ID: 1152532545

View in Genome Browser
Species Human (GRCh38)
Location 17:80927826-80927848
Sequence ATGGAGGAGATGAGGGCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1061
Summary {0: 1, 1: 1, 2: 10, 3: 108, 4: 941}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152532545_1152532551 7 Left 1152532545 17:80927826-80927848 CCGCCTGCCCTCATCTCCTCCAT 0: 1
1: 1
2: 10
3: 108
4: 941
Right 1152532551 17:80927856-80927878 TCTGAGAATTCCCGCCCGCACGG 0: 1
1: 0
2: 0
3: 2
4: 43
1152532545_1152532556 19 Left 1152532545 17:80927826-80927848 CCGCCTGCCCTCATCTCCTCCAT 0: 1
1: 1
2: 10
3: 108
4: 941
Right 1152532556 17:80927868-80927890 CGCCCGCACGGAGGAGCTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 157
1152532545_1152532553 16 Left 1152532545 17:80927826-80927848 CCGCCTGCCCTCATCTCCTCCAT 0: 1
1: 1
2: 10
3: 108
4: 941
Right 1152532553 17:80927865-80927887 TCCCGCCCGCACGGAGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 358
1152532545_1152532552 10 Left 1152532545 17:80927826-80927848 CCGCCTGCCCTCATCTCCTCCAT 0: 1
1: 1
2: 10
3: 108
4: 941
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532545_1152532557 20 Left 1152532545 17:80927826-80927848 CCGCCTGCCCTCATCTCCTCCAT 0: 1
1: 1
2: 10
3: 108
4: 941
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152532545 Original CRISPR ATGGAGGAGATGAGGGCAGG CGG (reversed) Intronic
900004665 1:36812-36834 GTGGCTGAGATGAGGACAGGAGG + Intergenic
900172447 1:1275588-1275610 CTGGAGGAGGTGGGGGCAGGAGG - Intergenic
900382221 1:2390603-2390625 ATGTCGGGGAGGAGGGCAGGGGG + Intronic
900421967 1:2559646-2559668 ATGGAGGACCTGAGGCCGGGAGG - Intronic
900577620 1:3391231-3391253 ATGGGCGGGAGGAGGGCAGGGGG + Intronic
900808704 1:4785016-4785038 AAGGAGGAGGTGACGGCCGGGGG + Exonic
900890802 1:5448358-5448380 ATTGAGGAGACAGGGGCAGGAGG + Intergenic
900975127 1:6011970-6011992 GTGGAGGTGATGAAGGCAGAGGG + Intronic
900993118 1:6106944-6106966 ATGGAGGAGAGGAGGGGTGGAGG + Intronic
901013766 1:6215970-6215992 TTGGAGGAGATCAGGGTGGGTGG + Intronic
901128049 1:6943167-6943189 ACGGAGGGGAGGAGGGGAGGAGG - Intronic
901264420 1:7899182-7899204 ATGTTGGAGATGAGGCCTGGTGG - Intergenic
901264902 1:7903000-7903022 AAGGAGGGGAAGAGGGAAGGAGG - Intergenic
901324112 1:8356807-8356829 AGATAGGAGGTGAGGGCAGGAGG - Intronic
901755991 1:11441895-11441917 AGGGAGGAGGAGAGGGAAGGAGG + Intergenic
901844807 1:11975105-11975127 ATGGAAGAGGTGGGGGAAGGGGG - Exonic
901919427 1:12525764-12525786 AGGGAGGAGAGGAGGGGAAGTGG + Intergenic
902371499 1:16009948-16009970 CCGGAGGGGATGTGGGCAGGTGG + Intergenic
902550986 1:17219496-17219518 AAGGAGGGGATGAGGCCAGGTGG + Intronic
902711542 1:18243375-18243397 ATGGAAGAGATGCGGGGAGTGGG - Intronic
902863621 1:19262963-19262985 ACTGAGCAGGTGAGGGCAGGTGG - Intergenic
903019974 1:20386982-20387004 CTGGAGGAGATGGGGGGAGGAGG + Intergenic
903164357 1:21510012-21510034 TGGGAGGAGGAGAGGGCAGGAGG + Intronic
903539682 1:24089947-24089969 GTGTGGGGGATGAGGGCAGGTGG - Intronic
