ID: 1152532544

View in Genome Browser
Species Human (GRCh38)
Location 17:80927823-80927845
Sequence GAGGAGATGAGGGCAGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1099
Summary {0: 1, 1: 0, 2: 7, 3: 89, 4: 1002}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152532544_1152532551 10 Left 1152532544 17:80927823-80927845 CCTCCGCCTGCCCTCATCTCCTC 0: 1
1: 0
2: 7
3: 89
4: 1002
Right 1152532551 17:80927856-80927878 TCTGAGAATTCCCGCCCGCACGG 0: 1
1: 0
2: 0
3: 2
4: 43
1152532544_1152532557 23 Left 1152532544 17:80927823-80927845 CCTCCGCCTGCCCTCATCTCCTC 0: 1
1: 0
2: 7
3: 89
4: 1002
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1152532544_1152532553 19 Left 1152532544 17:80927823-80927845 CCTCCGCCTGCCCTCATCTCCTC 0: 1
1: 0
2: 7
3: 89
4: 1002
Right 1152532553 17:80927865-80927887 TCCCGCCCGCACGGAGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 358
1152532544_1152532552 13 Left 1152532544 17:80927823-80927845 CCTCCGCCTGCCCTCATCTCCTC 0: 1
1: 0
2: 7
3: 89
4: 1002
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532544_1152532556 22 Left 1152532544 17:80927823-80927845 CCTCCGCCTGCCCTCATCTCCTC 0: 1
1: 0
2: 7
3: 89
4: 1002
Right 1152532556 17:80927868-80927890 CGCCCGCACGGAGGAGCTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152532544 Original CRISPR GAGGAGATGAGGGCAGGCGG AGG (reversed) Intronic
900172446 1:1275585-1275607 GAGGAGGTGGGGGCAGGAGGTGG - Intergenic
900237383 1:1599252-1599274 GAGGAGAGGAGAGCGGGCGGAGG + Exonic
900359237 1:2279977-2279999 GAGGAGTGGAGGGCTGGGGGTGG - Intronic
900471375 1:2856673-2856695 AAGGAGAGAAGGGGAGGCGGAGG - Intergenic
900629280 1:3625139-3625161 GAGGAGGTGGGGGCAGGCGGCGG + Exonic
900801695 1:4741059-4741081 GAGGACATGAGAGCAGGGAGGGG + Intronic
900830366 1:4961021-4961043 CTGGAGATGAGGGCAGGATGTGG - Intergenic
900899395 1:5506612-5506634 GAGGAGGGCAGGGCAGGAGGTGG + Intergenic
901167218 1:7229421-7229443 GAGGAGGGGAGGGGAGGAGGGGG + Intronic
901167280 1:7229583-7229605 GAGGAGGGGAGGGCAGGAGGAGG + Intronic
901324111 1:8356804-8356826 TAGGAGGTGAGGGCAGGAGGTGG - Intronic
901666856 1:10831070-10831092 GAGGGGATGAGGACAGGAAGAGG + Intergenic
902550987 1:17219499-17219521 GAGGGGATGAGGCCAGGTGGAGG + Intronic
902791148 1:18769149-18769171 GAGGAGGGGAGGGCAGGGAGGGG - Intergenic
902922743 1:19676771-19676793 GGGGAGATGAGGTCAGAAGGAGG - Intronic
903043957 1:20552455-20552477 GGGGAGAAGAGGGCAAGGGGAGG + Exonic
903088226 1:20883326-20883348 AAGGAAATGAGGGCCGGGGGTGG + Intronic
903097226 1:20989050-20989072 GAGGAGAGGAGGGGAGGGGAGGG + Intronic
903323621 1:22556766-22556788 GAGGAGGGGAGGGCAGGGGCAGG + Intergenic
903596867 1:24502248-24502270 GAGGAGAGGAGGGGAGGGGATGG + Intergenic
903846058 1:26280490-26280512 GGGGAGGGGAGGGCAGGCTGCGG - Intronic
904207646 1:28865173-28865195 GAGGAGATGAGGCACGGGGGAGG - Intergenic
904371163 1:30048304-30048326 GAGGAGATCAGGGCAGACCCCGG - Intergenic
904581678 1:31548476-31548498 GAGGAGAAGAGGGATGGGGGTGG + Intergenic
905127433 1:35725532-35725554 GAGGAGAGGTGGGCGGCCGGAGG - Intronic
905193710 1:36257283-36257305 GAGCAGATGAGGGCACCTGGAGG - Intronic
905479085 1:38248889-38248911 CAGGAGATGTGGGCAGGTGCGGG - Intergenic
905986728 1:42291926-42291948 GAGGAGCCGAGGGCAGGAGCCGG + Intronic
906524883 1:46488268-46488290 GAGGAGAGGAGAGGAGGGGGCGG - Intergenic
906694074 1:47812275-47812297 GAGGAGATGACGGAAGGCACGGG + Intronic
906694561 1:47815343-47815365 GAGGCGATGAGAGCAGACAGGGG + Intronic
907336037 1:53700244-53700266 GGGGAGGTGAGGGCTGGCAGTGG - Intronic
907389032 1:54144543-54144565 GAGGAGGTGAAGGGCGGCGGGGG + Exonic
908320396 1:62972807-62972829 GAGGAGGAGAGGGAAGGAGGAGG + Intergenic
909032848 1:70561999-70562021 GAGGCCATGAGTGCAGGCTGGGG + Intergenic
909687566 1:78367979-78368001 AAGGAGAGGAGGGCAGGGGAGGG - Intronic
910434038 1:87187315-87187337 AAGGAGATGAGGGCAGATGAAGG + Intergenic
910860954 1:91741964-91741986 CATGAGATGAGGGCGGGCAGAGG - Intronic
912522927 1:110258874-110258896 GAGGAGATGGGAGCAGGAGGAGG - Intronic
915167737 1:153958067-153958089 GGGGAGATGAAGTCCGGCGGAGG - Intronic
915253168 1:154605074-154605096 CAGGAGATGAGGCCAGGAGGCGG - Intronic
915277737 1:154801116-154801138 GGGGAGATGAGGAAAGGAGGTGG + Intronic
915516503 1:156415872-156415894 GGGGGGATTAGGGCAGGAGGAGG + Intronic
915587049 1:156849490-156849512 GGGGAGGTGGGGGCAGGGGGTGG + Intronic
915740274 1:158113753-158113775 GAGCAGAGGAGGGCAGGGGAGGG - Intergenic
915881195 1:159673392-159673414 GGGGAGAAGAGGGCAAGGGGTGG - Intergenic
915921398 1:159978275-159978297 TGGGAGATGGGGGCAGGCGAGGG + Intergenic
916435824 1:164776977-164776999 GAGGAGGTGTGGGGGGGCGGGGG + Intronic
916932906 1:169597913-169597935 GAGGAGAAGAGTTCAGGCTGTGG - Intronic
917289791 1:173460669-173460691 GAGGCGAGGAGGGAAGGAGGAGG + Intergenic
917400367 1:174642655-174642677 GAGGAGAGGAGGGGAGAGGGTGG - Intronic
917481674 1:175417316-175417338 GAGGAGTTGTGGGCAGTGGGTGG + Intronic
917485032 1:175448098-175448120 GAGGAGAAGAGTACAGGTGGAGG - Intronic
917488180 1:175474338-175474360 GAGGAGATCAGGGCATCCAGAGG + Intronic
918006058 1:180543148-180543170 GAGAAGAAGAGGGGAGGGGGAGG + Intergenic
918040052 1:180908418-180908440 GAAGTGATGAGGGCAGGCCTGGG + Intergenic
918282791 1:183023087-183023109 GAGGAGAGGAGGGGAGGGGAGGG - Intergenic
918783430 1:188732274-188732296 GAGGCGATCAGTGCAGGCTGGGG + Intergenic
919932062 1:202227550-202227572 CAGCAGTTGAGAGCAGGCGGTGG + Intronic
920345195 1:205301773-205301795 GAGGAGAAGGAGGCAGGTGGTGG + Intergenic
920348330 1:205321319-205321341 GAGCGGAGGAGGGCGGGCGGCGG - Intronic
920795892 1:209136040-209136062 GAGGAGAGGAGGGGAGGGGAGGG - Intergenic
920835034 1:209502714-209502736 GAGAGGATGAGGGCAGGGGTAGG + Intergenic
921397082 1:214679853-214679875 GAGGAGAAGGGGGGAGGAGGAGG - Intergenic
921948310 1:220904254-220904276 CAGGAGATTGGGGCAGGTGGTGG - Intergenic
922453788 1:225757903-225757925 GAGGAGAAGAGGGGAGGGGAGGG + Intergenic
922572790 1:226643731-226643753 GAGGTGATGAGGGCTGGAGGGGG + Intronic
922621497 1:226991995-226992017 GAGGAGAGGAGGGGAGGGTGGGG + Exonic
922717576 1:227885295-227885317 GTGCAGCAGAGGGCAGGCGGAGG + Intergenic
922766293 1:228158227-228158249 GAGGAGACGGGGGCAGCCGAGGG + Exonic
922936337 1:229425920-229425942 GAGGGGATGAGAGGAGGAGGAGG + Intergenic
923229930 1:231976075-231976097 CAGGAGGTGAGGCCAGGCAGCGG + Intronic
924415105 1:243850151-243850173 GAGGACAGGAGGGGAGGAGGAGG - Intronic
924527149 1:244863306-244863328 GAGGAGCCGCGGGCGGGCGGCGG - Intronic
1062858175 10:789943-789965 GAGGCGCTGAGGGCAGGAAGAGG + Intergenic
1063223435 10:3992510-3992532 GAGAAGATGAGGGAAGGGGAGGG - Intergenic
1063462153 10:6221740-6221762 GGGGAGGTGAGCGCAGGCTGGGG + Exonic
1063482128 10:6385226-6385248 AAGGAGGTGTGGGCAGGAGGGGG + Intergenic
1063540403 10:6927955-6927977 AAGGAGGTGAAGGCAGGCGGAGG - Intergenic
1063542590 10:6949476-6949498 GAGGAGAAGAAGGCAGGGAGGGG - Intergenic
1063652896 10:7957272-7957294 GGGGAGATTAGGGCAGACGATGG + Intronic
1063705353 10:8424972-8424994 GAAGAGAGGAGGGGAGGGGGAGG + Intergenic
1063981239 10:11453538-11453560 GTGGAGATGATGGAAGGCAGCGG - Intergenic
1064433380 10:15290296-15290318 GAGGAGCCGAGGGCAGGGGATGG - Intronic
1064871823 10:19946164-19946186 GAGGAGATGATTGGAGGCAGGGG - Intronic
1065020734 10:21500163-21500185 GAGGTGACAAGGGAAGGCGGCGG + Intergenic
1065078326 10:22102951-22102973 GGGGAGATGCGGGCTGGGGGTGG + Intergenic
1065323818 10:24533157-24533179 GAGGAGGTGGTGACAGGCGGTGG - Exonic
1065968021 10:30784506-30784528 GAGGGGGTGGGGGCAGGCGGGGG - Intergenic
1066247390 10:33596582-33596604 GAGGGGATGTGGGCAGGTGTGGG - Intergenic
1066367783 10:34793368-34793390 AAAGAGAAGAGGGCAGGCTGGGG + Intronic
1066507177 10:36057353-36057375 GAGGAGATGACGGGAGGAAGGGG + Intergenic
1066633251 10:37477420-37477442 GGGGAGGTGAGGGGAGGGGGAGG - Intergenic
1067150350 10:43727751-43727773 AAGGAGATGAGGGAAAGGGGTGG + Intergenic
1067174139 10:43930636-43930658 GAGGAGATGTGAGGAGGCTGGGG + Intergenic
1067688004 10:48479337-48479359 ATGGAGATGAGGGAAGGCGGAGG + Intronic
1067878671 10:50025367-50025389 GAGGAGACGAGGGAGGGGGGTGG - Intergenic
1067893055 10:50152569-50152591 GAGGAGACGAGGGAGGGGGGTGG + Intergenic
1068210584 10:53914613-53914635 GTGGAGTTGGGGGCTGGCGGAGG + Intronic
1069449220 10:68502747-68502769 GAGGAGAGGAGGGGAGGGGAGGG + Intronic
1069556031 10:69399125-69399147 GAGGAGGTGAGGGTGGGCGTGGG + Intronic
1069610874 10:69771682-69771704 GAGGTTAGGAGGGCAGGCTGTGG + Intergenic
1069671312 10:70206859-70206881 GAGGAGAGGAGGGGAGGGGAGGG + Intronic
1069694284 10:70375390-70375412 GGGTGGATGAGGGAAGGCGGAGG + Intronic
1069723672 10:70564514-70564536 CAGGAGGTGAGGGGAGGCTGAGG + Exonic
1070550353 10:77486237-77486259 GAGGAGATGAGGTGAGGTTGAGG - Intronic
1070872932 10:79773653-79773675 GAGTAGATGAGGGAATGCAGCGG + Intergenic
1070960577 10:80497677-80497699 CTGGAAATGAAGGCAGGCGGAGG - Intronic
1071137251 10:82466835-82466857 GAGGAGGTGAGGACAGGCAAGGG + Intronic
1071293584 10:84203857-84203879 GAGGAGCTAAGGGGAGGAGGTGG + Intronic
1071639858 10:87295803-87295825 GAGTAGATGAGGGAATGCAGCGG + Intergenic
1071655376 10:87442149-87442171 GAGTAGATGAGGGAATGCAGCGG - Intergenic
1072787426 10:98293763-98293785 GAGGAGAAAAGGCCAGGTGGTGG + Intergenic
1072839979 10:98762004-98762026 GAGGAGAAGAGGGGAGGGGAGGG - Intronic
1073178258 10:101569465-101569487 GGGGAGATGCCGGCAGGCAGGGG + Intergenic
1073462125 10:103671839-103671861 GAGGAGATGAAGGCAGGGACAGG - Intronic
1073553593 10:104426433-104426455 GAGAGGATGATGGAAGGCGGCGG - Intronic
1074326363 10:112455283-112455305 GAGGAGGGGAGGGGAGGGGGAGG - Intronic
1074329766 10:112494484-112494506 GAGGAAAGGAGGGCAGGGGAAGG - Intronic
1074409254 10:113211166-113211188 GAGGAGAGGAGGGGAGGGGAGGG - Intergenic
1074923775 10:118046711-118046733 GAGGAGCTGAGGCGAGGGGGAGG - Intergenic
1075077351 10:119360077-119360099 GAGGAGATAGGGGGAGGCTGAGG + Intronic
