571420 GAGAGGAGGGGAGGCGGGAGGGG + Intergenic
1152048966 17:77958299-77958321 GACCGGAGGGCAGGCGGCGGCGG + Intergenic
1152259495 17:79259422-79259444 AAGGTGAGGGCAGGGGCAGGAGG + Intronic
1152296020 17:79467346-79467368 GAGATGAGGGCAGAGCGGGGAGG + Intronic
1152305522 17:79518371-79518393 GAGAAGCGGGCAGGCGGGGATGG + Intergenic
1152320797 17:79608104-79608126 GCGAGGAGGGCAGGCTGTGGAGG + Intergenic
1152348323 17:79768513-79768535 GAGATGAGGGCCGGACGTGGTGG + Intergenic
1152448779 17:80363322-80363344 TTGCTCAGGGCAGGCGGAGGAGG - Intronic
1152532543 17:80927820-80927842 GAGATGAGGGCAGGCGGAGGAGG - Intronic
1152563380 17:81089618-81089640 CGCAGGAGGGCAGGCGGAGGGGG + Intronic
1152610222 17:81311681-81311703 TGGATGAGGGCAGGGAGAGGTGG + Exonic
1152623989 17:81380023-81380045 GATGTGAGGGGAGGCGGGGGGGG - Intergenic
1152928373 17:83098226-83098248 GGGAAAAGGGCAGGTGGAGGGGG - Intergenic
1152930688 17:83108041-83108063 GGGCTGAGGGCAAGCGCAGGAGG + Intergenic
1153015907 18:582544-582566 GATCTGAGGGCAGGGGAAGGAGG + Intergenic
1153567096 18:6429598-6429620 TAAATAAGGGCAGGGGGAGGAGG - Intergenic
1154031694 18:10758777-10758799 GTGGTGAGAGCAGGTGGAGGTGG + Intronic
1154439844 18:14379495-14379517 GAGATGAGAGAAGCCAGAGGGGG - Intergenic
1155092280 18:22523625-22523647 GAGATAAAGGCAAGGGGAGGAGG + Intergenic
1155428703 18:25733070-25733092 GAGAGGCTGGCAGGTGGAGGAGG + Intergenic
1155707679 18:28837162-28837184 GAGGGGAGGGGAGGGGGAGGGGG + Intergenic
1156455185 18:37289176-37289198 GGGATGGGGGCTGGCAGAGGGGG + Intronic
1156476459 18:37408855-37408877 GAGAGGTGGGCAGGTGGAGAGGG - Intronic
1156841806 18:41617858-41617880 GAGGTGGGGGAAGGAGGAGGGGG - Intergenic
1157272411 18:46286437-46286459 TAGATTAGGGCAGGGGCAGGAGG + Intergenic
1157572840 18:48724340-48724362 GAGCTGAGGGCAGGTGGAGCAGG - Intronic
1157595134 18:48859666-48859688 GGGAGGAGGGCAGGCAGAGTCGG + Exonic
1157618310 18:49001042-49001064 GAGAGCAGGGAAGGTGGAGGTGG + Intergenic
1157656335 18:49393051-49393073 GGGAGGAGGGGAGGAGGAGGAGG + Intronic
1157718502 18:49905862-49905884 GAGCTGGGGGCAGGCAGGGGAGG + Intronic
1157723671 18:49945746-49945768 GGGAGGAGGGGAGGAGGAGGAGG + Intronic
1157803880 18:50643832-50643854 GAGGTGAGGGTAGGTGCAGGGGG - Intronic
1157811812 18:50702702-50702724 CAGATGAGGGCAGGAAGATGGGG - Intronic
1158372191 18:56820625-56820647 TAACTGAGGGCAGGGGGAGGAGG - Intronic
1158446273 18:57524680-57524702 GAGAGGAGTGGAGGAGGAGGAGG + Intergenic
1158571989 18:58604009-58604031 GAGATGAGGACAGCATGAGGAGG + Intronic
1158695203 18:59697410-59697432 GGGAAGAGGGAAGGCGGCGGCGG - Intergenic
1159136913 18:64347503-64347525 GAGCTGAGGGCAGGAGGAGATGG - Intergenic
1160086189 18:75779596-75779618 GAGCTAAGGGCAGGAGCAGGTGG + Intergenic
1160202076 18:76804299-76804321 CAGCTGAGGGGAGGCCGAGGCGG + Intronic
1160208644 18:76858633-76858655 GAGGCGAGTGCAGGTGGAGGAGG + Intronic
1160403694 18:78629692-78629714 GAGATGGGAGGAGGCGGAGGTGG + Intergenic
1160569488 18:79807135-79807157 CAGATGCAGGCAGGCTGAGGTGG - Intergenic
1160774484 19:848704-848726 GGGAGGAGGGCAGGCAGGGGAGG + Intergenic
1160790139 19:919298-919320 GAGAGGAGGGCAGGAGGATTGGG - Intronic
1160918467 19:1508568-1508590 GCGCTGAGGGCAGGAGGAGTCGG + Exonic
1161074598 19:2279137-2279159 GGGTTGAGGACAGGCGGAGTGGG + Intronic
1161107270 19:2450528-2450550 AAGATGATGGGAGGCTGAGGCGG + Intronic
1161249173 19:3271167-3271189 GAGGTGAGGGCCAACGGAGGTGG + Intronic
1161257359 19:3316715-3316737 GAGACCAGGGGAGGCTGAGGCGG + Intergenic
1161258929 19:3324881-3324903 GAGTTGAGGCCAGATGGAGGAGG - Intergenic
1161330107 19:3682934-3682956 GAGGGGAGGGGAGGGGGAGGAGG - Intronic
1161370606 19:3908853-3908875 AAGATGAGGGAAGGAGGAGAAGG - Intronic
1161450184 19:4341435-4341457 GAGAGGAGGGCAGGGTGCGGTGG + Intronic
1161456664 19:4373091-4373113 GGGATGAGGCCAGGAGGGGGAGG + Intronic
1161638569 19:5405209-5405231 GGGATGATGGGAGGCAGAGGCGG - Intergenic
1162237721 19:9321759-9321781 GGGAGGAGGGCGGGGGGAGGAGG - Intergenic
1162451325 19:10756921-10756943 GAGGAGAGGGCAGGAGCAGGAGG - Intronic
1162745005 19:12793160-12793182 GAGGGGAGGGCAGGGGGCGGGGG - Exonic
1163061270 19:14763918-14763940 GAGAGGAGGGGAGGAGGAAGAGG - Intronic
1163095724 19:15055573-15055595 AAGAAGGGTGCAGGCGGAGGGGG + Intronic
1163438937 19:17311901-17311923 GACATGGGGGCAGGGGGTGGGGG - Intronic
1163677095 19:18660626-18660648 CGGAGGTGGGCAGGCGGAGGAGG - Intronic
1163827815 19:19533451-19533473 GAGGAGGGGGCAGGAGGAGGAGG - Intronic
1164302415 19:23973489-23973511 GAGAGGAGGAGAGGAGGAGGAGG + Intergenic
1164542111 19:29128905-29128927 GACATGAGGGCACGTGGCGGAGG + Intergenic
1164660599 19:29963014-29963036 CAGCTGGGGGTAGGCGGAGGAGG - Intronic
1165156067 19:33788832-33788854 GGGAGGAGGGAAGGGGGAGGAGG + Intergenic
1165172442 19:33903589-33903611 AAGCTGAGGGCCGGGGGAGGAGG - Intergenic
1165397094 19:35570473-35570495 GAGATGAAGACAGGCCGATGGGG + Intergenic
1165718612 19:38063261-38063283 GAGCTGGGGGCCGGCGGGGGCGG - Intronic
1165911348 19:39230113-39230135 GAGAGGAGAGGAGGGGGAGGGGG + Intergenic
1166008626 19:39925132-39925154 AAGAAGAGGGAAGGGGGAGGAGG + Intronic
1166081329 19:40445550-40445572 GAGATGGGGGAGGGGGGAGGGGG + Intergenic
1166267260 19:41691967-41691989 GAGAGGAAGGGAGGAGGAGGAGG - Intronic