903558585 1:24211071-24211093 GTGGAGGAGAGGAGGGGAGTAGG - Intergenic
903573960 1:24326342-24326364 GTGGAGGAGAAGAGGGGTGGAGG - Intronic
903573965 1:24326358-24326380 GTGGAGGAGAAGAGGGGTGGAGG - Intronic
903573970 1:24326374-24326396 GTGGAGGAGAAGAGGGGTGGAGG - Intronic
903677638 1:25074447-25074469 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
904373867 1:30067175-30067197 AAGGAGGAAGAGAGGGCAGGTGG - Intergenic
904769279 1:32871855-32871877 CTGGCTGAGATGAGGGAAGGGGG - Intronic
904769969 1:32875687-32875709 AAGGAGGCAGTGAGGGCAGGTGG + Intergenic
904957546 1:34297617-34297639 AAAGGGGAGCTGAGGGCAGGGGG - Intergenic
905343519 1:37295549-37295571 AAAGAGGAGAGCAGGGCAGGAGG + Intergenic
906518423 1:46453061-46453083 TGGGAGGAGGAGAGGGCAGGAGG - Intergenic
906606538 1:47176382-47176404 CTTGATGAGCTGAGGGCAGGTGG + Intergenic
906944333 1:50283002-50283024 ATGTTGAAGATGAGGGCAGAGGG - Intergenic
907727393 1:57032384-57032406 ATGGAGGAGAGAAGCACAGGGGG + Intronic
907774366 1:57498925-57498947 AGGGAGGAAATGGGGGCAGGAGG + Intronic
907906357 1:58785684-58785706 ATCGAGGGGAGGAGGGGAGGGGG + Intergenic
908289241 1:62645519-62645541 ATGGAGGAGTTGAGGAAAAGAGG + Intronic
908320395 1:62972804-62972826 AAGGAGGAGGAGAGGGAAGGAGG + Intergenic
908843426 1:68300787-68300809 ATGGAGGAAAGAAGGGAAGGAGG - Intergenic
908912055 1:69083294-69083316 ATGGAGAAGATGGGGGAGGGAGG - Intergenic
908921752 1:69202771-69202793 AGGGAGGAAAGGAGGGAAGGAGG + Intergenic
909484165 1:76155263-76155285 ATGGAGGAGACGGGGGTCGGGGG - Intronic
909655535 1:78027865-78027887 ATGGAGGAGAGGTGGGAATGGGG - Intronic
910088350 1:83431314-83431336 AAGGAGGAGGTGGGGGCAGGAGG - Intergenic
910245340 1:85132713-85132735 ATGGAGGGCAGGAAGGCAGGAGG - Intronic
910611712 1:89151192-89151214 AGGGAGGAAATGAGGACATGTGG - Intronic
910819973 1:91336049-91336071 AGGGAGGAGGGGAGGGCAGGAGG - Intronic
910819996 1:91336137-91336159 AAGGAGGAGGGGAGGGTAGGAGG - Intronic
911115951 1:94247243-94247265 AGTGAGGCGATGAGGGCTGGTGG + Intronic
912478901 1:109962474-109962496 ATGGACTAGGGGAGGGCAGGGGG + Intergenic
912624175 1:111194235-111194257 AGGGTGGAGAACAGGGCAGGAGG - Intronic
912714297 1:111971525-111971547 AGGGAAGAGAAGAGGGCATGGGG - Intronic
913169844 1:116222031-116222053 AAGGAGGAGGGGAGGGGAGGAGG + Intergenic
913701719 1:121380927-121380949 GTGGAGGGGGTGTGGGCAGGGGG - Intronic
914042279 1:144061396-144061418 GTGGAGGGGGTGTGGGCAGGGGG - Intergenic
914135810 1:144899092-144899114 GTGGAGGGGGTGTGGGCAGGGGG + Intronic
914517229 1:148384238-148384260 ATGGAGGAGCTGAGGCAAGCAGG + Intergenic
914944515 1:152052283-152052305 AAGAAGCAGTTGAGGGCAGGGGG - Intergenic
915253170 1:154605077-154605099 ATCCAGGAGATGAGGCCAGGAGG - Intronic
915277736 1:154801113-154801135 CTGGGGGAGATGAGGAAAGGAGG + Intronic
915627441 1:157123998-157124020 AGGGAAGAAAAGAGGGCAGGAGG - Exonic
915725728 1:158015850-158015872 ATGGTGGAGATTAGGGAAGCAGG - Intronic
916410836 1:164545479-164545501 ATGGAGGAAAAGAAGGCTGGAGG + Intergenic