1075256828 10:120932039-120932061 GAGGAGATGAGAGTAGGGGTGGG - Intergenic
1075419922 10:122293122-122293144 GAAGAGATCAGGGCAGGAGGTGG + Intronic
1075575205 10:123572771-123572793 GAGGAGGAGAGGGGAGGAGGAGG + Intergenic
1075575211 10:123572787-123572809 GAGGAGGAGAGGGGAGGAGGAGG + Intergenic
1076667821 10:132102945-132102967 GAGGAGACGCGGGCATGGGGTGG + Intergenic
1076667837 10:132102987-132103009 GAGGAGATGGGGGCGTGGGGTGG + Intergenic
1076669533 10:132111935-132111957 CAGGATATGTGGGCAGGCAGGGG + Intronic
1076669554 10:132112014-132112036 CAGGAGGTGTTGGCAGGCGGGGG + Intronic
1076778104 10:132709294-132709316 GAGGGGATGGGGGAAGGAGGGGG + Intronic
1076844301 10:133061516-133061538 GAGGGGGTGAGGCCAGGTGGCGG - Intergenic
1076988161 11:254147-254169 GAGCAGATGAGGGTAGGAGCAGG - Intergenic
1077161802 11:1116878-1116900 GAGGAGACGCGGACAGGCGGGGG + Intergenic
1077178429 11:1201070-1201092 GAGGAGGGGAGCGCAGGCTGAGG - Intronic
1077299234 11:1839541-1839563 GAGGAGGTGAGAGTAGGGGGTGG + Intronic
1077424041 11:2466182-2466204 GAGGAGATGCAGGCAGGCTGTGG + Intronic
1078306066 11:10187469-10187491 GAGGAGATGAGCGAAGGCAGGGG - Intronic
1078600320 11:12724762-12724784 GAGGAGGAGAGGGCAGGGAGAGG - Intronic
1078660344 11:13280832-13280854 GAGGAGATGAGGGGACGATGGGG - Intronic
1078829427 11:14965442-14965464 GAGGAGATGAGGGCCGTGGATGG + Intronic
1079441046 11:20515278-20515300 GAGTAGCTGAGGTCAGGTGGAGG - Intergenic
1079934497 11:26600405-26600427 GAGGAGAGGAGGGCAGGGGAAGG - Intronic
1079995780 11:27293621-27293643 GGGGAGGGGAGGGGAGGCGGAGG + Intergenic
1080034943 11:27700659-27700681 GAGGAGGTGAGGACAGGCCCCGG - Intronic
1080397457 11:31903088-31903110 CAGGGGAAGAGGGCAGGAGGAGG + Intronic
1080542355 11:33280016-33280038 GGGGAGCTGAGGGGAGGTGGGGG + Intronic
1080774576 11:35373472-35373494 GAGGGGCTGAGGTCAGGCTGTGG + Intronic
1081597159 11:44467225-44467247 GAGGAGCTGAGGGAAGGCTGAGG + Intergenic
1081672733 11:44950706-44950728 GTGGAGCTGATGCCAGGCGGAGG + Intronic
1081773598 11:45664159-45664181 GAGGAGCTGGGGGCAGGCTTGGG - Intronic
1081831801 11:46121146-46121168 GAGGAGAGGAGAGGAGGAGGAGG - Intronic
1082097558 11:48143788-48143810 GAGGAGGAGAGGGGAGGGGGAGG - Intronic
1082097572 11:48143821-48143843 GAGGAGGAGAGGGGAGGGGGAGG - Intronic
1082957660 11:58887511-58887533 GAGGAGAGGAGAGGAGGGGGAGG - Intronic
1083599870 11:63939816-63939838 GGGAAGATGCGGGGAGGCGGGGG + Intronic
1083614030 11:64017777-64017799 GAGGTGATGGGGGGAGGTGGGGG - Intronic
1083667267 11:64282561-64282583 CATGAGATGAGGGCAGGGGCGGG - Intronic
1084005315 11:66319573-66319595 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
1084040857 11:66541927-66541949 GAGGATATGAGGGCAAGGGAGGG + Intronic
1084104919 11:66975065-66975087 GGGGAGAGGAGGGGAGGGGGAGG + Intergenic
1084149507 11:67281621-67281643 GGGGAGAGGAGGGGAGGGGGCGG - Intronic
1084322206 11:68379765-68379787 GAGGAGAGGAGGACAGCAGGTGG - Intronic
1084424414 11:69076808-69076830 GAGGGCAGGAGGGCAGGTGGAGG - Intronic
1084424474 11:69077007-69077029 GAGGGCAGGAGGGCAGGTGGAGG - Intronic
1084424551 11:69077256-69077278 GAGGGCAGGAGGGCAGGTGGAGG - Intronic
1084424583 11:69077364-69077386 GAGGGCAGGAGGGCAGGTGGAGG - Intronic
1084452182 11:69245722-69245744 GAGCTGATGAGGTCAGGAGGTGG + Intergenic
1084471744 11:69365697-69365719 GAGGAGAAGCGGGGAGGAGGAGG + Intronic
1084659876 11:70540395-70540417 GAGGTGATGAAGGCAGGCTGGGG + Intronic
1084881910 11:72177627-72177649 GAGGAGATGAGGTGAGGAGTGGG + Intergenic
1085388260 11:76169427-76169449 GGGGAGATGAGGGCAGTCAAAGG - Intergenic
1085448033 11:76614475-76614497 GAGGAGAATAGGGCAGGAGAAGG - Intergenic
1085529498 11:77183152-77183174 GAGGAGGTGAGGGCAGACGCTGG + Exonic
1085699794 11:78735840-78735862 GAGGAGAGGAGGGGAGGGGAGGG - Intronic
1086536453 11:87852802-87852824 GAAAAGATGAGGGCAGGAGAAGG - Intergenic
1087149933 11:94850254-94850276 GAGGAGGTGAGACCAGGCTGTGG + Exonic
1088057085 11:105597308-105597330 GAGGAGAGGAGGGGAGGGGAGGG - Intergenic
1088123532 11:106396767-106396789 GAGGAGAGGAGGGGAGGGGAAGG - Intergenic
1089009942 11:115123979-115124001 AATGAGATGAGGGCAGGGCGGGG - Intergenic
1089072370 11:115710553-115710575 TAGGAGATGGGGGGAGGCGATGG + Intergenic
1089213783 11:116823356-116823378 GAGGAGGGGAGGGCAGCCAGGGG - Intergenic
1089367641 11:117931044-117931066 GAGCAGCTGAGGACAGGAGGTGG - Intergenic
1089377521 11:118005100-118005122 GAGGGGATGTGGGGAGGTGGAGG - Intergenic
1089378806 11:118013199-118013221 GAGGGGATGAGGGCAGTCCAGGG + Intergenic
1089383437 11:118052351-118052373 GAGCTGCTGAGGGCAGGCTGGGG + Intergenic
1089390606 11:118099192-118099214 GAGGGGGTGAGGGCAGGGGTGGG - Intronic
1089505305 11:118958344-118958366 GGGGAGAGGAGGGCAGGAGGAGG - Exonic
1089646563 11:119884244-119884266 GAGGAGAGGAGAGGAGGCAGAGG - Intergenic
1089832070 11:121337778-121337800 GAAGAGGGGAGGGCAGGTGGTGG - Intergenic
1089970542 11:122689687-122689709 GTGGGGATGAGGGCAGTCTGGGG - Intronic
1090178683 11:124674141-124674163 GGGCAGAGGAGGGCGGGCGGAGG - Exonic
1090270094 11:125379985-125380007 GAGGTGATGAGGGTAGGGGGTGG + Intronic
1090278455 11:125435909-125435931 GTAGAGATGCGGGCAGGTGGGGG - Intergenic
1090439379 11:126713360-126713382 GAGGGGATGAGGGCAGGGCTAGG + Intronic
1091042456 11:132294604-132294626 GAGCAGTTGAGGACAGGAGGAGG + Intronic
1091070518 11:132558420-132558442 GAGGGGAGGAGGGGAGGAGGAGG - Intronic
1091546116 12:1502337-1502359 GAGGAGAGGAGAGGAGGCCGTGG - Intergenic
1092009658 12:5098862-5098884 GAGGAGTAGAAGGGAGGCGGAGG + Intergenic
1092461013 12:8686261-8686283 GAGGAGAGGAGGGGAGGGGAGGG - Intronic
1092921184 12:13233134-13233156 GAGGAGGGGAGGGGAGGGGGAGG - Intergenic
1092921187 12:13233139-13233161 GAGGAGAGGAGGGGAGGGGAGGG - Intergenic
1093036375 12:14335966-14335988 GAGGCCATAAGGGCAGGCTGTGG - Intergenic
1094079398 12:26516173-26516195 GGGGAGGGGAGGGGAGGCGGGGG + Intronic
1094083825 12:26566456-26566478 GAGGAGAGGAGAGGAGGAGGAGG + Intronic
1094473454 12:30823777-30823799 GAGAAGAGAAGGGCAGGCTGGGG - Intergenic
1094540984 12:31363053-31363075 GAGGAGATGGAGGGAGGTGGAGG + Intergenic
1095787456 12:46125432-46125454 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
1096087617 12:48876331-48876353 CAGGAGATGAGGTCAGCCAGGGG - Intergenic
1096257483 12:50072323-50072345 GAGGGGAGGAGGGGAAGCGGGGG - Intronic
1096636808 12:52965426-52965448 GAGGAGGAGAGGGGAGGAGGTGG + Intergenic
1096747629 12:53738885-53738907 GAAGAGAGGAGAGCAGGCAGAGG + Intergenic
1096781509 12:53994823-53994845 GAGGGAAGGAGGGCGGGCGGCGG + Intronic
1096842461 12:54388107-54388129 GAGGAGCTGAGGCCTGGCTGGGG + Intronic
1096924826 12:55132429-55132451 GAGGAGATTAGGGCACACAGAGG + Intergenic
1097981488 12:65741579-65741601 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
1097981501 12:65741614-65741636 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
1098180163 12:67838990-67839012 GAAGAGATGAGGAAAGGCAGAGG - Intergenic
1098288427 12:68932872-68932894 GAACACATGAGGGCAGGCGGGGG + Intronic
1099121899 12:78700705-78700727 GAGGAGAGGAGGGGAGGAGAGGG + Intergenic
1099284831 12:80704691-80704713 TGGGAGTTGAGGGCAGGAGGTGG - Intergenic
1100912812 12:99384634-99384656 GAGGAGAGGAGGGGAGGGGAGGG - Intronic
1101371053 12:104130916-104130938 GGGGTGGGGAGGGCAGGCGGTGG + Intronic
1101698378 12:107148537-107148559 GAGGAGGACATGGCAGGCGGAGG + Intergenic
1102004542 12:109580896-109580918 GAGGGAGGGAGGGCAGGCGGGGG + Intronic
1102614845 12:114144696-114144718 GAAGAGATGAGGGGTGGTGGTGG - Intergenic
1103091703 12:118102775-118102797 GAGGAGATGGAGCCAGGAGGTGG - Intronic
1103381483 12:120496937-120496959 GGGGAGTTGAGGGAAGGTGGTGG + Intronic
1103410859 12:120710550-120710572 GAGAAGAAGAAGGCGGGCGGCGG + Exonic
1103510614 12:121471193-121471215 TAGAAGATGAGGTCAGACGGAGG - Intronic
1104003152 12:124873338-124873360 AGGGAGATGGGGGCTGGCGGGGG + Intronic
1104139945 12:125978187-125978209 GAGGTGGTCAGGGCAGGCAGGGG + Intergenic
1104746752 12:131215481-131215503 GCAGAGCTGAGGGCAGGGGGAGG + Intergenic
1104906228 12:132214813-132214835 TTGGAGACCAGGGCAGGCGGTGG + Intronic
1104933751 12:132353769-132353791 GAGGGGATGGTGGCAGGAGGAGG - Intergenic
1104982326 12:132579045-132579067 GAGGAGGGAAGGGGAGGCGGGGG - Intronic
1105007284 12:132729415-132729437 GGGGAGATGAGGGGAGGGGTAGG + Intronic
1105007337 12:132729525-132729547 GGGGAGGTGAGGGAAGGGGGAGG + Intronic
1105007374 12:132729604-132729626 GGGGAGGTGAGGGGAGGGGGAGG + Intronic
1105020096 12:132810320-132810342 AAGCAGATGTGGGCAGGCGGAGG - Intronic
1105287969 13:19022806-19022828 GAGGAGAGGAGGGGAGGAGAGGG + Intergenic
1105293660 13:19070751-19070773 GAGGGGAGGAGTGCAGGAGGAGG - Intergenic
1105384876 13:19920497-19920519 GAGAAGATGAGGGAAGGGGAGGG + Intergenic
1105388986 13:19958498-19958520 CAGGAGTCGAGGGCCGGCGGAGG + Intergenic
1105544033 13:21339002-21339024 GGGCAGATGAGGGCAGGTGAGGG - Intergenic
1106466714 13:30020171-30020193 GAGGAGGTGTGGGCGTGCGGGGG - Intergenic
1106512218 13:30421845-30421867 GAGGAGGTGGGGGAGGGCGGAGG + Intergenic
1106584041 13:31042126-31042148 GTGGAGACGACCGCAGGCGGAGG - Intergenic
1106609408 13:31264126-31264148 GAGGTGATGAGGCCATGGGGAGG - Intronic
1106620047 13:31364315-31364337 GAGGGGGTCAGGGCAGGCAGGGG - Intergenic
1107692914 13:42969796-42969818 GAGGAGATAAGGGGAGGCGCTGG - Intronic
1108063171 13:46553069-46553091 GAGGAGGAGAGAGCAGACGGCGG + Intergenic
1108258735 13:48636029-48636051 GAGGAGACGAGGTCAGGGAGCGG + Intergenic
1109429465 13:62212750-62212772 GAGGAGAGGAGGGGAGGGGAGGG - Intergenic
1110509358 13:76330816-76330838 GAAGAGATGATGGCAGCCAGAGG + Intergenic
1110518573 13:76446136-76446158 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
1110575272 13:77048141-77048163 GAGGTGATGAGGTCATGGGGTGG + Intronic
1111132597 13:83996592-83996614 GAGGTGAGGGCGGCAGGCGGCGG - Intergenic
1112015746 13:95330074-95330096 GAGGAGGTGAGGGGATGGGGAGG + Intergenic