1166390630 19:42407130-42407152 GGGATGGGAGCAGGCGCAGGTGG + Intronic
1166672414 19:44718881-44718903 GGGAGGAGGGAAGGGGGAGGTGG + Intergenic
1166690949 19:44820997-44821019 GGGAAGAGGGAAGGCGGGGGCGG - Exonic
1166781949 19:45347614-45347636 GAGGTGAGGGCAGGGTGAGGAGG + Intronic
1167001161 19:46746371-46746393 GAGCGGACGGCAGGAGGAGGCGG + Exonic
1167110472 19:47457670-47457692 GAGATGAGGAGTGGCAGAGGCGG - Intronic
1167173426 19:47848998-47849020 GATAGGAGGGGAGGAGGAGGGGG - Intergenic
1167242305 19:48351582-48351604 GAGGTGAGGGCAGAGGGAGGGGG - Intronic
1167293658 19:48637391-48637413 GAGGAGGGGGCAGGAGGAGGCGG + Exonic
1167381914 19:49143129-49143151 GAGTGGAGGGGAGGCTGAGGGGG - Intronic
1167510565 19:49893461-49893483 GAGATGGGGGCACCGGGAGGAGG + Intronic
1167601882 19:50459377-50459399 GAGATGAGGGGTGGGGAAGGAGG + Intronic
1167601896 19:50459427-50459449 GAGATGAGGGATGGGAGAGGAGG + Intronic
1167601912 19:50459479-50459501 GAGATGAGGGGTGGGAGAGGAGG + Intronic
1167601961 19:50459649-50459671 GAGATGAGGGATGGGAGAGGAGG + Intronic
1167659919 19:50790537-50790559 GAGCTAAGGGCAGGCCGGGGTGG - Intronic
1167876181 19:52414457-52414479 GAGATGGTGGCAGGGGGAGGGGG + Intronic
1168095082 19:54109911-54109933 GAGATGAGGGCCGGGGGCTGAGG - Intronic
925130105 2:1488570-1488592 CAGAGGAGGGAAGGCTGAGGTGG - Intronic
925672457 2:6325920-6325942 GGGAGGAGGGCCGGCGGAGGGGG - Intergenic
925812475 2:7713977-7713999 GGGGTGAGGGCAGGGGGAGGAGG - Intergenic
926679780 2:15654435-15654457 CAGCCGAGGGCAGGCGGAGAGGG - Intergenic
927168723 2:20350823-20350845 GAGGGGAGGGCAGGCGGCGGTGG - Intronic
927507074 2:23621542-23621564 GAGATGAGGGGGAGGGGAGGGGG + Intronic
927929379 2:27034320-27034342 AAGATGAGAGGAGGGGGAGGTGG + Intronic
927969951 2:27299217-27299239 GAGGAGTGGGCAGGGGGAGGTGG - Intronic
928099948 2:28431154-28431176 GAGGAGAGGACAGGAGGAGGTGG - Intergenic
928206809 2:29290341-29290363 GAGATGTGGGCAGAGTGAGGAGG + Intronic
928387682 2:30884083-30884105 GGGATGGGGGCATGTGGAGGAGG - Intergenic
928677983 2:33668903-33668925 GAGATGAGGGCTGGGGGCGGTGG + Intergenic
928997946 2:37315802-37315824 GGGAGCAGGGCAGGCGGCGGAGG - Intronic
929431165 2:41887851-41887873 GAGATGAGGGGAGGGAGGGGTGG + Intergenic
929647007 2:43637603-43637625 GAGAGGTGGGCAGGGGGCGGTGG + Intronic
929743810 2:44634252-44634274 GAAATTAGGGGAGGCTGAGGTGG - Intronic
929909799 2:46080003-46080025 GAGATTAAGGGAGGAGGAGGTGG + Intronic
932223985 2:70024600-70024622 GAGAGGAGGGAAGGAGGAAGAGG - Intergenic
932607668 2:73175823-73175845 GAGATTAGGGCCCGCGGCGGCGG + Intergenic
932705877 2:74024571-74024593 GAGCTGAGGGCTGGTGGAAGGGG + Intronic
932814294 2:74849510-74849532 GAGAGGAGGAAAGGAGGAGGGGG - Intronic
933239637 2:79905690-79905712 GAGGTGAGGACAGGCAGAGCTGG + Intronic
933860486 2:86461895-86461917 GAGATGGGGGGAGGAGGAGCAGG + Intronic
933979462 2:87538549-87538571 GAGCAGAGGGCAGGGGGACGAGG - Intergenic
934765796 2:96879401-96879423 GTGATGAGGGCAGGGGAAGCTGG - Intronic
934987506 2:98898580-98898602 CAGACGAGGGCAGGCCAAGGAGG - Intronic
935133907 2:100281814-100281836 CAGAAGGGGGCAGGCGGAGGAGG + Exonic
935749545 2:106219283-106219305 GAGGAGAGGGCAGGGAGAGGAGG + Intergenic
936075178 2:109397221-109397243 GAGCTCAGGGCAGGAGGAAGCGG - Intronic
936314361 2:111412242-111412264 GAGCAGAGGGCAGGGGGACGAGG + Intergenic
937115096 2:119399303-119399325 GAGATGGGGGCAGGAGGAAGTGG - Intergenic
937714954 2:125021634-125021656 GAGCTGAGAGCAGTGGGAGGAGG + Intergenic
937777521 2:125797283-125797305 GAGGGGAGGGGAGGGGGAGGGGG + Intergenic
937986356 2:127639902-127639924 GAGATGGGGGCAGGTTCAGGGGG - Intronic
938391595 2:130911121-130911143 GCGGTGAGGTCAGGAGGAGGAGG + Intronic
939522337 2:143246660-143246682 GAGGAGAGGGCAGGTGGAGGGGG + Intronic
939983202 2:148805612-148805634 GAGTGGAGGGGAGGAGGAGGAGG - Intergenic
940864488 2:158804478-158804500 GAGAAGGGGGCAGGAGGGGGAGG + Intronic
941029262 2:160493248-160493270 GAGGTGACGGCCGGAGGAGGGGG - Intronic
941854608 2:170218213-170218235 TAGATGATGGGAGGCGGGGGAGG - Intronic
941952216 2:171167315-171167337 GAGGTGAGTCCAGGCAGAGGAGG - Intronic
942875609 2:180793152-180793174 GAGATGAGGGGAGGTGAAGAAGG - Intergenic
942917174 2:181324674-181324696 GACATGAGGGCAGGCCATGGGGG - Intergenic
943557156 2:189419862-189419884 GAGAGGAGAGGAGGAGGAGGAGG + Intergenic
944402561 2:199345071-199345093 GAGATGGGGGCAGGTGGAGAAGG - Intronic
944503930 2:200390433-200390455 GTGATGAAGGCAAGGGGAGGTGG + Intronic
944591643 2:201223297-201223319 GAGGTGAGGGACGGTGGAGGAGG - Intronic
944762489 2:202831417-202831439 GAGTGGAGGGAAGGAGGAGGAGG - Intronic
944770812 2:202912489-202912511 GAGGTGACGGGAGGAGGAGGAGG - Intronic
944842777 2:203640439-203640461 GAGCTGAGGGGAGGTGGAGATGG - Intergenic
944863783 2:203840732-203840754 GAGATGATGGCAGCCAGAGCTGG + Intergenic
945446021 2:209939582-209939604 GGAATGAGGGCAGGCGGAGGAGG - Exonic
946043950 2:216805336-216805358 AAGATGTGGGCAGGCGGGGTGGG - Intergenic
946142869 2:217706541-217706563 GAGAGGAGGGGAGGAGGAAGGGG + Intronic
946419125 2:219554940-219554962 GAGATGAGGGCACAGGAAGGGGG + Intronic
946834953 2:223763507-223763529 GAGTTGGGGGCAGGTGGAGGGGG - Intronic
947367312 2:229410017-229410039 GTGAGGAGGGCAGGAAGAGGGGG - Intronic