916608796 1:166369620-166369642 AAGGAGGAAAGGAGGGCAGGAGG - Intergenic
917194715 1:172453022-172453044 ATGGAGGAAATGAGGCCTGCAGG + Intronic
917289798 1:173460682-173460704 AAGGAGGAGGGGAGGGGAGGAGG + Intergenic
917578211 1:176346207-176346229 ATGTTGGAGATGAGGCCTGGTGG - Intergenic
917665297 1:177220204-177220226 ATGGGGGAGTGGAGAGCAGGAGG + Intronic
917820507 1:178758535-178758557 GTGGAGGGGATGAGGGCAGGGGG - Intronic
918003409 1:180519743-180519765 GTGGAAGACAAGAGGGCAGGTGG + Intergenic
918006042 1:180543104-180543126 AGGGAGAAGAAGAGGGGAGGAGG + Intergenic
918248738 1:182683371-182683393 ATGGAGGAGGTGCTGGCAAGTGG - Intronic
918459091 1:184757016-184757038 ATAGAGGAGAGTAGGGCAGCAGG - Intergenic
918754663 1:188324234-188324256 GTGAAGGAGATTGGGGCAGGTGG + Intergenic
918824215 1:189300876-189300898 AGGGAGGAGAGGAGGGAGGGTGG + Intergenic
919098268 1:193062271-193062293 AGGCAGGAGATGATGGCAGTTGG + Intronic
920034280 1:203055904-203055926 AAGGAAGAGGTGAGGGCAGTGGG - Intronic
920041150 1:203098341-203098363 ATGGAGGAGACGAGGACAAAAGG - Intronic
920118502 1:203638115-203638137 ATGGAGGAGGGGAGGGGAGATGG + Intronic
920396337 1:205648763-205648785 ATTGAAGAGAAGGGGGCAGGAGG - Intergenic
920489143 1:206399647-206399669 GTGGAGGGGGTGTGGGCAGGGGG - Intronic
920681274 1:208074583-208074605 ATGGAGAAGATGGGGTAAGGAGG + Intronic
921001681 1:211050466-211050488 ATGGAAGAGGTAAGGGCAGTGGG + Intronic
922056207 1:222044834-222044856 ATAGAGGAGATGGGGCCCGGTGG + Intergenic
922483490 1:225955778-225955800 ATGGAGGAAAGGAGGCCAGGAGG + Intergenic
922572787 1:226643728-226643750 CAGGAGGTGATGAGGGCTGGAGG + Intronic
922574277 1:226651885-226651907 ATGGAGGAGGTGTGGGCAGAGGG - Intronic
923051880 1:230395415-230395437 TGGGAGGAGAGGAGGGGAGGAGG - Intronic
924002969 1:239574316-239574338 AAGAAGGAGAGGAGGGCAGCTGG - Intronic
924123713 1:240828281-240828303 TTGGAGGAGGAGAGGGGAGGAGG + Intronic
1062922863 10:1293084-1293106 AGGGAGGAAAGGAGGGAAGGGGG + Intronic
1063427235 10:5959998-5960020 ATGGAGGAGCTGAGGGTAATGGG - Intronic
1063482125 10:6385223-6385245 CTGAAGGAGGTGTGGGCAGGAGG + Intergenic
1064131517 10:12713970-12713992 ATGGATGGGATCAGAGCAGGAGG + Intronic
1064465669 10:15578172-15578194 ATGGAGGAGATAGGGACAGAGGG - Intronic
1064720209 10:18221090-18221112 AGGGAGGAGAGAAGGGCAGGGGG + Intronic
1064722195 10:18240779-18240801 ATGGGGGAGAAAAGGGAAGGAGG - Intronic
1064889704 10:20156655-20156677 ATTGTGGAGATGGGGGCAGGAGG + Intronic
1065484915 10:26228156-26228178 ATGGAAGACATGAGGCCATGGGG - Intronic
1065827297 10:29584110-29584132 GTGGAGGAGATGATGGCAATAGG + Intronic
1067068476 10:43116559-43116581 ATGTTGGAAATGAGGGAAGGGGG - Intronic
1067285124 10:44902259-44902281 AGGGAGGAGAGGAGGGATGGGGG + Intergenic
1067294532 10:44967761-44967783 ATGGTGGGGGTGAGGGCGGGGGG - Intronic
1067299562 10:44996349-44996371 ACTGAGGAACTGAGGGCAGGGGG - Intergenic
1067473090 10:46550003-46550025 ATGAGGGAGGTGAGGGCTGGTGG - Exonic