1112350156 13:98626371-98626393 GGGGAGATGAGGGGAGGGGAGGG + Intergenic
1112350170 13:98626395-98626417 GAGGAGGGGAGGGGAGGGGGAGG + Intergenic
1113143732 13:107183842-107183864 GAGGGGAGGAGGGCTGGGGGAGG + Intronic
1113236279 13:108278658-108278680 GAGGAGAGGAGGAGAGGAGGAGG - Intronic
1113302126 13:109033771-109033793 CAGGAGCTGAGGGCAGGAGGTGG + Intronic
1113909719 13:113836336-113836358 GAGGGGAGGAGGGGAGGAGGAGG + Intronic
1113933995 13:113983758-113983780 GATGAAATGAAGGCAGGCTGCGG + Intronic
1113934348 13:113985756-113985778 GATGAAATGAAGGCAGGCTGCGG + Intronic
1113934692 13:113987746-113987768 GATGAAATGAAGGCAGGCTGCGG + Intronic
1113940328 13:114015422-114015444 GAGGGGCTGAGGGCGGGCGCAGG + Intronic
1114731754 14:25000492-25000514 GAAGACAGGAGGGCAGGAGGAGG - Intronic
1116551539 14:46246085-46246107 GTGGAGATGAGGGTAGGGGTGGG - Intergenic
1116788925 14:49318872-49318894 GAGGAGGGGAGGGCAGGGGAGGG + Intergenic
1117830060 14:59741249-59741271 GAGGAAGTGAGGCCAGGCTGAGG - Intronic
1118322906 14:64763808-64763830 CAAGAGGTGAGGGAAGGCGGTGG + Intronic
1118459561 14:65976059-65976081 GAGGAGAAGGGGGAAGGAGGAGG + Intronic
1118730008 14:68659465-68659487 GAGGAGAAGAGGGCGGGAGGCGG + Intronic
1118757757 14:68857629-68857651 GAAGAAATGAGGGCAGGAGAAGG - Intergenic
1118982841 14:70730321-70730343 GCGGAGATGAGGGGAGCTGGCGG - Exonic
1119160489 14:72448138-72448160 ATGGAGATCAGGGCAGGTGGTGG + Intronic
1119764246 14:77178446-77178468 GAGGAGAGGAGGGGAGGGGAGGG - Intronic
1119764389 14:77179285-77179307 GAGGAGAGGAGGGGAGGGGAGGG - Intronic
1120903126 14:89593073-89593095 GAGGGAATGAGGGAAGGAGGAGG + Intronic
1121626404 14:95388616-95388638 GAGGAAATTAGGGCATGCAGAGG + Intergenic
1121741373 14:96254645-96254667 GTGGGGCTGAGGGCAGGGGGAGG - Intronic
1122153762 14:99738329-99738351 GAGGATATGAGGGCACACAGAGG - Intronic
1122328442 14:100896885-100896907 CATGAGATGGGGCCAGGCGGTGG - Intergenic
1122415816 14:101549031-101549053 GAGGAGCTGAGGGCAGCCTGGGG - Intergenic
1122426275 14:101607860-101607882 GAGGAGAGGAGGAGAGGTGGAGG - Intergenic
1122426323 14:101608044-101608066 GAGGAGAGGAGGAGAGGTGGAGG - Intergenic
1123410632 15:20056170-20056192 GGGGAGCTGAGGGCAGGCAGAGG - Intergenic
1123519962 15:21062876-21062898 GGGGAGCTGAGGGCAGGCAGAGG - Intergenic
1123700650 15:22912525-22912547 GAGAAGATGCAGGCAGGTGGAGG - Intronic
1123988895 15:25668629-25668651 GAGGAAGGGAGGGCAGGCTGGGG - Intergenic
1123996355 15:25720582-25720604 GAGGAGAGGAGGGTAGGAGAAGG + Intronic
1124441363 15:29688393-29688415 GAGGAGCTGAAGCCACGCGGGGG + Intergenic
1124635389 15:31361578-31361600 GAGGAAATGAAGGCTGGGGGAGG + Intronic
1124720257 15:32105470-32105492 GAGGAGAGGAGGAAAGGAGGAGG + Intronic
1124720262 15:32105489-32105511 GAGGAGAGGAGGAAAGGAGGAGG + Intronic
1124966231 15:34435151-34435173 GAGGAGCTGAGGCCTGGAGGGGG + Intronic
1124982833 15:34581234-34581256 GAGGAGCTGAGGCCTGGAGGGGG + Intronic
1125238476 15:37545293-37545315 GCGGAAATGAGGGTGGGCGGGGG + Intergenic
1125281588 15:38047552-38047574 GAGGAAAAGAGGGAAGGGGGAGG + Intergenic
1125587110 15:40828740-40828762 GAAGAAATGAAGGCAGGAGGAGG + Intergenic
1125649114 15:41298923-41298945 GAGGAGTTGGGGGCAGAGGGGGG + Intergenic
1125664204 15:41417308-41417330 GATCAGGTGAGGGCAGGCCGCGG + Exonic
1125930230 15:43594657-43594679 GAGGAAATGAGGGAAGGAGATGG - Intronic
1125943398 15:43694489-43694511 GAGGAAATGAGGGAAGGAGATGG - Intronic
1126167524 15:45666730-45666752 GAGGAGAGGAGGGAAGGGGAGGG - Intronic
1126167565 15:45666835-45666857 GAGGAGAGGAGGGGAGGGGAGGG - Intronic
1126889594 15:53190073-53190095 GAGGAAAAGAGGGAAGGAGGGGG + Intergenic
1127380853 15:58429430-58429452 GAGGAGATGAGGGTGGGCACAGG + Intronic
1127381939 15:58438153-58438175 GTGGAGAGGAGGGCAGGGAGAGG - Intronic
1127533169 15:59865034-59865056 GATGAAAGGAGGGCAGGAGGAGG - Intergenic
1127906818 15:63382060-63382082 GAGGAGCTGCTGGCAGGCGTGGG + Exonic
1128072558 15:64806832-64806854 GAAGAGAGGAAGGCAGGCGGAGG + Intergenic
1128107140 15:65053534-65053556 GAGGAGCTGAGGTCAGAGGGGGG - Exonic
1129107106 15:73318047-73318069 GAGGAAATGAGGACAGGGAGGGG + Intergenic
1129661364 15:77554762-77554784 GTGGAGATGAGAGCAGGAGGGGG + Intergenic
1129672256 15:77613876-77613898 CAGGTGGTGAGGGCTGGCGGGGG + Exonic
1129686966 15:77691847-77691869 GAGAAAATGAGTGCAGGTGGGGG + Intronic
1129930613 15:79407510-79407532 GAGGCAATGAGGGAAGACGGGGG + Intronic
1130108484 15:80946500-80946522 GAGGAGGTGCGGGAAGGCGGAGG - Intronic
1130141696 15:81231279-81231301 GAGGAGAGGAGGGGAGGGGAGGG + Intronic
1130180535 15:81622852-81622874 GAGGAGCTGAGGGGAGAAGGGGG - Intergenic
1130226092 15:82059149-82059171 AAGGAGAGGAGGGGAGGGGGAGG - Intergenic
1130872409 15:87981856-87981878 GAGGAGATGAGAGGAGGTGGTGG + Intronic
1131433178 15:92402747-92402769 GAGGAAATGTGGGGAGGCAGAGG - Intronic
1131525138 15:93146560-93146582 GAGGTGGTAGGGGCAGGCGGAGG - Intergenic
1132163210 15:99562474-99562496 TTGGAGATGAGGGCGGGAGGGGG + Intergenic
1132425325 15:101710966-101710988 GAGGAATTCAGGGCAGGAGGTGG + Intronic
1132551511 16:555650-555672 GAGGTGATGAGGGAAAGGGGGGG + Intergenic
1132767362 16:1541275-1541297 GAGGTGAGGGGGGCAGGTGGGGG + Intronic
1132817535 16:1839655-1839677 GAGGGAAGGAGGGCAGGCAGAGG - Exonic
1133022862 16:2974525-2974547 GAGTAGGTGAGGGCGGGAGGGGG - Intronic
1133100655 16:3477471-3477493 CAGGTGATGTGGGCTGGCGGTGG + Intronic
1133139633 16:3734686-3734708 GAGGAGGCGCGGGCAGGGGGTGG - Intronic
1133309815 16:4837590-4837612 GGGGAGAAGATGGCAGGGGGAGG + Intronic
1133310014 16:4839138-4839160 GGGGAGAAGATGGCAGGGGGAGG + Intronic
1133363256 16:5190734-5190756 GCAGAGATGAGAGCTGGCGGAGG - Intergenic
1133520215 16:6549347-6549369 GAGGGGAGGAGGGAAGGAGGAGG + Intronic
1134090719 16:11390369-11390391 GAGCAGAGGAGGCCATGCGGCGG - Exonic
1134470934 16:14525516-14525538 CAGGAGATGAGGGAAGGCAATGG + Intronic
1134834940 16:17353349-17353371 GGGGAAGTGAGGGCAGGAGGAGG + Intronic
1135027526 16:19010142-19010164 GAGGAGAGGAGGGGAGGGGAGGG - Intronic
1135066547 16:19314923-19314945 GAGGGGATGAGTGGAGGGGGAGG + Intronic
1135264361 16:21009905-21009927 GAGGAGAGGAGGGGAGGGGAGGG + Intronic
1135608941 16:23848013-23848035 AAGGGGATGAGGGCAGGGGAGGG + Intronic
1136275983 16:29179776-29179798 GAGGCCATGAGGGCAGTGGGTGG + Intergenic
1136356104 16:29745642-29745664 GAGGTGCTGGCGGCAGGCGGTGG - Intronic
1137289956 16:47045730-47045752 GAGGAGAGGAGGGGAGGGGAGGG - Intergenic
1137534273 16:49305754-49305776 GAGGAGAGGAGGGGAGGGGAGGG - Intergenic
1137542515 16:49374636-49374658 GAAGAGCTGAGGGCAGTAGGAGG - Intronic
1137706351 16:50538533-50538555 GTGGACTTGAGGGCAGGCAGAGG + Intergenic
1138229681 16:55327830-55327852 GAGGAGAGGAAGGCAGAGGGAGG + Exonic
1138293855 16:55870280-55870302 GAGGAGGTGAGAGGAGGAGGGGG + Intronic
1138301514 16:55933913-55933935 GAGGAGATGATAGGAGGAGGTGG - Intronic
1138404514 16:56778944-56778966 GAGGAGAAGAAGCCAGGAGGAGG + Intronic
1138667748 16:58586360-58586382 GGGGAGGGGAGGGCAGGGGGAGG + Intronic
1138901323 16:61274450-61274472 GATGGGTTGAGGGCAGGCTGTGG + Intergenic
1139469404 16:67170337-67170359 CAGGAGATGAGGCCAGGAGGGGG - Intronic
1139519479 16:67472378-67472400 GAGGAGCTGGGGGCTGGGGGAGG - Intronic
1139551271 16:67674359-67674381 CAGGAGACGAGGGCTGGCAGGGG + Intergenic
1139961041 16:70717351-70717373 GAGGACTTGAGGACAGGAGGTGG + Intronic
1140031850 16:71345277-71345299 GGGGAGATGAGGCCGGGAGGAGG + Intergenic
1141445921 16:84058362-84058384 GAGGAAAAGAAGGCAGGCAGGGG + Intronic
1141477481 16:84283565-84283587 GAGCGGGTGAGGGCAGGTGGGGG + Intergenic
1141594619 16:85089642-85089664 GAGGGGAGGATGGCAGGAGGAGG - Exonic
1141617829 16:85220268-85220290 TAGGAGCTGGGGGCAGGCGGGGG + Intergenic
1141841555 16:86577158-86577180 AAAGAGATGAGGGAAGGGGGAGG - Intronic
1142080354 16:88145838-88145860 GAGGCCATGAGGGCAGTGGGTGG + Intergenic
1142147679 16:88499386-88499408 GAGGAGAAGAGAGCAGTCGTGGG + Intronic
1142149441 16:88506184-88506206 GAGGAGACCAGGGCAGGAGGTGG + Intronic
1142605533 17:1079032-1079054 GAGGAGAGGAGGGAAGGGGAAGG + Intronic
1142727998 17:1830237-1830259 GAGGAGATGGCGGGGGGCGGTGG + Intronic
1142884662 17:2905226-2905248 GAGGAGAGAAGGGAAGGCGCAGG + Intronic
1142977817 17:3656084-3656106 CAGGGGGTGAGGGCTGGCGGGGG - Intronic
1142977849 17:3656162-3656184 CAGGGGGTGAGGGCTGGCGGGGG - Intronic
1143432238 17:6895571-6895593 GAGGAGATGAGAGAAGGGGCTGG - Intronic
1143704617 17:8687735-8687757 GAGGAGAGGTGGGGAGGGGGAGG - Intergenic
1143767342 17:9146359-9146381 GATGAGCTCAGGGCAGGAGGTGG - Intronic
1144556906 17:16290356-16290378 GGGGAGATGAGGGGAGGGGAGGG - Intronic
1144728098 17:17511792-17511814 GGGGAGATGGGGGCAGGGGTGGG - Intronic
1144758614 17:17694737-17694759 GGGGCGCTGAGGCCAGGCGGGGG + Intronic
1145056580 17:19707342-19707364 GAGGAGATTATGACAGACGGAGG - Intronic
1145815926 17:27794972-27794994 GAGGAGTTGGGGGGAGGAGGTGG - Intronic
1146418840 17:32663431-32663453 GAGGAGAGGAGAGCATGCAGGGG + Intronic
1147042979 17:37732098-37732120 GAGGAGAAGAGAGCAAGCCGGGG + Intronic
1147209877 17:38866745-38866767 GTGGAGATGGGGGCAGGTGGTGG - Intergenic
1147978095 17:44259357-44259379 GAGAAGATCAGGCCAGGCCGAGG + Intronic
1148019223 17:44542432-44542454 GGGGAGTTGAGGGCAGGGGTTGG - Intergenic
1148111768 17:45148538-45148560 GAGGAGCTGTGGGAAGGGGGAGG + Exonic
1148216272 17:45835498-45835520 GAGAAGATGGGGGCTGGAGGGGG + Exonic
1148342479 17:46881581-46881603 GCTCAGATGAGGGCAGGAGGAGG - Intronic
1148487895 17:48003120-48003142 GTGGGGGTGAGGGCAGGGGGTGG + Intergenic
1148698590 17:49575540-49575562 CAGGAGAGGACGGCACGCGGGGG - Intergenic
1149437480 17:56645295-56645317 GAGGGGATGAGGGCAGAGGTGGG - Intergenic
1149578029 17:57727687-57727709 GAGGAGGGAAGGGCAGGAGGAGG + Intergenic
1149581636 17:57754691-57754713 GAGGAGAAGAGGGGAGGCCCAGG + Intergenic
1150089450 17:62310048-62310070 GAGGAGAGGAGGAGAGGAGGAGG - Intergenic