947914610 2:233823223-233823245 GATATGAGGGCAGAAAGAGGAGG + Intronic
948309719 2:236975947-236975969 GAGGAGAGGGAAAGCGGAGGAGG - Intergenic
948628588 2:239285777-239285799 GAGTTGAGGGCAGCGGGTGGAGG + Intronic
948856285 2:240732048-240732070 GGGATGAGGGATGGGGGAGGAGG + Intronic
948873953 2:240817763-240817785 GAGATGTGAGCTGGAGGAGGAGG - Intronic
949069862 2:242018028-242018050 GAGATGGGGGCATGCAGGGGAGG + Intergenic
1168755028 20:310396-310418 GATTTGGGGGCCGGCGGAGGAGG - Intergenic
1168804157 20:662916-662938 GAGGTGAGGGCAGCTGGAGCTGG + Exonic
1169000081 20:2162255-2162277 GACATCAGGGCAGGGGCAGGGGG - Intronic
1169316133 20:4592511-4592533 GCTATGAGGGCAGGGGGTGGCGG + Intergenic
1170014575 20:11766322-11766344 GAGAGGAAGGCAGGGGTAGGGGG - Intergenic
1170262261 20:14423377-14423399 GGGATGGGGGCAGGCGGTGGGGG + Intronic
1170408515 20:16064517-16064539 GATATGAGGCCAGAAGGAGGGGG + Intergenic
1170803157 20:19607117-19607139 GGGATCAGGGCAGGAGAAGGAGG - Intronic
1170881974 20:20304773-20304795 GAGGAGAGGGGAGGCTGAGGCGG + Intronic
1170930618 20:20767012-20767034 GAGATGAGGATAGGCTGTGGGGG - Intergenic
1171032691 20:21691572-21691594 GAGATGAGGTCATGGGGAGGTGG + Intergenic
1171299878 20:24050822-24050844 GAGATGAGTGGAGGAGGAGGGGG - Intergenic
1171321453 20:24248041-24248063 GAAAGGAGGGCAGGGGAAGGAGG - Intergenic
1171327859 20:24311511-24311533 GAGAGGAGGGGAGGAGGAGCAGG + Intergenic
1172550025 20:35791805-35791827 GAGGTGAGGGAAGGAGAAGGAGG + Intronic
1173255462 20:41391681-41391703 TACATGAGGGCAGGAGGTGGCGG + Intergenic
1173581459 20:44149605-44149627 GGGAAGAGGGCAGAAGGAGGTGG - Intronic
1173643818 20:44621458-44621480 GAGAGGGTGGCAGCCGGAGGGGG - Intronic
1173759274 20:45545586-45545608 AAGGTGAGGACAGGGGGAGGAGG + Intronic
1173996950 20:47345828-47345850 GAGATGGGGGCGGGAGGGGGGGG + Intronic
1174423476 20:50415861-50415883 GGGAGGCGGGCAGGCAGAGGAGG + Intergenic
1174554002 20:51381152-51381174 GTGATGAGGACAGGCAGAAGGGG + Intergenic
1174648328 20:52104531-52104553 GTGATGGGGGCAGACGGTGGGGG - Intronic
1174800627 20:53560432-53560454 GAGAAGAAGGCAGGAGGAAGGGG + Intergenic
1175575736 20:60059047-60059069 GAGCCGAGGGCAGGGAGAGGTGG + Intronic
1175770313 20:61619285-61619307 GAGTGGGGGGCACGCGGAGGTGG - Intronic
1175980295 20:62735358-62735380 GTGATGGAGGCAGGCGGAAGAGG + Intronic
1176072732 20:63235389-63235411 GAGATGGGGGAAGGGGGAGCGGG + Intergenic
1176837505 21:13807206-13807228 GAAATTAGGGCAGGCAGAAGGGG - Intergenic
1177047053 21:16183828-16183850 GAGAGGAGGGCAGGGGGTGGAGG - Intergenic
1177972292 21:27805491-27805513 GAGAGGAAGGCAGGCAGAGAGGG + Intergenic
1178295840 21:31409474-31409496 GAGATGTGGGGAGCAGGAGGTGG - Intronic
1179135833 21:38678936-38678958 GAGGGGAGGGGAGGGGGAGGGGG + Intergenic
1179411691 21:41167874-41167896 GTGGGGAGGGCAGGCGCAGGTGG + Exonic
1179426597 21:41284400-41284422 GTGATGAGGGCAGGTGGATATGG - Intergenic
1179486951 21:41716587-41716609 GGGAGGAAGGGAGGCGGAGGAGG + Intergenic
1179628294 21:42660874-42660896 GAGATGTGGTCAGGGTGAGGGGG - Intronic
1179714319 21:43279920-43279942 GAGGGGAGGGGAGGTGGAGGTGG + Intergenic
1179714339 21:43279975-43279997 GAGGTGAGGTGAGGTGGAGGTGG + Intergenic
1179714399 21:43280118-43280140 GAGGGGAGGGGAGGTGGAGGTGG + Intergenic
1179714634 21:43280651-43280673 GAGGGGAGGGGAGGTGGAGGTGG + Intergenic
1179714678 21:43280750-43280772 GAGGGGAGGGGAGGTGGAGGTGG + Intergenic
1179767011 21:43581918-43581940 GAGATGAGGGCCTGCCGTGGGGG + Intronic
1179767023 21:43581958-43581980 GAGATGAGGGCCTGCTGTGGGGG + Intronic
1179767093 21:43582191-43582213 GAGATGAGGGCCTGCTGTGGGGG + Intronic
1179767110 21:43582251-43582273 GAGATGAGTGCCTGCTGAGGGGG + Intronic
1179919050 21:44497446-44497468 GAGGAGAGGGCAGGGGGAAGGGG - Intergenic
1179955734 21:44737184-44737206 GGGTGGAGGGCAGGGGGAGGGGG + Intergenic
1180261505 21:46672697-46672719 GAGATGGGAGGAGGCTGAGGTGG + Intergenic
1180672491 22:17564236-17564258 ATGATCAGGGCAGGCTGAGGTGG - Intronic
1181112148 22:20608489-20608511 TGGATGAGGGCAGGAGAAGGGGG + Intergenic
1181539595 22:23566274-23566296 GAGGAGAGGGCAGGGGGCGGGGG + Intergenic
1181584566 22:23845965-23845987 CTGATGAGGACAGGAGGAGGAGG + Intergenic
1181811661 22:25406866-25406888 GCCATGAGGTCAGGCGGAAGGGG - Intergenic
1182945153 22:34315124-34315146 GAGATTTGGGGGGGCGGAGGGGG - Intergenic
1183034282 22:35129360-35129382 AGGATGAGGGGAGGCCGAGGCGG + Intergenic
1183180664 22:36257736-36257758 GAGAGGAGGGCTGGGAGAGGAGG + Intronic
1183199026 22:36373242-36373264 CAGCTGAGGGCAGGGGCAGGGGG - Intronic
1183373227 22:37447532-37447554 GAGATGGGGACAGATGGAGGAGG + Intergenic
1183404465 22:37623675-37623697 GAGGTGGGGGCAGGAGGTGGAGG - Intronic
1183453811 22:37910730-37910752 GTGTTGGGGGCAGGAGGAGGGGG + Intronic
1183472834 22:38018781-38018803 GAGATGAGGCCAGATGCAGGAGG + Intronic
1183485210 22:38084676-38084698 GAAATGAGAGCAGGTGGAGATGG + Intergenic
1183736382 22:39647033-39647055 CAGGAGAGGGCAGGCAGAGGTGG - Intronic
1184096358 22:42318418-42318440 GAGGAGAGGGGAGGAGGAGGAGG + Intronic
1184175835 22:42788299-42788321 GAGAAGAGGGAAGCCCGAGGGGG - Intergenic
1184602060 22:45549510-45549532 GAGCCCAGGGCAAGCGGAGGGGG - Intronic
1184768813 22:46586420-46586442 GAGGGGAGGGCAGACAGAGGAGG - Intronic