1067841971 10:49688390-49688412 AGGCAGGAGATGATGGCGGGTGG - Intronic
1068297198 10:55087653-55087675 ATTGTGGAGATGAAAGCAGGTGG + Intronic
1068430516 10:56925777-56925799 ATGGAAGAGAAAAGGGCATGGGG - Intergenic
1069334836 10:67336152-67336174 ATGGAGGAGATGGGGACAACTGG - Intronic
1069601447 10:69710801-69710823 CTGGAGGGGAGAAGGGCAGGGGG - Intergenic
1069708274 10:70472810-70472832 AGGGAGGAGGTGTGGGCAGAAGG + Intergenic
1069776904 10:70932710-70932732 ATGGAGGAGATGGTGGCACAGGG + Intergenic
1070829150 10:79408075-79408097 GTGGTGGAGGTGGGGGCAGGAGG - Intronic
1070888862 10:79927410-79927432 GGGGAGGAGATCAGGGCAGTGGG + Intergenic
1071115195 10:82210461-82210483 AAGGAGAAGTGGAGGGCAGGGGG + Intronic
1071335503 10:84597130-84597152 ATTGAGGAGCTGGGGGCTGGGGG + Intergenic
1073074630 10:100816038-100816060 AGGGAAGAGATGAAGGGAGGAGG - Intronic
1073113041 10:101073966-101073988 CTGGGGGAGCTGCGGGCAGGTGG + Intergenic
1073576393 10:104629616-104629638 ATTAAGGAGATGGGGACAGGTGG + Intergenic
1073812599 10:107166573-107166595 ATGGAGGAGAGGAGAGCCAGAGG + Intergenic
1074228626 10:111512228-111512250 AGAGAGGAGAGGAGGCCAGGAGG - Intergenic
1074326306 10:112455180-112455202 AGGGGGGAGGTGAGGGGAGGAGG - Intronic
1074326364 10:112455286-112455308 GTGGAGGAGGGGAGGGGAGGGGG - Intronic
1074886633 10:117699205-117699227 ATGGAGGAAAGGTGGGCAGAGGG + Intergenic
1074963126 10:118465611-118465633 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1074994969 10:118748888-118748910 ATGGAGGAGAAGAGGTGTGGAGG + Intronic
1075155686 10:119974346-119974368 ATCGTGGAGATGCTGGCAGGGGG + Intergenic
1075324375 10:121519005-121519027 CTGGTGGAGAGAAGGGCAGGAGG + Intronic
1075419921 10:122293119-122293141 AAAGAAGAGATCAGGGCAGGAGG + Intronic
1075432395 10:122399013-122399035 ATGGAGGAGAGGAAAGCAGCTGG - Intronic
1075581952 10:123625570-123625592 ATGGAGGAGATGAGTGGCTGTGG + Intergenic
1075838497 10:125476859-125476881 ATGTTGGAGATGAGGCCTGGTGG - Intergenic
1075938391 10:126364814-126364836 AGGGAGGAGTTGAGGGAAGGAGG - Intronic
1075968914 10:126636559-126636581 CTGGAGGAGACAAGGACAGGTGG - Intronic
1076473908 10:130739229-130739251 TAGGAGAAGAAGAGGGCAGGGGG + Intergenic
1076596453 10:131625587-131625609 TTGGGGGTGATGAGGTCAGGGGG - Intergenic
1076790624 10:132775059-132775081 ACGGAGGAGAGAGGGGCAGGGGG + Intronic
1076854470 10:133109084-133109106 ATGGAGGATATGAGGGGCAGGGG - Intronic
1076976706 11:177763-177785 ATGCAGGGGATGAGGTGAGGAGG + Intronic
1077106367 11:844181-844203 GTGGAGGTGAGGGGGGCAGGGGG + Intronic
1077248377 11:1549914-1549936 TTGGAGGGGCTGGGGGCAGGTGG - Intergenic
1077391836 11:2303886-2303908 AGGGAGGAAAAGAGGGAAGGAGG + Intronic
1077510223 11:2955976-2955998 ATGGAGGAGGAGAAGGGAGGGGG - Intronic
1077629327 11:3800122-3800144 ATGGAGGAGTTGGGGGAAGATGG - Intronic
1077636269 11:3843258-3843280 GTGGAGGACATGAGAGCAGGAGG + Intergenic
1077863072 11:6200091-6200113 ATGAGGGGGTTGAGGGCAGGTGG - Exonic
1077908586 11:6555171-6555193 AGGGAGGAGAGGAGGGATGGAGG - Intronic