1150106412 17:62465612-62465634 GATGAGATGAGGCCAGGCACTGG - Intronic
1150265271 17:63828147-63828169 GAGGAGGGGAAGGCAGGCAGCGG + Exonic
1150311165 17:64130255-64130277 GCGGAGATGGGGGCGGGCCGAGG + Intronic
1150436443 17:65157813-65157835 GATGAGAAGAGGACAGGCTGAGG - Intronic
1150613101 17:66749279-66749301 GAGGGGTGGAGGGCAGGGGGAGG - Intronic
1150764756 17:67993999-67994021 GAGGAGAGGCGGGAAGGCGGTGG + Intergenic
1150901987 17:69289618-69289640 GAGGAGATGAGAGCAAGAGAAGG + Intronic
1150964181 17:69948498-69948520 GAGGAGGAGAGGGGAGGGGGAGG + Intergenic
1151331871 17:73414763-73414785 GAGGAGATGAGAGAACGGGGTGG + Intronic
1151354831 17:73552060-73552082 GAGGGGTGGGGGGCAGGCGGTGG - Intronic
1151356647 17:73562568-73562590 GGGGAGAAGAAGGCAGGCGTGGG + Intronic
1151384572 17:73747303-73747325 GAGCAGCTCTGGGCAGGCGGAGG + Intergenic
1151540409 17:74761928-74761950 GGGGAGATGGGGACAGGCAGAGG + Intronic
1151548980 17:74810511-74810533 TGAGAGATGAGGACAGGCGGAGG - Intronic
1151626275 17:75277806-75277828 TGGGAGATGGGGGCAGGGGGAGG - Intronic
1151698014 17:75727875-75727897 GAGGACAGCAGGGCAGGAGGGGG + Intronic
1151786643 17:76278449-76278471 GAGGAGCTGAGGGCAGCCCCGGG + Intronic
1152090233 17:78242411-78242433 CAGGAGATGAGGACAGATGGGGG - Intergenic
1152270018 17:79319061-79319083 GAAGACATGAGGGTGGGCGGAGG + Intronic
1152296019 17:79467343-79467365 GTGGAGATGAGGGCAGAGCGGGG + Intronic
1152326030 17:79637750-79637772 GAGGAGAGGAGGGGAGGGGAAGG + Intergenic
1152348322 17:79768510-79768532 GTGGAGATGAGGGCCGGACGTGG + Intergenic
1152369713 17:79878701-79878723 GTGGAGCAGAGGGCAGGCAGAGG - Intergenic
1152462435 17:80448644-80448666 GAGGAGAAGAGGGAAGGACGTGG - Intergenic
1152494944 17:80664465-80664487 AAGGAGAAGGGGGCAGGCGCAGG - Intronic
1152532544 17:80927823-80927845 GAGGAGATGAGGGCAGGCGGAGG - Intronic
1152579690 17:81160443-81160465 GAGGAAATGAGGGCAGCGGACGG - Intronic
1152623992 17:81380026-81380048 GAGGATGTGAGGGGAGGCGGGGG - Intergenic
1152796537 17:82310382-82310404 GAGGAGATGAGGAGGGGAGGAGG + Intergenic
1152855363 17:82662522-82662544 AGGGAGGTGAGGGCAGGTGGGGG + Intronic
1152875500 17:82784418-82784440 GTGGAGGTCAGGGCAGGCTGAGG + Intronic
1153107322 18:1542646-1542668 GAGGAGAGGAGGGGAGGGGAGGG - Intergenic
1153238850 18:3013113-3013135 GGGCGGCTGAGGGCAGGCGGCGG + Intronic
1153950574 18:10054563-10054585 CAGGAGATTAGCGCAGGGGGAGG - Intergenic
1154041993 18:10865162-10865184 GAGGACATGAAGGCAGGATGTGG + Intronic
1156391383 18:36653595-36653617 ATGGAGATGAGGGCAGAGGGAGG + Intronic
1156479589 18:37427583-37427605 GAGGAGATGAGGTCAGGTTGGGG - Intronic
1157288042 18:46390709-46390731 AAGGAAATGTGGGAAGGCGGTGG + Intronic
1157656334 18:49393048-49393070 GAGGGGAGGAGGGGAGGAGGAGG + Intronic
1157700316 18:49758114-49758136 GAGCAGCTGAGGGCAGCAGGTGG + Intergenic
1157723670 18:49945743-49945765 GAGGGGAGGAGGGGAGGAGGAGG + Intronic
1158446272 18:57524677-57524699 GAGGAGAGGAGTGGAGGAGGAGG + Intergenic
1158525500 18:58209337-58209359 GAGGAGGAGGGGGCAGGAGGAGG - Intronic
1158610393 18:58935179-58935201 GAGGAGGAGAGGGGAGGAGGAGG - Intronic
1160234112 18:77072150-77072172 CAGGAGGGGAGGGGAGGCGGAGG - Intronic
1160295019 18:77630005-77630027 GAGGAAAGGAGGGAAGGAGGGGG - Intergenic
1160403693 18:78629689-78629711 GGGGAGATGGGAGGAGGCGGAGG + Intergenic
1160462190 18:79047649-79047671 GAGAAGATGAGGACTGGAGGAGG + Intergenic
1160521886 18:79512568-79512590 GAGGAGATGCCTGCAGTCGGCGG + Intronic
1160695979 19:484743-484765 GAGGAGGGGAGAGCAGGAGGAGG + Intergenic
1160722557 19:603962-603984 GAGGAGGTGAGGTGGGGCGGGGG + Exonic
1160819775 19:1052514-1052536 GAGGAGAAGGGGGGAGGAGGAGG + Intronic
1160975506 19:1790479-1790501 GGGAAGGTGAGGGCAGGGGGAGG - Intronic
1161059402 19:2207524-2207546 GAGGGGCTGTGGGCAGGCGCAGG + Intronic
1161101683 19:2424736-2424758 CAGAAGGGGAGGGCAGGCGGGGG + Intronic
1161249172 19:3271164-3271186 GAGGAGGTGAGGGCCAACGGAGG + Intronic
1161328140 19:3673121-3673143 GAGGAGCAGAGGGCAGGGAGGGG - Intronic
1161331983 19:3692820-3692842 GAGGAGGGGAGGGCAGGGAGGGG - Intronic
1161358623 19:3833816-3833838 GAGGAGAGCAGCTCAGGCGGTGG + Intronic
1161422010 19:4181142-4181164 GAGGAGAAGAGGGCAGGGAGGGG - Intronic
1161490380 19:4557942-4557964 GAGGAGGCGAGGGCAGGGAGGGG - Intronic
1161500814 19:4614436-4614458 ATGGAGATGAGGACAGGGGGTGG + Intergenic
1161501027 19:4615800-4615822 GAGGAGGGGAGGGCAGGAAGGGG - Intergenic
1161505786 19:4642742-4642764 GAGGAGGGGAGGGCAGGGAGGGG + Intronic
1161591478 19:5131162-5131184 GAGGGGAAGTGAGCAGGCGGGGG - Exonic
1161606031 19:5215463-5215485 GAGGTGATGAGGGTGGGAGGCGG + Intronic
1161631097 19:5355952-5355974 GAGGAGAGGAGGGGAGGAAGGGG - Intergenic
1161649870 19:5477918-5477940 GAGGAGGAGAGGGCAGGGAGGGG - Intergenic
1161650374 19:5480579-5480601 GAGGAGGAGAGGGCAGGGAGGGG + Intergenic
1161745564 19:6057633-6057655 GAGGAGCTGATGGCCGGAGGAGG - Intronic
1162006036 19:7779995-7780017 AAGGAGATGGGGGCGGGGGGTGG - Intergenic
1162176810 19:8836456-8836478 GAGGAGAGGGGGGGAGGAGGAGG - Intronic
1162327404 19:10007273-10007295 GAGGAGATCAGGATAGGCAGTGG - Intronic
1162983826 19:14256517-14256539 GAGGAGGGGAGGGGAGGCGAGGG - Intergenic
1163019370 19:14474345-14474367 GAGGAGAGGAGGGCAGAGTGAGG + Intronic
1163061202 19:14763624-14763646 GAGGAGAGGAGGAGAGGAGGAGG - Intronic
1163118020 19:15200038-15200060 GAGGAGAGGAGGAGGGGCGGGGG + Intronic
1163533862 19:17866064-17866086 GTGGAGATGAGGGTATGCAGTGG - Intergenic
1164156960 19:22602881-22602903 GAGGAGATGAAGGCAGGGCGTGG + Intergenic
1164249659 19:23465883-23465905 GAAGAGATGAGGAGAGGAGGAGG - Intergenic
1164249728 19:23466283-23466305 GAGGAGATGAGGAGAGGATGGGG - Intergenic
1164302414 19:23973486-23973508 GAGGAGAGGAGGAGAGGAGGAGG + Intergenic
1164542007 19:29128389-29128411 GAGGACATGAGGACATGCAGGGG + Intergenic
1164542030 19:29128506-29128528 GAGGACATGAGGACATGTGGGGG + Intergenic
1164542110 19:29128902-29128924 GATGACATGAGGGCACGTGGCGG + Intergenic
1164595651 19:29529362-29529384 GAGGTGAGGAGGGCCGGCTGGGG + Intronic
1164756115 19:30691067-30691089 GAGGAGTTAAGGGCTGGAGGTGG + Intronic
1164885949 19:31778736-31778758 GGGGAAATGAGGGCAGGACGGGG + Intergenic
1165149683 19:33753506-33753528 GAGGAGATGGGGGATGGTGGAGG - Intronic
1165149871 19:33753992-33754014 GAGGAGATGGGGGATGGTGGGGG - Intronic
1165384073 19:35500259-35500281 GAGGTCTTGAGGGCAGGAGGAGG - Intronic
1165778972 19:38421087-38421109 GAGGATATGAGGTCAGCAGGCGG + Exonic
1165881426 19:39046722-39046744 GAGGTGATGGGGGCAGACTGTGG + Intergenic
1165911345 19:39230110-39230132 GAGGAGAGGAGAGGAGGGGGAGG + Intergenic
1165945520 19:39439566-39439588 GATGGGATGAGGGGTGGCGGGGG + Intronic
1166198125 19:41219732-41219754 GAGAAGCTGAGGGCAGGGGTGGG + Intronic
1166781948 19:45347611-45347633 GGGGAGGTGAGGGCAGGGTGAGG + Intronic
1166886114 19:45961961-45961983 GAGGAGATGAGGACAGAGAGGGG + Intronic
1166985684 19:46659182-46659204 GAGGAGGCGGTGGCAGGCGGGGG - Intronic
1167174808 19:47858548-47858570 GAGGAGATGAGGGCAGCCAGGGG + Intergenic
1167242308 19:48351585-48351607 GAGGAGGTGAGGGCAGAGGGAGG - Intronic
1167472320 19:49682142-49682164 GAGGTGATGGGGGCAGGGGATGG + Intronic
1167601970 19:50459673-50459695 GAGGAGATGAGGAGGGGAGGGGG + Intronic
1167659920 19:50790540-50790562 GGGGAGCTAAGGGCAGGCCGGGG - Intronic
1167700125 19:51038457-51038479 GAGGAGAGGAAAGCAGGAGGAGG - Intergenic
1167876178 19:52414454-52414476 AAGGAGATGGTGGCAGGGGGAGG + Intronic
1167886208 19:52502052-52502074 GAGGAACTGAGGGCAGGCATGGG - Intronic
1167891503 19:52543491-52543513 GAGGAACTGAGGGCAGGCATGGG - Intronic
1167912525 19:52715690-52715712 GAGGAACTGAGGGCAGGCATGGG + Intronic
1167915958 19:52740202-52740224 GAGGAACTGAGGGCAGGCATGGG + Intergenic
1167922230 19:52791355-52791377 GAGGAACTGAGGGCAGGCATGGG + Intronic
1167927496 19:52833405-52833427 GAGGAACTGAGGGCAGGCATGGG + Intronic
1168172355 19:54597036-54597058 GAGGAGATGAGAGTAGACTGAGG + Intronic
1168296700 19:55380405-55380427 GAGGAGAGGAGGGGAGGGGAGGG - Intronic
1168525788 19:57087825-57087847 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
1202671990 1_KI270709v1_random:63735-63757 GAGGAAATGAGGGAAGGAAGGGG + Intergenic
925376284 2:3388354-3388376 GAGGGGAGGCGGGCTGGCGGGGG - Exonic
925450863 2:3968304-3968326 GAGGAGAGGAGGGAAGGGGAGGG + Intergenic
925462539 2:4075799-4075821 AAGGAGATGAGAGGAGGAGGAGG - Intergenic
925686873 2:6481992-6482014 GAGGAGCTGTGGGCAGTGGGAGG - Intergenic
926212779 2:10883475-10883497 GAGGAGATGACAGCAGCAGGTGG + Intergenic
926230834 2:11002676-11002698 GAGGAGAGGAGGGAAGGGGCTGG + Intergenic
926623221 2:15067377-15067399 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
927088092 2:19690269-19690291 GAGGAAAGGAGGGGAGGGGGAGG + Intergenic
927168724 2:20350826-20350848 GGGGAGGGGAGGGCAGGCGGCGG - Intronic
927507071 2:23621539-23621561 GAGGAGATGAGGGGGAGGGGAGG + Intronic
927692005 2:25215230-25215252 CTGGGGAGGAGGGCAGGCGGTGG - Intergenic
927696737 2:25244461-25244483 AGGGAGAGGAGGGGAGGCGGTGG + Intronic
927841629 2:26448798-26448820 GAGTCGGTGAGGCCAGGCGGGGG + Exonic
927927876 2:27025808-27025830 GACGAGAGGAGGGCAGGCAGGGG + Intronic
927929378 2:27034317-27034339 GAGAAGATGAGAGGAGGGGGAGG + Intronic
928206900 2:29290891-29290913 GAGGAGAGGCAGGCAGGCAGGGG + Intronic
928264759 2:29802326-29802348 GAGGAGGGGAGGGCAGGGGAGGG + Intronic
928264847 2:29802501-29802523 GAGGAGAGGAGGGGAGGGGAGGG + Intronic
928393573 2:30927474-30927496 GAGGAGATGAATCCAGGCAGTGG + Intronic
928677982 2:33668900-33668922 AAAGAGATGAGGGCTGGGGGCGG + Intergenic
928997947 2:37315805-37315827 GTGGGGAGCAGGGCAGGCGGCGG - Intronic
929000668 2:37344643-37344665 GTGGAGAAGAGGGAAGGCGAAGG + Exonic
929537410 2:42792413-42792435 GAGGAGGCGAGGGCAGGGGGCGG + Intronic
929665597 2:43831699-43831721 GAAGAGAGGAGGGCAGCGGGGGG + Intronic
930126198 2:47799116-47799138 GAAGAGATGAGCACAGGAGGAGG + Exonic