1184813182 22:46851378-46851400 GAGATGAGTGCAGCAGCAGGAGG - Intronic
1185038221 22:48490399-48490421 GAGCTGAGGGCTGGGGTAGGGGG + Intronic
1185080562 22:48707352-48707374 CAGAAGAAGGCAGGAGGAGGGGG - Intronic
1185199363 22:49492147-49492169 GAGATGGGGCCAGGCACAGGAGG - Intronic
1185336911 22:50274872-50274894 GAGCTGTGGGGAGGTGGAGGGGG - Intergenic
1185372548 22:50467708-50467730 GAGACGGGGGCAGGGGGAGTTGG + Intronic
1185388154 22:50545971-50545993 GAGAAGAGGGCAGGAGCTGGTGG + Intergenic
949260763 3:2099912-2099934 GAGGTGAGGGTAGGAGGACGTGG + Intronic
950018681 3:9770835-9770857 GAACTGGGGGCAGCCGGAGGAGG + Intronic
950305203 3:11911479-11911501 GAGATGGGGGCAGGGCCAGGTGG - Intergenic
950360221 3:12444726-12444748 CAGATCAGGGCAGGAGGGGGCGG - Intergenic
950590995 3:13935659-13935681 AAGAGGAGGGGAGGAGGAGGAGG + Intergenic
950614079 3:14145770-14145792 GAGACGAGGCCAAGCTGAGGAGG - Exonic
950725621 3:14915076-14915098 GAGTTGAGGGCTGGAGGCGGAGG + Intronic
950863564 3:16171458-16171480 GAGTTGAGAGAAGGCAGAGGAGG + Intergenic
951017001 3:17742521-17742543 AAGAGGAGGGGAGGAGGAGGAGG - Intronic
951099412 3:18669396-18669418 GATATGAAAGCAGGTGGAGGGGG - Intergenic
952913099 3:38207902-38207924 GAGGGGAGGGGAGGGGGAGGGGG - Intronic
953470165 3:43159535-43159557 GACATCAGAGCAGGCCGAGGAGG - Intergenic
953606932 3:44418477-44418499 GAGATGAGGGAAGGGTGAGGGGG - Intergenic
954411747 3:50374076-50374098 GGGAGGAGGGGAGGGGGAGGAGG + Intronic
954876464 3:53805954-53805976 AAGATGAGGGAGGGAGGAGGAGG - Intronic
956370195 3:68550677-68550699 GAGATGAGCGGTGGGGGAGGGGG - Intergenic
956432178 3:69198125-69198147 CAGTTGGGGGCGGGCGGAGGGGG + Intronic
956813541 3:72888033-72888055 GAGAGGAGAGGAGGGGGAGGCGG - Intergenic
960030350 3:113048064-113048086 GAGATGAGGGCTGGGTGCGGTGG - Intergenic
960035696 3:113101076-113101098 GAGATGAGGAAATGGGGAGGAGG - Intergenic
960193833 3:114741005-114741027 GAGGTGAGGACAGGCTGAGATGG + Intronic
960422483 3:117464144-117464166 GATGTCAGGGCTGGCGGAGGTGG + Intergenic
961021241 3:123508975-123508997 TAGATGAGGTCATGCGGAGGTGG - Intronic
961389947 3:126546478-126546500 GAGATGAGGTCATGAGGATGCGG + Intronic
961941017 3:130637066-130637088 GAGAGAAGGGGAGGGGGAGGGGG - Intronic
962018238 3:131466971-131466993 GGGAGGAGAGCTGGCGGAGGTGG - Intronic
962106826 3:132398873-132398895 GAGTTATGGGCAGGGGGAGGTGG - Intergenic
962235294 3:133701711-133701733 GAGCTGAGGTCAGGAGCAGGGGG + Intergenic
962255272 3:133866221-133866243 GAGTTGAGGGCTGGGGGTGGTGG - Intronic
962420521 3:135225158-135225180 GAAACGAGGACAGGTGGAGGTGG - Intronic
962526688 3:136243658-136243680 GAGAGGAGGGCATGTGGTGGAGG + Intergenic
962886678 3:139634038-139634060 GAGATGTGAGCAGGCGGAAGAGG - Intronic
963057713 3:141200976-141200998 GAGAAGAAGGCAGGAGCAGGAGG + Intergenic
963115605 3:141726468-141726490 GAGGGGAGGGGAGGGGGAGGGGG + Intergenic
963742955 3:149097921-149097943 GAGAGGTGGGGAGGGGGAGGGGG + Intergenic
964148685 3:153497757-153497779 GAGCTGAGGGGAGAGGGAGGAGG - Intronic
966371669 3:179256872-179256894 GAGAGTAGGGCAGGCTGTGGTGG + Intronic
966413868 3:179669542-179669564 GGGAAGATGGCAGGAGGAGGAGG - Intronic
966768576 3:183484014-183484036 GAGGCCAAGGCAGGCGGAGGCGG + Intergenic
966826126 3:183966590-183966612 GAGATGGGGGGAGGGGGAGAAGG - Intronic
966882281 3:184357325-184357347 GGGATGAGGGCAGCCCGAGATGG - Intronic
966914592 3:184577826-184577848 GCGATGGGGACAGGCGCAGGGGG - Intronic
967262066 3:187652226-187652248 GAGTTGAGGGCGGGGGGTGGGGG - Intergenic
967390284 3:188948231-188948253 GAGATGAAGGGAGGCAGAGCGGG - Intronic
967898234 3:194418005-194418027 GAGGAGAGGGGAGGCGGGGGAGG + Intronic
967915596 3:194576067-194576089 GAGGAGAGGCCAGGAGGAGGCGG - Intergenic
968084809 3:195869502-195869524 GTGAAGAAGGCAGGCTGAGGTGG + Exonic
968106818 3:196007137-196007159 GAGATGGGGGCATGCTGGGGAGG - Intergenic
968165367 3:196460451-196460473 GAGTTGAGGGCTGGGGTAGGTGG - Intergenic
968382459 4:107984-108006 GAGCTGAGGGCTGGCGATGGCGG - Intergenic
968620120 4:1600189-1600211 GAGCTGAGGGCTGGGGCAGGAGG + Intergenic
968741745 4:2334768-2334790 GGGAAGAGGGGAGGCGGAAGTGG - Intronic
968767574 4:2481599-2481621 CAGAAGAGAGCAGGAGGAGGAGG - Intronic
968873841 4:3254982-3255004 GAGATGAAGGCAGGGGTGGGGGG - Intronic
968952035 4:3700284-3700306 GGGAGGAGGGGAGGGGGAGGAGG + Intergenic
968972724 4:3804292-3804314 GGGATGAGGGGAGATGGAGGGGG - Intergenic
969110614 4:4841822-4841844 GAAAGGAGGGTAGGCTGAGGTGG + Intergenic
969239294 4:5888509-5888531 GAGGCGAGGGCGGGAGGAGGGGG + Intronic
969294785 4:6263420-6263442 AAGGTGAGGGCTGGGGGAGGTGG + Intergenic
969342926 4:6553569-6553591 GAGATGAGGGCAGGGGAAAAAGG + Intronic
969344885 4:6564123-6564145 GCGGTGACGGCTGGCGGAGGCGG - Intergenic
969371497 4:6734135-6734157 GGGATGAGGGGAGGAGGTGGAGG + Intergenic
969454809 4:7294945-7294967 AAGAGGAGGGGAGGGGGAGGGGG - Intronic
969512830 4:7629451-7629473 GAGGTGAGGGAGGGAGGAGGTGG + Intronic
969587094 4:8100457-8100479 GAGATGAAGGCAGGGTGCGGTGG + Intronic
969711811 4:8849049-8849071 GAGCAGCGGGCAGGGGGAGGAGG - Intronic
971487072 4:27171333-27171355 GGGGTGAGGGCACGCAGAGGAGG + Intergenic
971508499 4:27394139-27394161 GGGATGAGGGCAGGTGGGAGAGG - Intergenic