1078093381 11:8281662-8281684 ATGGAGGACAGGATGGCAGGGGG - Intergenic
1078701716 11:13691307-13691329 TAAGAGGAGATAAGGGCAGGAGG - Intronic
1078929050 11:15899395-15899417 AAGGGTGAGATGAGGGCAAGTGG + Intergenic
1079217413 11:18526498-18526520 GTGGAAGAGAGGAGGGCGGGTGG + Intronic
1079331846 11:19540155-19540177 CTGCAGGAGATGAAGGCAGGCGG - Intronic
1079493692 11:21017041-21017063 ATGGTGGTGATGATGCCAGGTGG - Intronic
1079817188 11:25076541-25076563 AAGGAAGAGAGGAGGGAAGGAGG + Intronic
1079964394 11:26963197-26963219 AAGGAGGAAAGGAGGGCAGGAGG + Intergenic
1080542352 11:33280013-33280035 CTGGGGGAGCTGAGGGGAGGTGG + Intronic
1080839782 11:35973111-35973133 AGGGAGGAGACCAGGGCAGCTGG - Intronic
1081566156 11:44262531-44262553 ATGGAGGAACTGAGTGCCGGGGG + Exonic
1081852600 11:46284238-46284260 ATGGAGCAGAGCATGGCAGGAGG + Intronic
1082009692 11:47441786-47441808 ATGCAGGGGCTGGGGGCAGGGGG - Intronic
1082772590 11:57219855-57219877 ATGGAGAAGAGGAGGGGTGGGGG + Intergenic
1082808378 11:57463927-57463949 AAGGAGGAGGGGAGGGGAGGGGG - Intronic
1082957661 11:58887514-58887536 AAGGAGGAGAGGAGAGGAGGGGG - Intronic
1083172876 11:60933517-60933539 ATGGAAGGGCAGAGGGCAGGTGG - Intronic
1083178909 11:60971920-60971942 TGGCAGGAGATGAGGGAAGGGGG - Intronic
1083201617 11:61124222-61124244 CTGGAGGAGGTGAGGGCTGCTGG - Intronic
1083484666 11:62975860-62975882 AGGGAAGAGAAGAGGGAAGGGGG - Intronic
1083855429 11:65390803-65390825 ACGGAGGAGGTGAGAGGAGGAGG - Intronic
1083909738 11:65699323-65699345 ATGGAGGAGAGGAGGCAAAGGGG + Intergenic
1084104918 11:66975062-66975084 AGGGGGGAGAGGAGGGGAGGGGG + Intergenic
1084157626 11:67323001-67323023 AGGGAGGAGAGGAGGGAAAGAGG - Intronic
1084177242 11:67429260-67429282 ATGGAGGCTGTGAGGCCAGGAGG - Intronic
1084196502 11:67525755-67525777 ATGGAGGAGGTGAGGGGATAAGG + Intergenic
1084360402 11:68665222-68665244 CGGGAGGAGATGAGGGAAGAGGG + Intergenic
1084438378 11:69157125-69157147 GGGGAGAAGATGAGGACAGGCGG - Intergenic
1084495627 11:69501508-69501530 ATGGAGGAAAGGAGGGCTGGAGG + Intergenic
1084726414 11:70945338-70945360 AGGGAGGAGGTGAAGGCAGAAGG + Intronic
1084742664 11:71149744-71149766 AGGGAGGAGGGGAGGGAAGGAGG + Intronic
1085129460 11:74025704-74025726 AGGGAGGATACGAGGGCTGGAGG + Intronic
1085248993 11:75129309-75129331 GTGGAGGGGAGGAGGGCAGCAGG + Intronic
1085458257 11:76677984-76678006 TAGGAGGAGATGAGAGGAGGGGG - Intergenic
1085637555 11:78170177-78170199 TTGGAGGTGCTGAGGGCATGAGG + Intergenic
1085750324 11:79155688-79155710 AAGGAGGAAAGGAGGGGAGGGGG - Intronic
1086411528 11:86549329-86549351 AAAGAGGAGATAAGGGCAGATGG - Intronic
1086876771 11:92105961-92105983 ATGGAGGGGAAGAGGGATGGAGG + Intergenic
1087004139 11:93452453-93452475 GTGGAGGAGATGAAGGAAGTGGG + Intergenic
1087806194 11:102558308-102558330 ATGGGGGAGATGTGGGCTGTAGG - Intergenic
1088228929 11:107653597-107653619 AGGGAGGAGAGGCGGGGAGGGGG - Intronic
1088410267 11:109526288-109526310 ATGGAGGAGGTGAGGCCTGGTGG + Intergenic