930730450 2:54723694-54723716 GGGGAGGGGAGGGCAGGCAGAGG + Intronic
931250792 2:60529126-60529148 GAGAAGAGCAGGGCAGGTGGGGG - Intronic
931348822 2:61470805-61470827 GAGGCGACTAGGGCGGGCGGCGG + Intergenic
931867276 2:66426302-66426324 GAGGAGATGAGCGCACCCCGGGG + Intergenic
932137699 2:69245306-69245328 GTGTAGATGGGGGCAGGAGGCGG - Exonic
932435508 2:71700668-71700690 GAGGCGGTGGGGGGAGGCGGGGG + Intergenic
932457434 2:71858375-71858397 GAGGAAATGAGAGCAGGGGTTGG + Intergenic
932705163 2:74019073-74019095 GTAGAGATGAGGGTTGGCGGGGG - Intronic
933227877 2:79771994-79772016 GAGGAGGGGAGGGGAGGAGGGGG - Intronic
933804603 2:85989021-85989043 GAGGGGATCAGGGCAGCCAGTGG - Intergenic
934117424 2:88810681-88810703 GAGGGGGTGAGTGCAGGTGGAGG + Intergenic
934477562 2:94603525-94603547 GAGGGGTGGAGGGCAGGGGGAGG - Intronic
934855375 2:97725951-97725973 GAGGAGGTGAGGGCAGGGCGGGG + Intronic
935564275 2:104589972-104589994 GAGGACATCAGTGCAGGCTGGGG + Intergenic
936090344 2:109498136-109498158 GAAGGAAGGAGGGCAGGCGGAGG - Intronic
936100232 2:109571084-109571106 GAGGAGGAGAGTGCAGGGGGAGG - Intronic
936524227 2:113232113-113232135 GAGGACATGACGGGGGGCGGTGG - Intronic
937273481 2:120670001-120670023 GAGGAGATGTGGGAGGGGGGAGG - Intergenic
937419418 2:121741678-121741700 GAGGTGATGAGGTCATGAGGTGG - Intronic
937463605 2:122110405-122110427 GAGGATGTGAAGGCAGGTGGAGG + Intergenic
937870616 2:126783331-126783353 GAGGGGCTCAGGGCAGGTGGTGG + Intergenic
938243512 2:129760783-129760805 GAGGGGCTGATGGCGGGCGGGGG - Intergenic
938422691 2:131156937-131156959 GAGGTGAGGAGGGCAGGCTCTGG - Intronic
938556663 2:132430691-132430713 GCTGAGATGAGGGCAGGTGATGG + Intronic
939073182 2:137568210-137568232 GAGGAGAGGAGGGGAGGAAGTGG + Intronic
939540883 2:143492349-143492371 GAGGAGATGAGAGGAGAAGGTGG - Intronic
940079098 2:149779864-149779886 GAGGAGAGGAGGGGAGGGGAGGG - Intergenic
940636803 2:156307497-156307519 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
940640588 2:156341780-156341802 GAGGAGAAAAAGGCGGGCGGCGG + Intronic
941131794 2:161659997-161660019 GAGGGGATGAGGGTTGGAGGGGG + Intronic
942080739 2:172397287-172397309 GAGGAGGGGAGCGGAGGCGGAGG + Intergenic
942555194 2:177165776-177165798 GAGGAAATGAGGGCATGGGGTGG - Intergenic
944032810 2:195257687-195257709 GAGGAGGTGAGGCCACGTGGAGG + Intergenic
944511856 2:200473165-200473187 GAGTGGGTGAGGGCAGGTGGCGG - Intronic
945446022 2:209939585-209939607 GAGGGAATGAGGGCAGGCGGAGG - Exonic
945869714 2:215213955-215213977 GAGGAGAGGAGGAGAGGAGGGGG + Intergenic
946307599 2:218865090-218865112 GATGAGAACAGGGCAGGAGGGGG - Intronic
946395357 2:219441589-219441611 GAGGAGGTGAGGGTGGGAGGAGG + Intronic
946621663 2:221569977-221569999 GAGGAGAGGAGGGAAGGGGGCGG - Intronic
946640675 2:221780515-221780537 GAAGATATGAGAGCAGGAGGAGG - Intergenic
946708787 2:222485701-222485723 GGGAAGATGAAGGCAGGCAGAGG - Intronic
946809786 2:223511387-223511409 GAAGAGATGAGGGCTGGCCAGGG + Intergenic
947817130 2:233045134-233045156 GAGGAGATGAGGGAAGGGCAGGG - Intergenic
948029053 2:234801415-234801437 GAGGAGAAGGGAGCAGGAGGGGG - Intergenic
948207508 2:236170001-236170023 GAGGAGGAGAGGGCTGGCGGCGG - Intergenic
948600714 2:239106169-239106191 GAGGAGCCGAGGGCGGGCGGAGG + Intronic
948600721 2:239106188-239106210 GAGGAGCTGAGGGCGGGCGGAGG + Intronic
948642302 2:239383429-239383451 GATGACATGTGGGCAGGCAGGGG + Intronic
948698418 2:239745690-239745712 GAGGAGATGTGGGCGTGGGGAGG + Intergenic
948856284 2:240732045-240732067 GAGGGGATGAGGGATGGGGGAGG + Intronic
948862641 2:240760344-240760366 GTGGAGGGGAGGGCAGGCTGTGG - Intronic
1168861577 20:1049451-1049473 GAGGAGATTAGGACAGGCCTGGG - Intergenic
1169213415 20:3779825-3779847 GAGGAGGTGAGAGAAGGTGGGGG + Intronic
1169308697 20:4517201-4517223 CAGGAGGTGGGGGCAGGTGGTGG - Intergenic
1169316132 20:4592508-4592530 TAGGCTATGAGGGCAGGGGGTGG + Intergenic
1169685007 20:8261353-8261375 GAAGAGATAAGGGGAGGCAGAGG - Intronic
1170262258 20:14423374-14423396 TGGGGGATGGGGGCAGGCGGTGG + Intronic
1170792846 20:19521853-19521875 GAGGAGATGGGGGCTGGGGAAGG - Intronic
1170876363 20:20253972-20253994 GAGGAGAGGAGGGGAGGGGAGGG - Intronic
1170876443 20:20254169-20254191 GAGGAGAGGAGGGGAGGGGAGGG - Intronic
1170880976 20:20296267-20296289 GAAGGGATGAGGGAAGGGGGAGG - Intronic
1171053736 20:21885732-21885754 GAGGAGAGGAGGTCAGACAGTGG + Intergenic
1171200011 20:23233208-23233230 TAGGAAGTGAGGGCAGGCTGGGG + Intergenic
1171853400 20:30324131-30324153 AATGAGAAGAGGGCAGGGGGTGG + Intergenic
1171878256 20:30598148-30598170 GAGGGGAGGAGGGCAGGAGGAGG - Intergenic
1172119250 20:32588162-32588184 GAGGAGAGGAGGGCAGCTGCAGG + Intronic
1172184613 20:33023585-33023607 GGGGAGATGAGGGAAGAGGGAGG - Exonic
1172899632 20:38325027-38325049 GAGTAGATGCTGGCAGGAGGTGG + Intronic
1173410342 20:42804201-42804223 GAGAGGATGGGGGCAGGTGGAGG - Intronic
1173513692 20:43650010-43650032 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
1173744631 20:45426856-45426878 CAGAAGATGAGGGCAGTGGGAGG - Intergenic
1173855909 20:46250847-46250869 AAGGAGAGGAGGGCATGGGGCGG + Intronic
1174158840 20:48535878-48535900 GAGTAGAAGAGAGCAGGCAGTGG - Intergenic
1174216646 20:48921396-48921418 GAGGAGATGAGGAAAGGAAGGGG - Intergenic
1174648331 20:52104534-52104556 GAGGTGATGGGGGCAGACGGTGG - Intronic
1175119537 20:56707553-56707575 GAGAGGAGGACGGCAGGCGGGGG + Intergenic
1175264620 20:57695212-57695234 CAGGTGAGGCGGGCAGGCGGTGG + Intronic
1175272757 20:57746453-57746475 AAGGAGATGCGGGCAGGGGGAGG + Intergenic
1175289430 20:57865214-57865236 GAGGAGAGGAGGGGAGGGGAGGG - Intergenic
1175503609 20:59467093-59467115 GAGGAAATTGAGGCAGGCGGAGG + Intergenic
1175569751 20:60009944-60009966 GGGGAGCTGGGGGCAGGGGGAGG - Intronic
1175914957 20:62422026-62422048 GAAGAGATGGGGGGAGGCAGGGG - Intronic
1176142334 20:63550210-63550232 GAGGAGGTGAGGTCATGTGGGGG - Intronic
1176167037 20:63679763-63679785 GAGGAGAAGAAGGCAGGCTCGGG - Intronic
1176179120 20:63741344-63741366 GAGGAGATGGGGGCGGGGTGCGG - Intronic
1176184442 20:63770730-63770752 GAGGAGAACTGGGCAGGCGGTGG + Intronic
1176277142 20:64278893-64278915 AAGGAGGTGAGGGCAGGCCGTGG - Intronic
1176521197 21:7825787-7825809 GGGGAGAAGAGGGCAGTGGGTGG + Exonic
1177047054 21:16183831-16183853 GGGGAGAGGAGGGCAGGGGGTGG - Intergenic
1178337711 21:31758627-31758649 GAGGTGATGGGGGCTGGTGGGGG - Intergenic
1178407579 21:32337217-32337239 GAGGGTATGAGGGCAGGTGGTGG - Intronic
1178636543 21:34308692-34308714 CACGAGATGAGGGCAGTGGGGGG - Intergenic
1178655217 21:34455799-34455821 GGGGAGAAGAGGGCAGTGGGTGG + Intergenic
1178824558 21:36004820-36004842 GAGGAGGCGGGGGGAGGCGGGGG + Intergenic
1178824572 21:36004844-36004866 GAGGAGGCGGGGGGAGGCGGGGG + Intergenic
1178839949 21:36130289-36130311 GAGGAGGAGATGGCAGCCGGGGG - Intergenic
1179185106 21:39079614-39079636 GAGGAAATGGAGGCAGGCAGAGG + Intergenic
1179267389 21:39816427-39816449 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
1179492993 21:41753538-41753560 GGGAAGATGAGGAAAGGCGGAGG - Intronic
1179767129 21:43582328-43582350 CGGGAGATGAGGGCCGGCTGAGG + Intronic
1179767160 21:43582448-43582470 AGGGAGATGAGGGCCGGCTGAGG + Intronic
1179887174 21:44319123-44319145 GAGGTGAGGAGGGCAGCTGGGGG + Intronic
1179903535 21:44407212-44407234 GAGGACTTGAGCGCAGGAGGTGG - Intronic
1180079682 21:45480963-45480985 GAGGAGATGAGGTGAGGAGGCGG - Intronic
1180093818 21:45545374-45545396 GAGGAGGGGAGGGCAAGGGGGGG - Intergenic
1180156099 21:45977971-45977993 GGGGAGATGAGGAAAGGGGGAGG + Intergenic
1180230381 21:46423735-46423757 GAGGGGAAGAGGGGAGGAGGAGG + Intronic
1180875878 22:19175107-19175129 GAGGAGATGGGGGCACGTTGAGG - Intergenic
1180955220 22:19738437-19738459 GAGGAGATAAGGAGAGGTGGAGG + Intergenic
1181084251 22:20432024-20432046 GAGCAGATGGGGGCTGGGGGAGG - Intronic
1181112145 22:20608486-20608508 GAGTGGATGAGGGCAGGAGAAGG + Intergenic
1181387685 22:22557821-22557843 GAGGAGAAGGGAGCAGGAGGAGG + Intronic
1181459306 22:23076845-23076867 GAGGAGCTCAGGGCAGGGGAAGG + Intronic
1181494429 22:23280055-23280077 GTGTAGATGAGGTCATGCGGTGG - Intronic
1181690233 22:24555114-24555136 GAGGAGAGAACGGGAGGCGGCGG + Intronic
1181966048 22:26657407-26657429 GTGGAGGTGAGGGCCGGGGGTGG + Intergenic
1182045184 22:27268621-27268643 CAGGAGATGAGGCCATGAGGTGG - Intergenic
1182357920 22:29730569-29730591 GAGGACAGGAGGGCAGGCCCTGG - Exonic
1182477304 22:30583171-30583193 GAGGAGAGGAGGGCTGGGGAAGG + Intronic
1182876945 22:33700486-33700508 GATGACATGAGGGCTGGCGGGGG + Intronic
1183032674 22:35117473-35117495 GGGGTGCTGAGGGCAGGCAGAGG - Intergenic
1183180663 22:36257733-36257755 GAGGAGAGGAGGGCTGGGAGAGG + Intronic
1183315063 22:37132476-37132498 GAGGAGAGGAGGGAAGGAGGAGG + Intronic
1183404466 22:37623678-37623700 GGGGAGGTGGGGGCAGGAGGTGG - Intronic
1183601750 22:38844047-38844069 GAGGAGAAGACGGCAGGCGGCGG + Intergenic
1183792140 22:40080677-40080699 GAGGATAAGAGGGCAGGCAAGGG - Intronic
1184133773 22:42533921-42533943 GAGCGGATGAGGGTAGGTGGGGG - Intergenic
1184545446 22:45164291-45164313 GAGGAGGTGAGGAGCGGCGGCGG + Exonic
1184593983 22:45503231-45503253 GAGGAGATGAGGACCGGAGCTGG - Intronic
1184604457 22:45564191-45564213 GAGGAGATGGAGGGAGGCAGGGG - Intronic
1184726724 22:46351523-46351545 GAGGAGAGGAGGACGGGCGGTGG - Intronic
1184728857 22:46362230-46362252 GAGGCGGTGAGGGGAGGGGGTGG + Exonic
1185091720 22:48779311-48779333 GAGGCGAGAAGGGAAGGCGGTGG - Intronic
1185336795 22:50274623-50274645 GAGGTGCTGAGGGGAGGTGGGGG - Intergenic
1185366940 22:50441111-50441133 GAGGAGGTGAGGCCAGGCCAGGG + Intronic
1185388153 22:50545968-50545990 GAGGAGAAGAGGGCAGGAGCTGG + Intergenic
1185399336 22:50607856-50607878 GAGGGGAGGAGGGGAGGAGGAGG + Intronic
949417553 3:3830606-3830628 GAGGCCATCAGGGCAGGCTGGGG + Intronic
949568735 3:5270755-5270777 CAGGAAATGAGGGCAGCCGCTGG - Intergenic
949642953 3:6060273-6060295 GAGAAGACAAGGGCAGGCAGTGG - Intergenic