972206360 4:36777792-36777814 GAGAGAAGAGCAGGGGGAGGTGG + Intergenic
975064657 4:70045640-70045662 GACATGAGGGCATGTGCAGGAGG + Intergenic
975269983 4:72420171-72420193 GAGATGAGGGAGGGCCTAGGTGG - Intronic
975281714 4:72569282-72569304 GAGGAGAAGGCAGGCGGAGGAGG + Intergenic
976104928 4:81606451-81606473 GAGGTGAGGGGAGGAGGAGCAGG - Intronic
976591073 4:86850471-86850493 GAGGTGTGGTCAGGCTGAGGAGG + Intergenic
978243837 4:106548904-106548926 GAGGGGAGGGGAGGGGGAGGGGG - Intergenic
978334411 4:107650089-107650111 AAGATGAGGGGAGGAGAAGGAGG + Intronic
978614636 4:110582151-110582173 GAGACAAGGGCAGCCTGAGGTGG + Intergenic
979624417 4:122828568-122828590 GTCATGAGGGGAGGTGGAGGGGG + Intronic
979654535 4:123176843-123176865 GAGGTGGGGGAAGGGGGAGGAGG + Intronic
979703927 4:123698159-123698181 GAGAGGAGGGCAGGGGAAGAGGG - Intergenic
979715481 4:123832345-123832367 GACATGACGGGGGGCGGAGGGGG + Intergenic
982091280 4:151881982-151882004 TAGATGAGGTCAGGAGGATGAGG - Intergenic
982283980 4:153715445-153715467 GAGATGGGGACAGGAGGAGGAGG + Intronic
982358284 4:154491957-154491979 GAGGGGAAGGCAGGCGGCGGAGG - Intergenic
983648444 4:170015635-170015657 GAGATGAGGGCATCTGGAGAGGG - Intronic
984736567 4:183114176-183114198 GAGAGGATGGCGGGGGGAGGAGG - Intronic
985094699 4:186401981-186402003 GAGAGTAGGGCAGGGGGAAGGGG - Intergenic
985141021 4:186840643-186840665 GAGAAGAGGGAGGGAGGAGGAGG - Intergenic
985539017 5:479224-479246 GAGGTCAGGGCAGGCCGGGGAGG + Intronic
985650179 5:1103974-1103996 GAGATGAAGGAAGGCGGGAGAGG + Intronic
985844978 5:2337137-2337159 GAGATGAGGAGAGGGGAAGGTGG + Intergenic
986330023 5:6711164-6711186 GAGGTGAGGGCAGGGGAAGAGGG + Intergenic
987032866 5:13991529-13991551 GAGGGGAGGGGAGGGGGAGGAGG + Intergenic
987373816 5:17217180-17217202 GAGGAGAGGGGAGGCGGAGGGGG + Intronic
987414868 5:17652065-17652087 GAGAGGAAGGGAGGGGGAGGGGG - Intergenic
987842782 5:23242273-23242295 GATGTGGGGGCTGGCGGAGGAGG - Intergenic
989592151 5:43121596-43121618 GAGAAGAGGGAGGGCGGGGGAGG + Exonic
990703488 5:58500712-58500734 GAGGTGGGGGCAGGGGGTGGTGG - Intergenic
991481979 5:67090430-67090452 GAGAAGCGGGGAGGGGGAGGGGG - Intronic
991971934 5:72149731-72149753 GGGATGAGGGCAGGAGGTGAGGG + Intronic
992187258 5:74256274-74256296 GAGATGGAGCCAGGTGGAGGAGG - Intergenic
992297098 5:75336747-75336769 GAGATGGAGGGAAGCGGAGGCGG - Intronic
992627477 5:78648633-78648655 GAGAGGAGAGCGGGAGGAGGCGG + Exonic
992748231 5:79839412-79839434 GAAATGAGGGCAGGAGAAGCAGG + Intergenic
993423860 5:87737793-87737815 GAGATGAAGTCAGGCAAAGGAGG - Intergenic
993900644 5:93582109-93582131 GAGAGGGGGGGAGGCGGAGAGGG - Intergenic
993901352 5:93585680-93585702 GAGATGAGCGCAGGCCGGGAGGG - Intronic
994958896 5:106572210-106572232 GAGGTGGGGGGAGGAGGAGGAGG + Intergenic
994997243 5:107079191-107079213 GAGATGGAGGGAGGGGGAGGAGG + Intergenic
995048339 5:107673346-107673368 GAAATGAGGGCCGGGGGCGGGGG + Intergenic
996938708 5:128977514-128977536 GAGATGAGGGAATGAGCAGGAGG + Intronic
997628870 5:135351072-135351094 GGGGTGAGGACAGGAGGAGGAGG + Intronic
997778138 5:136629756-136629778 GAGGTGAGGGCTGGGGGTGGGGG - Intergenic
998478194 5:142439175-142439197 GTGTTGTGGGCAGGCAGAGGAGG + Intergenic
998512508 5:142725093-142725115 GAGATGAGGTCAGGAGGAGAAGG + Intergenic
999161297 5:149501727-149501749 TAATTGAGGGCAGGCAGAGGTGG - Intronic
999176546 5:149635809-149635831 GAGATTTGGGAAGGCTGAGGTGG + Intergenic
999758551 5:154682949-154682971 GAGCTGGAGGGAGGCGGAGGGGG - Intergenic
1000007719 5:157202923-157202945 GTGATGAGGGCAGACAGTGGAGG - Intronic
1000019670 5:157308338-157308360 GAGGTAAGGGCAAGCTGAGGTGG - Intronic
1001132916 5:169079577-169079599 GAGAGAAGGGGAGGAGGAGGAGG + Intronic
1001148736 5:169207755-169207777 GAGATGATGGCATTTGGAGGTGG + Intronic
1001157598 5:169286702-169286724 GAGAGGAGGGCCGAGGGAGGCGG - Intronic
1001192932 5:169647359-169647381 TAGATGAGTGGAGGGGGAGGAGG + Intronic
1001644213 5:173268360-173268382 TAAATGAGGGCTGGCGGAGATGG - Intergenic
1001654123 5:173336394-173336416 GAGATGGGGGATGGCGAAGGAGG - Intergenic
1001712168 5:173787558-173787580 CAGATGAGGGCAGGAGGAAAAGG + Intergenic
1001845562 5:174918016-174918038 GAGAAGAGGGAAGCCCGAGGGGG + Intergenic
1001897628 5:175395118-175395140 GAAATGAGGGCAGGAGCAGAGGG + Intergenic
1002048321 5:176554451-176554473 GTGATGAGGGTAGGCAGCGGGGG - Intronic
1002182838 5:177440416-177440438 AAGCTGTGGGCAGGCGAAGGAGG + Intronic
1002569975 5:180134717-180134739 GAGATGGGGACAGGTGGATGGGG - Intronic
1003350150 6:5309008-5309030 GAGATGGGGCCAGTGGGAGGTGG - Intronic
1003687633 6:8320283-8320305 AAGATGATGGCATGAGGAGGTGG - Intergenic
1003872767 6:10415076-10415098 GCGGTGAGCGCAGGAGGAGGAGG + Exonic
1003879380 6:10466338-10466360 GATTTGAAGGCAGGAGGAGGAGG + Intergenic
1004120840 6:12820550-12820572 GAGAGGAGAGCAGGAGGAGAGGG - Intronic
1004182867 6:13395945-13395967 GAGCAGAGGGCAGGCGGAAGGGG + Intronic
1004317178 6:14599734-14599756 GAGAGGTGGGGAGGTGGAGGGGG + Intergenic
1004536214 6:16504961-16504983 GAGCTGATTGCAGGAGGAGGAGG - Intronic
1005048965 6:21666350-21666372 GAGATGCGGGGAGAGGGAGGGGG + Intergenic
1005207925 6:23426365-23426387 GAGGTGAGGGCTGGGGAAGGAGG - Intergenic
1005916069 6:30352529-30352551 TAGATGAGGTCAGGAGGGGGGGG + Intergenic
1006021494 6:31120515-31120537 GAGAGGAGGAGAGGTGGAGGGGG + Intronic
1006095445 6:31653316-31653338 GAGAAGAGGGCACGGAGAGGCGG - Intronic
1006271754 6:32970922-32970944 GGGAGGAGGGCGAGCGGAGGAGG - Exonic
1006335787 6:33420019-33420041 GCGAAGAGAGCAGGAGGAGGAGG - Intergenic
1006403159 6:33829560-33829582 GAGATGAGGGAGGGGAGAGGAGG - Intergenic
1006433040 6:34009929-34009951 GAGATGAGGGCCTGGGGACGAGG - Intergenic
1006480492 6:34289277-34289299 GACATGAGGGCCGGATGAGGTGG + Intronic
1006679683 6:35788036-35788058 GGGAGGAGAGCAGGTGGAGGAGG - Exonic
1006798830 6:36746746-36746768 GGGAGGAGGAGAGGCGGAGGAGG - Intronic
1007119413 6:39367754-39367776 GAGAGGAGGGCATGGGGAAGTGG - Intronic
1007174829 6:39888597-39888619 GGAATGAGGGAAGGCGGAGGTGG + Intronic
1007630771 6:43272093-43272115 GGGAAGAGGGCAAGAGGAGGTGG - Intronic
1008542227 6:52555214-52555236 GCGAAGAGGGCAGGAGGAGGGGG - Intronic
1008975386 6:57419681-57419703 GAGATGAGGGCAGGAGGGAGGGG + Intronic
1009164262 6:60321194-60321216 GAGATGAGAGCAGGAGGGAGGGG + Intergenic
1009826697 6:68875230-68875252 GAGGGGAGGGCAGAGGGAGGGGG - Intronic
1010768112 6:79799040-79799062 GTGTTGAGGGCAGGGGAAGGAGG - Intergenic
1014384250 6:120781056-120781078 GAGAAGAGGGCAAATGGAGGAGG + Intergenic
1014804851 6:125818046-125818068 GAGAAGCGGGAAGGGGGAGGAGG - Intronic
1016555384 6:145330549-145330571 GAGGTGAAGGCAGGTGGAAGAGG - Intergenic
1017442662 6:154478191-154478213 AAGAGGAGGACGGGCGGAGGAGG - Intronic
1017637350 6:156456178-156456200 GAGGGGAGGGGAGGGGGAGGGGG - Intergenic
1017805225 6:157939952-157939974 GAGTTGGGGGCAGGGGCAGGGGG + Intronic
1017962239 6:159232803-159232825 GAGATGAGAAGAGACGGAGGAGG - Exonic
1018103128 6:160458868-160458890 GGGATGTGGGCAAGGGGAGGGGG - Intergenic
1018743731 6:166748652-166748674 GAGATGGGGGCCTGAGGAGGTGG - Intronic
1018743750 6:166748700-166748722 GAGATGGGGGCCTGAGGAGGTGG - Intronic
1018743808 6:166748843-166748865 GAGATGGGGGCCTGAGGAGGTGG - Intronic
1018743855 6:166748955-166748977 GAGATGGGGGCCTGAGGAGGTGG - Intronic
1018743884 6:166749019-166749041 GAGATGGGGGCCTGAGGAGGTGG - Intronic
1018743910 6:166749083-166749105 GAGATGGGGGCCTGAGGAGGTGG - Intronic
1018743986 6:166749275-166749297 GAGATGGGGGCCTGAGGAGGTGG - Intronic
1018744042 6:166749419-166749441 GAGATGGGGGCCTGAGGAGGTGG - Intronic
1018744105 6:166749579-166749601 GAGATGGGGGCCTGAGGAGGTGG - Intronic
1018744138 6:166749659-166749681 GAGATGGGGGCCTGAGGAGGTGG - Intronic
1018820752 6:167372383-167372405 GACATAGGGGCAGGCAGAGGTGG + Exonic
1018996897 6:168716943-168716965 GGGATGTGGGCACGGGGAGGTGG + Intergenic
1019002124 6:168763159-168763181 GGCAAGAGGGCAGGCGGTGGGGG + Intergenic
1019188078 6:170232637-170232659 GGGATGAGGGCAGGGGCTGGTGG + Intergenic
1019259778 7:75111-75133 GATATCAGGCCAGGCGTAGGGGG + Intergenic
1019427446 7:984287-984309 AAAATGGGGGCAGGTGGAGGGGG - Intronic
1019600592 7:1881747-1881769 AAGATGTGGGGAGGCAGAGGTGG + Intronic
1019603540 7:1897347-1897369 GAGATGAGGACAGGCAGAGACGG - Intronic
1019681628 7:2353775-2353797 GAGATGAGGGCTGGCGTGCGGGG + Intronic
1019729535 7:2622630-2622652 GAGTTGAGAGGAGGAGGAGGAGG - Intergenic
1019729551 7:2622680-2622702 GAGGTGGGGGCAGGAGGAGCAGG - Intergenic
1019729562 7:2622705-2622727 GAGATGGGGGCAGGAGGAGCAGG - Intergenic
1020002765 7:4765127-4765149 GAGAGGAGGGCAAGGAGAGGAGG + Exonic
1020092587 7:5349917-5349939 GGGGTGAGGGGAGGCGGGGGAGG - Intronic
1020094408 7:5360680-5360702 GAGAAGAGGGCAGGAGGCTGCGG - Intronic
1020502552 7:8941817-8941839 GAGATAAGGGAAGGAGGAGGCGG + Intergenic
1020944876 7:14590901-14590923 CAGAACAGTGCAGGCGGAGGAGG - Intronic
1021239042 7:18178068-18178090 GAGGGGAGGGGAGGTGGAGGAGG - Intronic
1021394597 7:20131719-20131741 GAGATGAAGTGAGGCGGATGAGG + Intergenic
1021486680 7:21175626-21175648 GAGATGAAGGCAGGATGAGGAGG + Intergenic
1021492925 7:21239608-21239630 AAGGTGAGGGCTGGAGGAGGAGG - Intergenic
1022761930 7:33364717-33364739 GAGGTGAGAGGAGGGGGAGGAGG - Intronic
1024072565 7:45798755-45798777 GAGGGGAGGGAAGGGGGAGGTGG + Intergenic
1024100155 7:46024165-46024187 GAGTTGAGGGCAGGAGTAGGTGG - Intergenic
1025709022 7:63890860-63890882 GAGATGGGGAGAGGAGGAGGAGG + Intergenic
1025945159 7:66099414-66099436 GAGAGGAGGAGAGGGGGAGGAGG + Intronic
1026044075 7:66893603-66893625 GTGAGGAGGGAAGGAGGAGGTGG + Intergenic
1026106695 7:67426949-67426971 GAGGGGAGGGGAGGGGGAGGGGG - Intergenic
1026307547 7:69154924-69154946 GAGAGGAGGGGAGGGGGAGGGGG - Intergenic
1026736668 7:72953476-72953498 GAGTTGAGGGGCGGGGGAGGTGG - Intergenic
1026938030 7:74270254-74270276 GAGAGGAGGGGAGGGAGAGGAGG - Intergenic
1026938036 7:74270268-74270290 GAGAGGAGGGGAGGGAGAGGAGG - Intergenic
1027107066 7:75411587-75411609 GAGTTGAGGGGCGGGGGAGGTGG + Intergenic
1027533536 7:79366395-79366417 GGAAAGAGGGCAGGAGGAGGTGG + Intronic
1027753799 7:82185467-82185489 GAGAGGGGGGGAGGGGGAGGAGG + Intronic
1027898177 7:84072447-84072469 GGGATGTAGGCAAGCGGAGGAGG + Intronic
1028450968 7:90982772-90982794 TAGATGGGGGCAGGGGGAGTGGG + Intronic
1028827503 7:95290348-95290370 GAGAGCAGGGCAGGAAGAGGTGG - Exonic
1028952005 7:96646660-96646682 GAGAGGATGGCAGTCGGAGGTGG - Intronic
1029106485 7:98180955-98180977 AAGAGGAGGGGAGGAGGAGGAGG + Intronic