949943667 3:9173685-9173707 GAGGAGAGGTGGGCAGGGGTGGG - Intronic
950268055 3:11589846-11589868 GAGGTCATGAGGGCAGGCTCTGG - Intronic
950390943 3:12696445-12696467 GAGAAGGTGAGGGTAGGCAGAGG - Intergenic
950489783 3:13296867-13296889 TTGGAGATGAGAGCATGCGGGGG - Intergenic
951170711 3:19539016-19539038 AAGGAGATGAGGGGAGGAGGGGG - Intergenic
952196949 3:31085700-31085722 GAGCAGAAGAGGGCAGCCAGTGG + Intergenic
952344484 3:32471055-32471077 GAGGAGAGGAGGAGAGGAGGGGG + Intronic
953406770 3:42663648-42663670 GGGGACATGAGGGCAAGCCGAGG - Intronic
953502109 3:43446908-43446930 GGGAAGATGAGGGCAGGGGTAGG - Intronic
953996266 3:47522426-47522448 GATGAGCTAAGGGCAGGCTGGGG - Intergenic
954216023 3:49124981-49125003 GAGTGGATGGGGGCAGGCGTGGG - Intronic
954247005 3:49340008-49340030 GAGGAGATGGCGGAAGGTGGAGG - Exonic
954462162 3:50633570-50633592 GGGGAGATGAGAGGAGGGGGTGG - Intronic
954464317 3:50645799-50645821 CAGGAGATGGAGGCAGGGGGTGG - Intronic
954653794 3:52181699-52181721 GAGCAGGTGAGTGCAGGCTGAGG - Intergenic
955006095 3:54970438-54970460 GAGGAGAGGAGGGGAGGGGAGGG - Intronic
955006147 3:54970574-54970596 GAGGAGAGGAGGGGAGGGGAAGG - Intronic
956703865 3:71982607-71982629 GAGGCCATCAGGGCAGGCTGGGG + Intergenic
959784416 3:110276660-110276682 GGGGAGATGAGGGGAGGGGAAGG - Intergenic
960438615 3:117658833-117658855 AAGGAGATGAGGGAAGGAGAGGG - Intergenic
960891073 3:122448592-122448614 GTGGAGTTGGGGGCAGGGGGAGG + Intronic
961260054 3:125595204-125595226 GAGGAGACGAGGGAGCGCGGCGG - Intergenic
961578227 3:127855974-127855996 GAGGTCATGTGGGCAGGAGGTGG - Intergenic
961660250 3:128464856-128464878 GAGGAAATGAAGGAAGGAGGGGG - Intronic
961798113 3:129424431-129424453 GAGGAAGTGAGAGCAGGGGGAGG - Intronic
962154762 3:132934558-132934580 GAGGAGCTAAGGGCTGGCTGTGG - Intergenic
962235291 3:133701708-133701730 GAGGAGCTGAGGTCAGGAGCAGG + Intergenic
962444570 3:135453112-135453134 GAGGTGAAGAGGGCGGGAGGAGG - Intergenic
962478445 3:135778132-135778154 TAGGAGATGGGGGCAGCCGGAGG + Intergenic
962745577 3:138395421-138395443 GAGGAGGTGGGGGCAGATGGTGG - Intronic
963590174 3:147247471-147247493 AAGGTGGTGTGGGCAGGCGGAGG - Intergenic
963721383 3:148865876-148865898 GAGGAGATGAGGGTCGGAGTGGG - Intronic
964420268 3:156495017-156495039 GAGGAGTTGAGGGTAGGAGGAGG - Intronic
964767583 3:160193583-160193605 GATGAGATGGGGGCTGGTGGGGG + Intergenic
965106570 3:164363061-164363083 GTGGAGTGGAGGGCAGACGGTGG + Intergenic
965491964 3:169348873-169348895 TATGACATGAGGGCAGGGGGAGG - Intronic
965705158 3:171499287-171499309 GAGAAGATGTGGGCAGGAGAAGG - Intergenic
965874590 3:173300740-173300762 GTGGAGATGAGGACAGTCAGAGG + Intergenic
965939473 3:174160912-174160934 GAGGGGTTGAGGGCAGGAGGTGG - Intronic
967262069 3:187652229-187652251 GTGGAGTTGAGGGCGGGGGGTGG - Intergenic
967493955 3:190122112-190122134 GAGGAGAGGAGGGGAGGGGAGGG + Intronic
967527817 3:190514541-190514563 GAGGAGATGGGGGCGGGGGGTGG - Intronic
968310663 3:197680995-197681017 GAGGAGACGAGGGGAGGGGATGG + Intronic
968310699 3:197681071-197681093 GAGGGGATGAGGGGAGGAGAAGG + Intronic
968583018 4:1403626-1403648 GAGGAGGCGCGGGGAGGCGGCGG - Exonic
968599927 4:1503975-1503997 AATCAGATGAGGGCAGGCCGTGG - Intergenic
968945005 4:3658958-3658980 AAGGAGAGGAGGGAAGGCTGGGG - Intergenic
968949125 4:3681348-3681370 GAGGCGTTGTGTGCAGGCGGAGG + Intergenic
968952034 4:3700281-3700303 GAGGGGAGGAGGGGAGGGGGAGG + Intergenic
969371496 4:6734132-6734154 GAGGGGATGAGGGGAGGAGGTGG + Intergenic
969394572 4:6911663-6911685 GAGTAGAGGAGGGAAGGTGGAGG - Intronic
969472714 4:7399014-7399036 GAGGAGCTGAGGGCAGGAAGGGG + Intronic
969705274 4:8788325-8788347 CAGGAGATGAGAGCAGGGAGGGG + Intergenic
969713243 4:8856468-8856490 GAGGAGAAGAGGCCGGGCAGGGG + Intronic
970540155 4:17069818-17069840 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
971514344 4:27467917-27467939 GAGGAGATGAGGAGGGGAGGAGG - Intergenic
971618798 4:28828278-28828300 GAGGAGCCGCGGGGAGGCGGGGG - Intergenic
973666345 4:53163432-53163454 GAGGAGAAGAGGCCAGGCGCAGG + Intronic
973836907 4:54819017-54819039 GAGGAGAAGAGGGGAGGGAGGGG - Intergenic
973869403 4:55149846-55149868 GAGGAGGTTAGGGGAGGAGGTGG + Intergenic
974473912 4:62355231-62355253 GAGGAGAGGAGGGGAGGGGAGGG - Intergenic
975073737 4:70178351-70178373 GAGGAGAGGAGGGGAGGGGAGGG - Intergenic
975281713 4:72569279-72569301 GAGGAGGAGAAGGCAGGCGGAGG + Intergenic
975756987 4:77580773-77580795 GGGGAGAGGAGGGCAGGAGAGGG - Intronic
975828105 4:78340823-78340845 GAGAAGATTAGGACATGCGGAGG - Intronic
976068393 4:81215247-81215269 GAAGAGAGGAGGGAAGGAGGAGG + Intergenic
976177859 4:82373180-82373202 GAGGAAAGGAGGGCGGGCCGAGG + Intronic
976258624 4:83124824-83124846 GAGGAGAGGAGGGCAGGGGAGGG + Intronic
976512533 4:85928308-85928330 GAGGAAAGGAGGGAAGGAGGAGG - Intronic
976772011 4:88663388-88663410 GAGGAGATGAGGGCTTGCTGGGG + Intronic
978030860 4:103938790-103938812 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
978277724 4:106972192-106972214 GAGGAGAAGTGGTGAGGCGGGGG - Intronic
978431779 4:108640350-108640372 GAGGAGAGCAGGGAAGGTGGTGG - Intergenic
978557453 4:109996510-109996532 GAGGTCATCAGGGCAGGAGGAGG - Intronic
978739274 4:112119100-112119122 GAGGAGAGGAGGGGAGGAGAGGG + Intergenic
978885437 4:113761816-113761838 GAGGGGGTGCTGGCAGGCGGAGG - Intronic
980130347 4:128811546-128811568 GTGGAAATGGGGGCGGGCGGCGG + Intronic
981173895 4:141658177-141658199 GAGGAAAAGAGAGCAGGGGGAGG - Intronic
981403663 4:144342180-144342202 GAGGAGATGAGGGCACTTAGTGG + Intergenic
982027700 4:151267875-151267897 GAGGAGATGAGTGCAGTCCAGGG + Intronic
982114151 4:152083175-152083197 GAGGAGAGGAGAGGAGGGGGAGG + Intergenic
982283979 4:153715442-153715464 GAGGAGATGGGGACAGGAGGAGG + Intronic
983026710 4:162746806-162746828 GGGGAGGAGAGGGGAGGCGGTGG + Intergenic
983191235 4:164755533-164755555 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
983503129 4:168523224-168523246 GAGGAGAGGAGGGGAGGGGAGGG + Intronic
984257834 4:177408726-177408748 GAGGACAGGAGGGCAGGAGAAGG - Intergenic
984375103 4:178920639-178920661 GAGGAGAGGAGGGGAGGAGAGGG - Intergenic
984628951 4:182040011-182040033 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
984628982 4:182040086-182040108 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
984629022 4:182040186-182040208 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
984629033 4:182040211-182040233 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
984717271 4:182937496-182937518 CAGGACACGAGGGCAGGAGGTGG - Intergenic
984741888 4:183173041-183173063 GAGGAGAGGAGGGGAGGAGAGGG - Intronic
984795847 4:183659372-183659394 GAGAAGACGAGGGGAGGCGGGGG - Exonic
985211879 4:187604112-187604134 GAGGAGAGGAGGGGAGGAGAGGG - Intergenic
985539016 5:479221-479243 GGGGAGGTCAGGGCAGGCCGGGG + Intronic
985733404 5:1564053-1564075 GAGGTGAGGAGGACAGGGGGAGG - Intergenic
985809767 5:2074473-2074495 AGGGAAATGAGGGCAGGCTGGGG - Intergenic
985835672 5:2270221-2270243 CAGCAGGTGAGGGCAGGCAGAGG + Intergenic
985894245 5:2739551-2739573 GAGGAGAGGAAGGCTGGCTGTGG + Intergenic
985937217 5:3106499-3106521 GAGGAGATGAGGGGAGCGGAGGG - Intergenic
986494893 5:8332072-8332094 GGGGAGAAGAGAGCAGGCGTGGG - Intergenic
986726225 5:10599482-10599504 GAGGGGAAGAGGGTAGGAGGAGG - Intronic
986901017 5:12433617-12433639 GAGGAGAGGAGAGGAGGAGGGGG - Intergenic
987032865 5:13991526-13991548 GAGGAGGGGAGGGGAGGGGGAGG + Intergenic
987035129 5:14011731-14011753 GAGCAGACGAGGGCAGGGCGCGG - Intergenic
987067183 5:14301481-14301503 TAGGAGATGAGGACAGAAGGTGG - Intronic
988589188 5:32534305-32534327 GAGGAGATGATGGAAGCCAGAGG - Intronic
988589719 5:32538262-32538284 GAGGAAGTGGGGGCAGGCAGAGG + Intronic
989043078 5:37249156-37249178 GAGTAGATGAGGGGAGACCGAGG + Intronic
989224217 5:39006770-39006792 GAGGAGAGGAGGGGAGGGGAGGG + Intronic
989592150 5:43121593-43121615 GGGGAGAAGAGGGAGGGCGGGGG + Exonic
991573294 5:68077683-68077705 GAGGAGATGAGTCCAGAGGGAGG + Intergenic
992423923 5:76635857-76635879 GGGGAGAGGAGGGTAGGGGGAGG + Intronic
992562138 5:77963410-77963432 GAGCAGATGATGGCAGGCATTGG - Intergenic
995040915 5:107587237-107587259 GAGGAGACAAGGACAGGAGGGGG - Intronic
995428383 5:112049002-112049024 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
995907483 5:117142940-117142962 GATGAGATTATGGGAGGCGGAGG - Intergenic
996075223 5:119185122-119185144 GGAGAGATGGGGGCAGGTGGAGG - Intronic
996164926 5:120212236-120212258 GAGGATATCAGTGCAGGCTGGGG + Intergenic
996343193 5:122460859-122460881 GTGAAGATGGGGGCAGGAGGAGG - Intronic
996457247 5:123698959-123698981 AGGGAGGTGAGGGCAGGGGGAGG - Intergenic
996531606 5:124533348-124533370 GATGAGATGAGGGCAGGGATTGG - Intergenic
996929783 5:128871930-128871952 GAGGAGGAGAGGGCAGGGGAGGG - Intronic
997437461 5:133885542-133885564 GAGGAGCTGGGGGGAGGCGAGGG + Intergenic
998003248 5:138640726-138640748 GTGGAGGTGAGGGGAGGAGGGGG + Intronic
998005098 5:138651519-138651541 GTGGGGGTGGGGGCAGGCGGTGG - Intronic
998071269 5:139199678-139199700 GGGGATCTGAGGGCAGGAGGGGG - Intronic
999467591 5:151822401-151822423 GAGGGGGTAAGGGCAGGGGGTGG - Intergenic
999743848 5:154576788-154576810 AAGGAGATCAAGGCAGCCGGGGG - Intergenic
1000093665 5:157951938-157951960 GAGGAGAGGAGGGGAGGGGAGGG - Intergenic
1000193751 5:158938337-158938359 GAGCAGAGGAGGGGAGGAGGGGG - Intronic
1000828042 5:166070535-166070557 GAGGAGGTGAGGGTAGATGGGGG - Intergenic
1001076010 5:168628682-168628704 GAGGGAAGGAGGGCAGGAGGAGG - Intergenic
1001132915 5:169079574-169079596 GAGGAGAGAAGGGGAGGAGGAGG + Intronic
1001434419 5:171688223-171688245 GAGGAAATGAGAGCATGCGTGGG - Intergenic
1001622183 5:173096491-173096513 GGGGAGAGGAGGGCAGGGGAGGG - Intronic
1001901158 5:175431045-175431067 GAGGAGAGGAGAGCTGGCGGAGG - Intergenic
1002121325 5:177006619-177006641 GCGGAGCTGTGCGCAGGCGGCGG + Intronic
1002320889 5:178375260-178375282 GGGGAGAGGAGGGGAGGTGGGGG + Intronic