1029117623 7:98245316-98245338 GTGAGCAGGGCAGGCGGTGGAGG + Intronic
1030272194 7:107681924-107681946 GAGATTGGGGCGGGAGGAGGTGG - Intronic
1030781853 7:113610692-113610714 GAGAAGAGGGGAGGAGGAGGAGG + Intergenic
1031585992 7:123532967-123532989 GAGGTGACGGGAGGAGGAGGAGG + Intronic
1031595052 7:123640620-123640642 GAGAGGAGAGGAGGGGGAGGGGG + Intergenic
1031983815 7:128149237-128149259 GAGATGAGTGGAGGTGGTGGAGG + Intergenic
1031992199 7:128205868-128205890 GAGATGGTGGCTGGTGGAGGGGG + Intergenic
1032083991 7:128874215-128874237 GTGGTGAGGGCAAGCGGAAGGGG - Intronic
1032265727 7:130368673-130368695 GGGATGAGGGCATGGGGATGGGG - Exonic
1032468992 7:132164566-132164588 GAGAGGAGGGCAGGAGGGGAGGG - Intronic
1033367446 7:140682471-140682493 GAGGTGAGAGGAGGCTGAGGAGG + Intronic
1033802773 7:144920345-144920367 GGGGTGAGGGGAGGGGGAGGGGG + Intergenic
1034226618 7:149489759-149489781 GGGATCAGGGCAGGAGGAGAGGG + Intronic
1034436773 7:151066367-151066389 GAGGTGCGGGCACGGGGAGGGGG - Intronic
1034455288 7:151167034-151167056 GAGAAGTGCGGAGGCGGAGGTGG + Exonic
1035075852 7:156176823-156176845 GAGCTGTGGCCAGGAGGAGGGGG + Intergenic
1035091377 7:156315528-156315550 GAGAAAAGGGGAGGGGGAGGGGG - Intergenic
1035226715 7:157437984-157438006 GAGAGGAGGGGAGGGGAAGGTGG - Intergenic
1035251410 7:157599905-157599927 GAGAGGTGGGCAGGTGGAGAGGG - Intronic
1035251466 7:157600095-157600117 GAGAGGTGGGCAGGTGGAGAGGG - Intronic
1035422716 7:158742598-158742620 GACATGAGTGCAGGAGCAGGGGG + Intronic
1035645245 8:1214037-1214059 GAGGTGAGGACAGGCGGCTGTGG - Intergenic
1035900877 8:3457204-3457226 GTGAGGAGGGCAGGATGAGGGGG - Intronic
1036005808 8:4662323-4662345 GAAATGAGGGAAAGCAGAGGGGG + Intronic
1036442969 8:8797570-8797592 GGGATGGGGGCAGGGGGAGAAGG + Intronic
1036528258 8:9555881-9555903 GAAGTGAGGGCGGGCGGTGGGGG + Intergenic
1036614743 8:10379562-10379584 AAGAGGGGGGAAGGCGGAGGGGG - Intronic
1037417866 8:18670511-18670533 GGGATGAAGGCAGGCAGTGGCGG + Intronic
1037760314 8:21737657-21737679 GAGAAGAGGACAGGAGGGGGAGG - Intronic
1037760434 8:21738210-21738232 GGGAAGAGGGGAGGAGGAGGAGG - Intronic
1037767407 8:21780655-21780677 GAGGGGAGGGCAGGGGGATGGGG - Intronic
1037804508 8:22051547-22051569 CAGCTGAGGGCAGGCCGAGGGGG - Intronic
1037977302 8:23222873-23222895 GGGAGGATGGCAGGAGGAGGGGG - Intronic
1038486930 8:27942495-27942517 CAGAGGAGGGCAGGTGGAGAAGG - Intronic
1039808510 8:41024072-41024094 GAGATGGGAGCAGCAGGAGGAGG - Intergenic
1040548726 8:48422313-48422335 GAGATGGAGCCAGGAGGAGGAGG + Intergenic
1041023335 8:53659451-53659473 GACATGAGGACAGACGAAGGCGG - Intergenic
1041650433 8:60296994-60297016 GGGATGAAGGTAGGCTGAGGAGG - Intergenic
1041953615 8:63533149-63533171 GAAAAGAGGGAAGGAGGAGGGGG - Intergenic
1042525446 8:69759932-69759954 GAGATGAGGGCCGGGTAAGGTGG - Intronic
1042959007 8:74282668-74282690 GAGATGAGGATAGCCAGAGGAGG + Intronic
1042959461 8:74288169-74288191 GAGAAGAGGGCAGATGGAGGCGG + Intronic
1043657730 8:82691569-82691591 GAGAAGAGGGCTGGGGGAAGGGG + Intergenic
1043961791 8:86424840-86424862 GAGGGGAGGGGAGGGGGAGGGGG + Intronic
1044767977 8:95597182-95597204 GAGAGGAGGGGAGGAGGGGGAGG - Intergenic
1045391545 8:101719937-101719959 GAAATGAGGGCAGGGAGAGAGGG + Intronic
1045713938 8:105019547-105019569 GGGAAGAAGGCAGGTGGAGGAGG + Intronic
1046131739 8:109974833-109974855 GAGATGTGGGGCGGAGGAGGAGG + Exonic
1047300768 8:123612094-123612116 GAGGGGAGGGGAGGGGGAGGGGG - Intergenic
1047368871 8:124238351-124238373 GTGAGGAGGGAAGGTGGAGGTGG - Intergenic
1047464404 8:125098679-125098701 GATATGAGGGGAGGAGGAGAAGG + Intronic
1047795407 8:128250010-128250032 GAGGTGGGGGCAAGCAGAGGTGG + Intergenic
1047907004 8:129483137-129483159 GAGAGGAGGGAAGGGGGAAGGGG + Intergenic
1048007648 8:130432056-130432078 GAGAGGAGGAAAGGAGGAGGGGG + Intronic
1048737511 8:137518354-137518376 GAAATGAGGGGATGCAGAGGTGG - Intergenic
1048876383 8:138839617-138839639 GAGATGAGGGCAGGTGAGGAGGG + Intronic
1049010591 8:139884560-139884582 GAGATGGGGTCAGGCCCAGGGGG - Intronic
1049419394 8:142510348-142510370 GTGATGAGGCCCGGGGGAGGTGG + Intronic
1049419608 8:142510937-142510959 GAGCTGCGGGGGGGCGGAGGAGG - Exonic
1049625560 8:143618199-143618221 GAGCTGAGGGCAGGAGCAGCTGG - Intergenic
1049688793 8:143949865-143949887 GACAGGAGAGGAGGCGGAGGGGG + Intronic
1049775207 8:144400842-144400864 GAGAGGAGGGGAGGCGGGGAGGG + Intronic
1050086018 9:1966586-1966608 GAGATGTGGGCAAGTGGAAGAGG - Intergenic
1050151301 9:2621872-2621894 GAGAGGAGGGAAGGGAGAGGGGG - Exonic
1050309624 9:4339805-4339827 GAGGGGAGGGGAGGGGGAGGGGG + Intronic
1050412918 9:5385021-5385043 GAGATGAGGTCAGATGGAGGTGG + Intronic
1051174264 9:14347390-14347412 GAGAGGAGGATAGGTGGAGGGGG + Intronic
1051240455 9:15050088-15050110 GAGGAGAGGGGAGGCGGGGGAGG + Intergenic
1051774866 9:20622302-20622324 CAGCTGAGGGGGGGCGGAGGAGG - Exonic
1053174979 9:35916106-35916128 GGGAGGAGGGCAGGCAGAGCGGG - Intergenic
1053233817 9:36434319-36434341 GGGATGGGGGAAGGAGGAGGGGG + Intronic
1053289129 9:36868457-36868479 GAGATGAGGGACTGCGGTGGGGG + Intronic
1053302347 9:36960987-36961009 GAGAGGAGGAGAGGAGGAGGTGG - Intronic
1053459055 9:38254401-38254423 GAGCTGAGGGCTGGAGCAGGGGG + Intergenic
1054791429 9:69260244-69260266 GAGATTAGGGAAGGAGGGGGAGG - Intergenic
1055774587 9:79753722-79753744 GTGTTGAGGGCAGGGGCAGGTGG - Intergenic
1055824499 9:80307145-80307167 GAGAGGAGGGAGGGAGGAGGGGG - Intergenic
1056379143 9:86041560-86041582 AAGGTGAGGGCAGGCGCCGGGGG - Intronic
1056691441 9:88811898-88811920 GGGGTGGGGGCAGGCGGGGGCGG - Intergenic
1057110890 9:92469758-92469780 GTGCTGAGGGGAGGCGGTGGCGG + Intronic
1057423547 9:94930549-94930571 GAGAAGAGGTCAGGAGGAAGAGG + Intronic
1057436869 9:95048598-95048620 GAGCCGAGGGCAGGCGTGGGCGG - Intronic
1058601351 9:106674232-106674254 CAGAGGAGGGAAGGGGGAGGCGG - Intergenic
1058868869 9:109185622-109185644 GAGAGAAGGGGAGGAGGAGGTGG + Intronic
1059333033 9:113548531-113548553 GAGCTGAGGGGAAGAGGAGGGGG + Intronic
1059354290 9:113687284-113687306 GAGAGGAGGGAAGAGGGAGGAGG + Intergenic
1059373531 9:113863120-113863142 GAGATGAGGATAAGGGGAGGGGG + Intergenic
1059409755 9:114124510-114124532 GAGAGGATGACAGGAGGAGGGGG + Intergenic
1059493548 9:114690341-114690363 GTGCTGAGGGCAGGTGAAGGTGG + Intergenic
1059519118 9:114923256-114923278 AAGATGGTGGCAGGAGGAGGAGG - Intronic
1060779305 9:126399915-126399937 GCGATGGGCGCAGGCGGAGAGGG + Intronic
1061061818 9:128254318-128254340 GAGAAGAGGGAAGCCCGAGGGGG + Intronic
1061128131 9:128689523-128689545 GAGAGAAGGGAAGGCGAAGGGGG - Intronic
1061184750 9:129046282-129046304 GAAATGAGAGCAGGCAGAGTGGG - Intronic
1061204819 9:129156766-129156788 GAGATGGGTGCAGGAGCAGGAGG - Intergenic
1061411744 9:130425654-130425676 AAGAGGAGGGGAGGAGGAGGAGG - Intronic
1061588603 9:131584011-131584033 GGGCTGAGGGCGGGCGGGGGAGG + Intronic
1061666142 9:132161985-132162007 GAGACGCGGGCCGGGGGAGGGGG - Exonic
1061860450 9:133465206-133465228 GGGATGAGGGCAGGAGGGTGAGG + Intronic
1062080829 9:134622552-134622574 GAGAGAAGGGCAGACAGAGGAGG - Intergenic
1062102924 9:134737851-134737873 GAGGTGAGGGCCAGAGGAGGAGG + Intronic
1062191403 9:135249643-135249665 GACATGAGGGGAGGGAGAGGGGG + Intergenic
1062528926 9:136991344-136991366 GCTATGAGGGCAGGAGGAAGAGG - Intergenic
1062612635 9:137381930-137381952 GAGGTGAGAGCACGAGGAGGAGG + Intronic
1062612664 9:137382025-137382047 GAGGTGAGGGCGCGGGGAGGAGG + Intronic
1062612669 9:137382044-137382066 GAGGTGAGGGCGCGCGGAGGAGG + Intronic
1062612674 9:137382063-137382085 GAGGTGAGGGCGCGCGGTGGAGG + Intronic
1062612693 9:137382118-137382140 GAGGTGAGGGCGCGGGGAGGAGG + Intronic
1062612700 9:137382137-137382159 GAGGTGAGGGCGCGGGGAGGAGG + Intronic
1062612705 9:137382156-137382178 GAGGTGGGAGCATGCGGAGGAGG + Intronic
1062612710 9:137382175-137382197 GAGGTGAGGGCGCGCGGAGGAGG + Intronic
1185459872 X:328953-328975 GAGGAGAGGGGAGGGGGAGGGGG - Intergenic
1185640557 X:1587935-1587957 GAGGAGAGGGCAGGGGAAGGGGG - Intergenic
1185640970 X:1588814-1588836 GAGGGGAGGGGAGGCGAAGGGGG - Intergenic
1185750889 X:2609160-2609182 GAGGAGGGGGCGGGCGGAGGTGG - Intergenic
1186451723 X:9679681-9679703 GAGATGCGGGAAAGCTGAGGAGG + Intronic
1186462661 X:9760685-9760707 GAGGAGAGGGCATGCAGAGGGGG + Intronic
1187056838 X:15748718-15748740 GAGATGGGGGTTGGCGGGGGCGG - Intronic
1187089965 X:16085889-16085911 GAGATGGGGGCGTGGGGAGGGGG - Intergenic
1187508705 X:19898517-19898539 GAGACGGGGGCAGGGGGTGGAGG - Intergenic
1188263543 X:28043140-28043162 GAGTTGGGGGGAGGGGGAGGCGG - Intergenic
1188617695 X:32178997-32179019 GAGATGTAGGCAGGAGGAGGAGG - Intronic
1189350262 X:40270633-40270655 GAGTTGAGGGGAGCGGGAGGGGG - Intergenic
1190137058 X:47807038-47807060 GGGCTGGGGGCAGGAGGAGGTGG + Intergenic
1190179228 X:48177504-48177526 GAGAGGAGGGGAGGGGGAGGGGG + Intergenic
1190190681 X:48274508-48274530 CAGAGGAGGGGAGGGGGAGGAGG + Intronic
1190752600 X:53375258-53375280 TAGATCAGGACAGGCAGAGGTGG - Exonic
1191785941 X:64917282-64917304 GAGATGAGGGTAGGAGTAGGGGG + Exonic
1192553589 X:72072593-72072615 GAGAAGATAGCAGGTGGAGGAGG - Intergenic
1194798561 X:98241776-98241798 GGGATGAGGGCTGGCAGGGGAGG + Intergenic
1195001446 X:100647078-100647100 GAGAAGAGGGAAAGGGGAGGGGG + Intronic
1195119721 X:101738374-101738396 GAGGGGAGGGGAGGGGGAGGGGG - Intergenic
1196783247 X:119400843-119400865 TTGATGAGGGCAAGCAGAGGTGG - Intronic
1196804628 X:119573856-119573878 GAGCTTAAGGCAGGCGGAGTAGG - Intergenic
1198033794 X:132781395-132781417 GAGTTGAAGGCAGGCCGAGATGG + Intronic
1198408822 X:136345108-136345130 GAGATGAGCACAGGCTCAGGTGG - Exonic
1198784647 X:140273934-140273956 GAGGTGAGGGAAGTCAGAGGGGG - Intergenic
1198934742 X:141894810-141894832 GAGAGGTGGGCAGGGAGAGGTGG + Intronic
1199600370 X:149538100-149538122 GAGATGAGGTGAGGAGGAGAGGG - Intergenic
1199650215 X:149941840-149941862 GAGATGAGGTGAGGAGGAGAGGG + Intergenic
1199733930 X:150666764-150666786 GGGAAGATGGCAGGAGGAGGAGG - Intronic
1199751552 X:150824140-150824162 GAGAAGAAGGAAGGAGGAGGAGG + Intronic
1199860529 X:151797038-151797060 GAGATGAAGCCAGGCTTAGGAGG - Intergenic
1199982250 X:152927607-152927629 GAGATCGGGGGAGGAGGAGGAGG - Intronic
1200787213 Y:7271758-7271780 GAGATGGGGGCTGGGGGTGGGGG + Intergenic
1201337060 Y:12892707-12892729 GAGAGGAGTGCAGGCTGAAGAGG - Intergenic
1201589088 Y:15593809-15593831 GCTTTGAGGGCAGGCAGAGGAGG - Intergenic
1201594594 Y:15653619-15653641 GAGAAAAGGGCAGGAGGAGATGG + Intergenic