1002697080 5:181098536-181098558 GGGGAGGGGAGGGCAGGCGAGGG + Intergenic
1002697098 5:181098571-181098593 GGGGAGGGGAGGGCAGGCGAGGG + Intergenic
1002697133 5:181098636-181098658 GGGGAGGGGAGGGCAGGCGAGGG + Intergenic
1002697173 5:181098711-181098733 GGGGAGGGGAGGGCAGGCGAGGG + Intergenic
1002697182 5:181098731-181098753 GGGGAGGGGAGGGCAGGCGAGGG + Intergenic
1002888929 6:1317290-1317312 GAGGAGAGAGGAGCAGGCGGGGG - Intergenic
1003020495 6:2505079-2505101 GAGGAGATGAGGAGAGGATGAGG - Intergenic
1003235923 6:4295097-4295119 GAGGGCATGAGGGCAAGGGGAGG - Intergenic
1003411016 6:5863040-5863062 GAGGAGCAGAGGGCAGGCCTGGG + Intergenic
1003519069 6:6842145-6842167 GAGGAGAGGAGAGGAGGCGAGGG + Intergenic
1003869186 6:10388361-10388383 GTGGAAATGAGGGCTGGAGGAGG + Intergenic
1003975164 6:11336075-11336097 AGGGAGGTGAGGGCAGGAGGAGG - Intronic
1005948429 6:30612836-30612858 GAGTTGATGAAGGCAGGCAGGGG + Intronic
1005976674 6:30805373-30805395 GATGAAATGAGGGCAGGAGAAGG + Intergenic
1005986757 6:30880797-30880819 AAGGAGATGAAGGGAGGCAGAGG - Intronic
1006068205 6:31477758-31477780 GGGGAGAGAAGGGCAGGTGGAGG - Intergenic
1006100085 6:31681213-31681235 GATGAGGTGAGGGAAGGCGCTGG - Intronic
1006187764 6:32190356-32190378 GAGGGGATGAGGGGAGGAGACGG + Intergenic
1006271748 6:32970873-32970895 GAGGGGAGGAGGGGAGGAGGGGG + Exonic
1006336057 6:33420927-33420949 GGGGAGACCAGGGCAGGGGGAGG + Intronic
1006340151 6:33442508-33442530 GAGGAGAGGAGGGCGGGGGAGGG - Intronic
1006429878 6:33988927-33988949 GAGGTGCTCAGGGCAGGCTGAGG - Intergenic
1006902540 6:37512484-37512506 GAGGGGATGCAGGCAGGAGGTGG - Intergenic
1006935353 6:37713477-37713499 GAGGAGATGAGAGTTGGAGGAGG - Intergenic
1007174828 6:39888594-39888616 TAGGGAATGAGGGAAGGCGGAGG + Intronic
1007231011 6:40347847-40347869 GAGGGGAGGAGGGGAGGAGGGGG - Intergenic
1007418730 6:41706800-41706822 GGGGAGATGGGGGCAGGTTGGGG - Intronic
1007428341 6:41761435-41761457 TAGGGGATGAGGGCATGAGGAGG - Intergenic
1007553298 6:42746430-42746452 GAGGAGCTGGGGGGAGGGGGAGG - Intergenic
1010004558 6:70981204-70981226 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
1010004590 6:70981304-70981326 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
1011231314 6:85165081-85165103 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
1011410293 6:87059858-87059880 GAGGGGAGGAGGGTAGGTGGGGG + Intergenic
1011632286 6:89339448-89339470 GAGGAGAGGAGGGGAGGAGAGGG + Intronic
1012357492 6:98333710-98333732 GAGGTGATGAGGCCATGAGGTGG - Intergenic
1014769452 6:125444774-125444796 GGGGAGACGGGGGCAGGAGGTGG - Intergenic
1015240249 6:131014254-131014276 GGGGAGGTGAGGGTAGGAGGTGG + Intronic
1015789333 6:136950790-136950812 GAGGAGCTCAGGGCAGGCGCAGG + Intergenic
1016428545 6:143959142-143959164 GAGGAGCTGCGAGCAGGCAGCGG - Intronic
1016657916 6:146543292-146543314 GGGGAGAGTAGGGCAGGAGGTGG + Intergenic
1016774236 6:147886808-147886830 GAGGAGCTGAGGGAAGGCTCTGG + Intergenic
1016967695 6:149734112-149734134 GAGGAAATGATGGCCGGGGGCGG - Intronic
1017637476 6:156456416-156456438 GAGGAGAGGAGGGGAGGGGAGGG - Intergenic
1017652080 6:156593143-156593165 GGGGAGAAGAGGGGAGGAGGGGG + Intergenic
1017805117 6:157939184-157939206 GAGCAGATGAGGGCAGCAAGTGG + Intronic
1018653216 6:166008430-166008452 GAGGAGATGCGCCCAAGCGGGGG + Intergenic
1018659993 6:166076959-166076981 GAGAAGCTGAGGGTATGCGGAGG - Intergenic
1018743732 6:166748655-166748677 GAGGAGATGGGGGCCTGAGGAGG - Intronic
1018743751 6:166748703-166748725 GAGGAGATGGGGGCCTGAGGAGG - Intronic
1018743809 6:166748846-166748868 GAGGAGATGGGGGCCTGAGGAGG - Intronic
1018743856 6:166748958-166748980 GAGGAGATGGGGGCCTGAGGAGG - Intronic
1018743885 6:166749022-166749044 GAGGAGATGGGGGCCTGAGGAGG - Intronic
1018743911 6:166749086-166749108 GAGGAGATGGGGGCCTGAGGAGG - Intronic
1018743987 6:166749278-166749300 GAGGAGATGGGGGCCTGAGGAGG - Intronic
1018744043 6:166749422-166749444 GAGGAGATGGGGGCCTGAGGAGG - Intronic
1018744106 6:166749582-166749604 GAGGAGATGGGGGCCTGAGGAGG - Intronic
1018744139 6:166749662-166749684 GAGGAGATGGGGGCCTGAGGAGG - Intronic
1018768532 6:166952790-166952812 GGGGAGAGGAGGGGAAGCGGAGG + Intronic
1018952657 6:168389240-168389262 CAGGTGAGGAGGGCAGGCAGAGG - Intergenic
1018996242 6:168712399-168712421 GGGGACAAGAGGGCAGGCGTGGG + Intergenic
1019188077 6:170232634-170232656 GGGGGGATGAGGGCAGGGGCTGG + Intergenic
1019223497 6:170493242-170493264 GAGGTGAGGAGGGGAGGAGGAGG + Intergenic
1019298194 7:289993-290015 GACGGGGTGGGGGCAGGCGGGGG + Intergenic
1019341471 7:510761-510783 GAGGAGAGGAGGGGAGGGGAGGG + Intronic
1019346275 7:532252-532274 CAGGGGGTGAGGCCAGGCGGGGG + Intergenic
1019437297 7:1028669-1028691 GGGGAGATGAGGGAAGTAGGGGG - Intronic
1019437369 7:1028913-1028935 GGGGAGATGGGGGCAGACTGGGG - Intronic
1019795161 7:3043585-3043607 GAAGAGAAGAGGGCACGGGGAGG - Intronic
1020667828 7:11069630-11069652 GAGGAGAGGAGGGGAGGGGAAGG - Intronic
1020875980 7:13694186-13694208 GAGGAGATGAGGGCATGGGGAGG - Intergenic
1022207677 7:28180007-28180029 GAGGCGCTGAGGGCAGCGGGGGG - Intronic
1022477918 7:30723801-30723823 GAGGCAATGAGGGCAGGGGCTGG + Intronic
1023065631 7:36374680-36374702 GTGGAGTTGGGGGCAGGGGGAGG - Intronic
1023529368 7:41136846-41136868 GAGCAGAAGAGGCCAGGCAGTGG + Intergenic
1024250524 7:47502576-47502598 CAGGCGATGAGGGCAGCAGGGGG + Intronic
1025076970 7:55951943-55951965 GTGGAGGTGAGGGCAGGCTCCGG + Intronic
1025610467 7:63072380-63072402 GAGGAGGGGAGGGCTGGGGGAGG - Intergenic
1025849162 7:65231649-65231671 GGGGAGTTGAGGGCAGGGTGGGG - Intergenic
1025945038 7:66099032-66099054 GAGGAGAGGAGGAGAGGAGGAGG + Intronic
1025945092 7:66099218-66099240 GAGGAGAGGAGGAGAGGAGGCGG + Intronic
1025945158 7:66099411-66099433 GAGGAGAGGAGGAGAGGGGGAGG + Intronic
1026228479 7:68463012-68463034 GAGGAGAAGAGGGAAGGAGAGGG - Intergenic
1026272656 7:68850140-68850162 GAGGAGAGGAGGGGAGGGGAGGG - Intergenic
1026307550 7:69154927-69154949 GGGGAGAGGAGGGGAGGGGGAGG - Intergenic
1026669628 7:72377964-72377986 GGGGAAATGGGGGCAGGGGGAGG - Intronic
1027133122 7:75605431-75605453 GAAGAGATGACAGCAGGTGGAGG + Intronic
1027853674 7:83482146-83482168 GAGGAGAAGTGGGTAGGTGGTGG + Intronic
1028480312 7:91297432-91297454 GAGCAGAGGAGGGGTGGCGGGGG - Intergenic
1028694586 7:93693979-93694001 GCAGAGAATAGGGCAGGCGGAGG - Intronic
1028827504 7:95290351-95290373 GAGGAGAGCAGGGCAGGAAGAGG - Exonic
1028952006 7:96646663-96646685 GGGGAGAGGATGGCAGTCGGAGG - Intronic
1029139538 7:98400552-98400574 GAGGAGGGGAGGGAAGGAGGAGG + Intronic
1029361443 7:100091211-100091233 AAGGGGATGAGGACAGGAGGAGG - Intronic
1029426254 7:100495811-100495833 TAGGAGATGGGGGCAGGGGGAGG + Intergenic
1029477705 7:100794858-100794880 GAGGAGGGGAGGGCAGGGGAGGG + Intronic
1029861449 7:103576704-103576726 GAGGAAAGGAGGGAAGGCGCAGG - Intronic
1030196850 7:106860885-106860907 GAGGGGATGAGAGAAGGGGGAGG + Intergenic
1030272187 7:107681911-107681933 GAGGAGGTGGGGGCAGGGGATGG - Intronic
1030716730 7:112816279-112816301 GAAAAGGTGAGGGCAGGTGGGGG - Intergenic
1030781852 7:113610689-113610711 GGGGAGAAGAGGGGAGGAGGAGG + Intergenic
1030865848 7:114700835-114700857 TAGGAAATGAAGGCAGGAGGAGG + Intergenic
1031595049 7:123640617-123640639 GAGGAGAGGAGAGGAGGGGGAGG + Intergenic
1031950056 7:127882418-127882440 GAGGAGAGGAGGGGAGGGGAGGG + Intronic
1032076933 7:128840523-128840545 GAGGAGATGGGGGCAGGGTGGGG - Intronic
1032525791 7:132577410-132577432 GAGGAGAGGAGGCGAGGCGAGGG - Intronic
1032675931 7:134129448-134129470 GAGGAGAGGAGGGGAGGGGAGGG - Intronic
1032957533 7:136988296-136988318 GAGGAGGTGAGGGAAGGAGAGGG + Intronic
1033021408 7:137728648-137728670 GAGGAAATGATGGCAGATGGAGG - Intronic
1033327396 7:140390878-140390900 CAGGAAATGAGGACAGGAGGGGG - Intronic
1033367445 7:140682468-140682490 GAGGAGGTGAGAGGAGGCTGAGG + Intronic
1033518887 7:142139766-142139788 GTAGTGATGAGGGCAGGCAGGGG + Intronic
1033600201 7:142883833-142883855 AAGGAGATCAGGGCAGGGAGGGG + Intronic
1033832639 7:145271807-145271829 GAGAAGAGGAGGGGAGGAGGAGG + Intergenic
1034192731 7:149224093-149224115 GCGGGGACGGGGGCAGGCGGCGG + Exonic
1034393011 7:150800727-150800749 GAGGCGGGGAGGGGAGGCGGGGG - Exonic
1034445292 7:151111028-151111050 GAGGAGAAGACGGGGGGCGGGGG - Intronic
1034653728 7:152712767-152712789 GAGGAGAGGAAGGGAGGGGGAGG - Intergenic
1034679209 7:152915823-152915845 GAGGAGATGAGGGGAGGGGGAGG - Intergenic
1034959828 7:155358308-155358330 GAGGAAAGGAGGGAAGGTGGGGG + Exonic
1035061824 7:156075097-156075119 GAGGCCGTGAGGGCAGGCTGAGG - Intergenic
1035142098 7:156772849-156772871 GAGGAGAGGAGGGGAGGGGAGGG + Intronic
1035165510 7:156987196-156987218 GAGGAGCTGAGGGCACACGCTGG + Intergenic
1035226716 7:157437987-157438009 GAGGAGAGGAGGGGAGGGGAAGG - Intergenic
1035247741 7:157575420-157575442 GGGGAGGTGACGGCAGGCAGGGG + Intronic
1035280777 7:157776690-157776712 GAGGAGAGGGAGGCAGGAGGAGG - Intronic
1035316039 7:157998007-157998029 GAGGAGAGGAGTGCAGGGTGGGG + Intronic
1035534691 8:382051-382073 GAGGAGATGAGGCCCTGCAGAGG - Intergenic
1035637293 8:1156347-1156369 GAGGAGAGTTGGGGAGGCGGCGG + Intergenic
1035689885 8:1553186-1553208 GAGGACAGGAGGGAAGGAGGCGG - Intronic
1035857897 8:2996470-2996492 GAGGAGCTGAGGGCAGGGTGAGG + Intronic
1035903077 8:3478972-3478994 GAGGCGATGAGGGAGGTCGGAGG - Intronic
1036005805 8:4662320-4662342 GAGGAAATGAGGGAAAGCAGAGG + Intronic
1036197518 8:6733328-6733350 GAGGAGAGGAGGGAAGACAGAGG - Intronic
1037072907 8:14674773-14674795 GAGGAGGAGAGGGCAGGGGAGGG - Intronic
1037223572 8:16554783-16554805 GAGGAGAGGAGGGGAGGGGAGGG + Intronic
1037568845 8:20141578-20141600 GAGGAGAGGAGGACAAGGGGGGG + Intergenic
1038447316 8:27612940-27612962 GAGGAGAAGATGGCGGGGGGTGG + Intronic
1039491629 8:37952050-37952072 GGGGAGATGCTGGCAGGCAGGGG + Intergenic
1040319939 8:46287400-46287422 GAGGACATTAAGGCAGGCAGAGG - Intergenic
1040748651 8:50677976-50677998 GGGGAGAGGAGGGCAAGGGGAGG + Intronic
1041740282 8:61150528-61150550 GAGGGGAGGAGGGCTGGGGGTGG - Intronic
1042212232 8:66392321-66392343 GAGGGGAAGGAGGCAGGCGGAGG - Intergenic
1042348317 8:67750282-67750304 GAAGAGAAGAAGGCAGGCAGAGG - Intergenic
1042654976 8:71085863-71085885 GAAGACATGGGGGCAGGTGGGGG + Intergenic
1042822743 8:72949103-72949125 GAGGAGATGAAGGGAGAGGGAGG + Intergenic
1043186872 8:77163530-77163552 GAGGAGATGAGGGCTGACTCTGG - Intergenic
1043463834 8:80486512-80486534 GCGGAGAAGGGGGCGGGCGGCGG - Exonic
1044767966 8:95597161-95597183 GGGGAGAGGAGGGGAGGGGGAGG - Intergenic
1044983258 8:97736399-97736421 GAGGAGGGGAGGGGAGGAGGGGG + Intergenic
1045247822 8:100458946-100458968 GAGGGGATCAGGCCAGGCTGTGG - Intergenic
1045326705 8:101122726-101122748 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
1045388099 8:101690189-101690211 GTGGAGAGGAGGGGAGGGGGTGG + Intronic
1046580296 8:116084585-116084607 GAGGAGCTGATGGCAGGAAGAGG + Intergenic
1046936061 8:119887130-119887152 GAGGGGAGGAGGGGAGGGGGGGG - Intronic
1047061805 8:121235649-121235671 GAGGAGGGGAGGGAAGGAGGAGG - Intergenic
1047061812 8:121235665-121235687 GAGGAGGGGAGGGAAGGAGGAGG - Intergenic
1047131272 8:122022733-122022755 GAGGAGAGGAGGGGAGGGGAAGG - Intergenic
1047247847 8:123160413-123160435 GAGGAGAGGAGGGGAGGGAGAGG + Intergenic
1047338639 8:123958842-123958864 GAGGAGAGCAGTGCAGGGGGAGG + Intronic
1047354046 8:124103333-124103355 GAGGAGATGGGGGAAGTTGGGGG + Intronic
1047629549 8:126692149-126692171 GAGGAGATGAGGGGAGGGGAGGG - Intergenic
1048163309 8:132040138-132040160 GAGGAATTGAGGGGAGGAGGTGG - Intronic
1048569545 8:135640146-135640168 TAGGAGATGAGGACAGATGGGGG + Intronic
1048754803 8:137727169-137727191 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
1048965804 8:139613742-139613764 GAGGACAGGATGGCAGGCAGGGG - Intronic
1049020582 8:139955192-139955214 GGGGAGGTGAGGGTAGGAGGTGG - Intronic
1049024380 8:139978820-139978842 GAGGGGCTGAAGGCAGGCCGAGG + Intronic
1049194716 8:141308715-141308737 GAGAAGGTGGGGACAGGCGGGGG - Intergenic
1049683549 8:143930367-143930389 GTGGAGGTGAGCGCAGGCCGGGG - Exonic
1049700438 8:144008907-144008929 GAGGAGAGGAAGCCTGGCGGAGG + Intronic
1049746534 8:144265528-144265550 GAGGGGCCGAGGGCAGACGGTGG - Intronic
1050041652 9:1501612-1501634 GAGGAGATTGGGGCAGCGGGGGG - Intergenic
1050125473 9:2352680-2352702 GAGGAGAGGAGGGAAGGGGAGGG + Intergenic
1051079368 9:13278418-13278440 GAGGAGAAGTGGCCAGGCGCCGG - Intronic
1051595508 9:18821010-18821032 GAGGAGGTGTGGGTAGGCAGGGG + Intronic
1052339777 9:27353698-27353720 GAGCTGATTAGGGCAGGGGGAGG - Intronic
1052619577 9:30889149-30889171 GAGAAGAAGGGGGCAGGAGGGGG - Intergenic
1052852407 9:33386031-33386053 GAGGGGTGGAGGGCAGGGGGAGG + Intronic
1052951947 9:34220013-34220035 GGGGAGAGGAGGGGAGGGGGAGG - Intronic
1053217957 9:36288552-36288574 GAGGAGATGCCGGCTAGCGGTGG + Intronic
1053288614 9:36865530-36865552 GAAGAGAGGAGGGAAGGCAGCGG + Intronic
1053289126 9:36868454-36868476 GGGGAGATGAGGGACTGCGGTGG + Intronic
1053302348 9:36960990-36961012 GAGGAGAGGAGGAGAGGAGGAGG - Intronic
1053680506 9:40482582-40482604 GAGGGGTGGAGGGCAGGGGGAGG + Intergenic
1053791202 9:41687430-41687452 AATGAGAAGAGGGCAGGGGGTGG + Intergenic
1053930495 9:43110893-43110915 GAGGGGTGGAGGGCAGGGGGAGG + Intergenic
1054153951 9:61627342-61627364 AATGAGAAGAGGGCAGGGGGTGG - Intergenic
1054179550 9:61899124-61899146 AATGAGAAGAGGGCAGGGGGTGG + Intergenic
1054283206 9:63142353-63142375 GAGGGGTGGAGGGCAGGGGGAGG - Intergenic
1054293591 9:63318097-63318119 GAGGGGTGGAGGGCAGGGGGAGG + Intergenic
1054391613 9:64622586-64622608 GAGGGGTGGAGGGCAGGGGGAGG + Intergenic
1054473738 9:65558462-65558484 AATGAGAAGAGGGCAGGAGGTGG - Intergenic
1054504115 9:65893742-65893764 GAGGGGTGGAGGGCAGGGGGAGG - Intronic
1054657988 9:67681697-67681719 AATGAGAAGAGGGCAGGGGGTGG - Intergenic
1055212251 9:73810830-73810852 GAGCAGATGGGGGCAGGTAGAGG + Intergenic
1055715818 9:79116870-79116892 GAGGAGAAGGAGGTAGGCGGCGG + Intergenic
1055757552 9:79572411-79572433 GAGGAGCTGCCGGCGGGCGGTGG + Intronic
1056381745 9:86062597-86062619 GAGGGGAGGAGGGCAAGAGGAGG + Intronic
1056630493 9:88289313-88289335 GAGGAAATGAGGGCAACAGGAGG - Intergenic
1056638074 9:88347741-88347763 GAGGAGAGGAGGGGAGGGGAGGG - Intergenic
1056867561 9:90242694-90242716 GAGGAGAAGAGGGGAGGGGAAGG + Intergenic
1056920989 9:90789274-90789296 GAGGAGATGAGAGCAGGTCATGG - Intergenic
1057220693 9:93256327-93256349 GAGGGACGGAGGGCAGGCGGGGG - Exonic
1057390914 9:94640713-94640735 GAGGAGATAAGGCCAGCGGGAGG + Intergenic
1057489356 9:95509246-95509268 GAGGAGGGGAGGGGAGGGGGTGG + Intronic
1057742327 9:97722552-97722574 ATGGTGATGAGGACAGGCGGGGG + Intergenic
1057928015 9:99170210-99170232 GAGGAGGGGAGTGCAGGCGGGGG - Intergenic
1058422212 9:104842892-104842914 GAGGAGCTCAGAGCAGGAGGAGG - Intronic
1058432397 9:104930328-104930350 GAGGAGATGAGGGGAGGGGAGGG - Intergenic
1058632890 9:107007731-107007753 TAGGAGCAGAGGGCAGGAGGTGG + Intronic
1058803190 9:108564946-108564968 GGGGAGATGAGGGCAGGAATGGG + Intergenic
1058868868 9:109185619-109185641 GAGGAGAGAAGGGGAGGAGGAGG + Intronic
1058902776 9:109456622-109456644 GAGCAGATCAGGGCAGAGGGTGG + Intronic
1059119230 9:111627164-111627186 GATGACATGAGGCCGGGCGGTGG + Intergenic
1059213470 9:112537073-112537095 GAGGAGAAGAGGGGAGGGGAGGG - Intronic
1059306260 9:113355504-113355526 GAGGGGAAGAGGGCAGGGGAGGG - Intronic
1059329232 9:113524579-113524601 GAGGAGCTGAGGGCAGTGGCTGG + Intronic
1060167998 9:121435889-121435911 GAAGAGAGGAGGGTAGGAGGAGG + Intergenic
1060197392 9:121632531-121632553 GAGGAGGTGAGGGCAGGGGAGGG - Intronic
1060405437 9:123370734-123370756 GAGGAGATCCCGGCAGGCAGCGG - Exonic
1060705093 9:125791549-125791571 GAGGAAGAGAGGGCAGGGGGAGG - Intronic
1060809661 9:126604224-126604246 GAAGAGATGAGGCCAGGGAGAGG + Intergenic
1061056601 9:128226001-128226023 GAGGAGGTGGGGACAGGAGGAGG - Intronic
1061062478 9:128257590-128257612 GAGGAGATGAAGGTAGGGTGTGG - Exonic
1061459928 9:130729375-130729397 GAGAAGATGAGGGCATGGGTGGG - Intronic
1061504772 9:131025571-131025593 AAGGAGAGGAGAGCAGGTGGAGG + Intronic
1061682553 9:132250153-132250175 TAGGGGATGAGGGCAGAGGGAGG + Intergenic
1061707935 9:132467353-132467375 CAGGAGCTGAGGGGAGGAGGGGG - Intronic
1061926618 9:133809023-133809045 GAGAAGGTGAGGGCAGATGGCGG - Exonic
1061942828 9:133892197-133892219 GGGGAGATGAGGGGAGGGGTGGG + Intronic
1062021735 9:134322798-134322820 GAGGACAGGAGGGGAGGAGGAGG - Intronic
1062261303 9:135664545-135664567 GAGGAGATGAGGGTGTCCGGTGG + Intronic
1062414717 9:136442457-136442479 GAGGCTGTGAGGGCAGGCTGGGG + Intronic
1062460253 9:136659932-136659954 GAGGGGAGGAGGCCAGGCGTGGG + Intronic
1062604114 9:137336135-137336157 GAGGTGGGGAGGGCAGGAGGAGG + Intronic
1062612634 9:137381927-137381949 GAGGAGGTGAGAGCACGAGGAGG + Intronic
1062612663 9:137382022-137382044 GAGGAGGTGAGGGCGCGGGGAGG + Intronic
1062612668 9:137382041-137382063 GAGGAGGTGAGGGCGCGCGGAGG + Intronic
1062612673 9:137382060-137382082 GAGGAGGTGAGGGCGCGCGGTGG + Intronic
1062612699 9:137382134-137382156 GAGGAGGTGAGGGCGCGGGGAGG + Intronic
1062612704 9:137382153-137382175 GAGGAGGTGGGAGCATGCGGAGG + Intronic
1062612709 9:137382172-137382194 GAGGAGGTGAGGGCGCGCGGAGG + Intronic
1185688250 X:1948214-1948236 GAGGAGATGGGAGGAGGAGGAGG + Intergenic
1185688539 X:2133753-2133775 GAGGAGATGGGAGGAGGAGGAGG + Intergenic
1185772362 X:2774188-2774210 GGGCAGACGAGGGCAGGAGGAGG - Intronic
1185822537 X:3219298-3219320 GGGCAGATGGGGGCAGGAGGGGG + Intergenic
1185869165 X:3649657-3649679 GAGGAGGGGAGGGGAGGCGAAGG + Intronic
1186409189 X:9331211-9331233 TAAGAGATGAGGCCAGGCGCAGG - Intergenic
1186452340 X:9684117-9684139 ATGGAGATGAGGGCGGCCGGTGG - Exonic
1186459957 X:9740068-9740090 GAGGAGAAGAGGGCAGCAGTGGG + Intronic
1186698337 X:12062105-12062127 GTGGAGCTCAGGGCAGGAGGAGG - Intergenic
1187668703 X:21646134-21646156 TAGGGGATGGGGGCAGGGGGTGG + Intronic
1187704272 X:21993899-21993921 GAGGAGGAGAGGGAAGGAGGAGG - Intronic
1189385838 X:40536185-40536207 GTGGAGGTGGGGGCAGGGGGAGG + Intergenic
1189492860 X:41483313-41483335 GAGGAGAGGAGGGGAGGGGAGGG - Intergenic
1190107644 X:47571306-47571328 CAGGATCTGAGGGCAGGTGGGGG - Exonic
1190179225 X:48177501-48177523 CAGGAGAGGAGGGGAGGGGGAGG + Intergenic
1190248886 X:48707673-48707695 GAGCAGGTGGGGGCAGGTGGAGG - Exonic
1190260366 X:48793427-48793449 GAAGAGATGGGGGAAGGGGGAGG - Intronic
1190285985 X:48961768-48961790 GAGGAGAAGAGAGGAGGAGGAGG + Exonic
1190427192 X:50345005-50345027 GAGGAGAGGAAGGCAGGAGCTGG - Intronic
1190598167 X:52066701-52066723 GAGGAGAGGAGGGGAGGAGAGGG + Intronic
1190610657 X:52187372-52187394 GAGGAGAGGAGGGGAGGAGAGGG - Intronic
1190887583 X:54543168-54543190 CAGGAGATGAGGGCAGGAAAAGG - Intronic
1191785938 X:64917279-64917301 GATGAGATGAGGGTAGGAGTAGG + Exonic
1194121902 X:89972835-89972857 GAGGAGAAGGGGGCAGGGTGGGG - Intergenic
1195006561 X:100691077-100691099 GAGGAGATGAGGGAAATGGGGGG + Intronic
1195540409 X:106056668-106056690 GAGGAGAGGAGGGGAGGGGAGGG + Intergenic
1195701469 X:107708857-107708879 GAGGTGATGAGGGCCAGCTGGGG - Intergenic
1196108093 X:111917702-111917724 GAGGAAACAAGGGCAGGCAGAGG - Intronic
1196128193 X:112122444-112122466 GGGGAGGTGAGGGAAGGCGAGGG + Intergenic
1199751551 X:150824137-150824159 GAGGAGAAGAAGGAAGGAGGAGG + Intronic
1199872911 X:151913915-151913937 GAGGAGAGGAGTGCTGGTGGGGG - Intronic
1199873439 X:151915959-151915981 GAGGAGAGGAGTGCTGGTGGGGG - Intronic
1199874144 X:151918678-151918700 GAGGAGAGGAGTGCTGGTGGGGG - Intronic
1200101068 X:153689264-153689286 GGGGAGGGGAGGGCAGGGGGAGG - Intronic
1200238048 X:154478649-154478671 AAGGAAAGGAGGGCGGGCGGGGG - Intronic
1200761476 Y:7043054-7043076 ATGGAGATGAGGGCAGACGGTGG - Exonic
1201739701 Y:17310933-17310955 GAGGAGAAGGGGGGAGGAGGAGG - Intergenic