1088685601 11:112282035-112282057 TGGCAGGGGATGAGGGCAGGCGG + Intergenic
1088695480 11:112362482-112362504 AAGTAGGAAATGAGGGCAGGGGG + Intergenic
1089054281 11:115572642-115572664 ATTGAAGAGATGAGGGAAAGTGG + Intergenic
1089257355 11:117200874-117200896 AAGGCAGACATGAGGGCAGGTGG + Intronic
1089489778 11:118875250-118875272 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1089505306 11:118958347-118958369 CTAGGGGAGAGGAGGGCAGGAGG - Exonic
1089605264 11:119638014-119638036 GTGGAGGAGGTGAGGGCAGGGGG - Intronic
1089672590 11:120066892-120066914 AGGGAGGATATGAGGTCAGCGGG - Intergenic
1090237503 11:125160218-125160240 AGCAAGGAAATGAGGGCAGGGGG - Intergenic
1090239709 11:125173526-125173548 ATGGAGGAGATGAGTTTAGCTGG - Intronic
1090278458 11:125435912-125435934 ATAGTAGAGATGCGGGCAGGTGG - Intergenic
1090288031 11:125517183-125517205 AAGGAGGAAAGGAGGGCAGCTGG - Intergenic
1090344591 11:126059483-126059505 ATTGGGGGGATGCGGGCAGGGGG - Intronic
1090387002 11:126363182-126363204 AGGAAGGAGATGGGGGCAGGAGG - Intronic
1090651904 11:128814341-128814363 TTGGAGGTGATTAGGGCATGAGG - Intergenic
1090913996 11:131146444-131146466 GAGGGGGACATGAGGGCAGGAGG - Intergenic
1090996075 11:131866990-131867012 AGGGAGGAGGTGGGGGAAGGGGG + Intronic
1091042455 11:132294601-132294623 ATCGAGCAGTTGAGGACAGGAGG + Intronic
1091322975 11:134664814-134664836 ATGGGGAGGATGAGGGCAGCAGG + Intergenic
1091685132 12:2556191-2556213 AGGCTGGAGAAGAGGGCAGGAGG - Intronic
1092233605 12:6791969-6791991 TTTGAGGGGATGAGGGAAGGAGG + Intronic
1092527243 12:9316752-9316774 ATGGAGGAAGTGAGGACAAGGGG + Intergenic
1092540030 12:9415021-9415043 ATGGAGGAAGTGAGGACAAGGGG - Intergenic
1092575298 12:9776134-9776156 AAGGAGGAAAAGAGAGCAGGAGG - Intergenic
1092743828 12:11654653-11654675 AGGGAGGAGATGAGAGAAGAAGG + Intronic
1093884204 12:24440730-24440752 AGGGAGTAGGTGAGGGGAGGAGG - Intergenic
1093887002 12:24473361-24473383 TGGGAGGAGATGTGGGCAAGTGG + Intergenic
1094513006 12:31107443-31107465 ATGGAGGAAGTGAGGACAAGGGG + Intergenic
1095262998 12:40119538-40119560 AAGGAGAAGGTGAGGGCAGGAGG - Intergenic
1095721334 12:45404684-45404706 GTGGGGGAGATGAGAGGAGGAGG - Intronic
1096226517 12:49869802-49869824 GGGCAGGAGGTGAGGGCAGGGGG - Exonic
1096429992 12:51534929-51534951 TTGGTGGAGATGAGGCCACGTGG + Intergenic
1096524793 12:52204030-52204052 ATGGAGGAGAGCTGGGCAAGGGG + Intergenic
1096539141 12:52294478-52294500 AGGGAGGAGGGGAGGGAAGGTGG + Intronic
1096677401 12:53232944-53232966 AGGCTGGAGAGGAGGGCAGGAGG + Intronic
1096767039 12:53899521-53899543 AGGGAGGAAAGGAGGGGAGGAGG + Intergenic
1096943188 12:55372461-55372483 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1096977302 12:55706984-55707006 ATGGATGGAATGAGGGCAGCAGG - Intronic
1097248559 12:57620056-57620078 ATTGCGCAGATGAGGGGAGGTGG - Exonic
1097967911 12:65601026-65601048 ATGGAGGAGAAGAGGAGAGGAGG + Intergenic
1098069288 12:66654673-66654695 AAGGAGGAGAGGAGGGCTGTGGG + Intronic
1098730053 12:74024670-74024692 ATGGAGGAGATGGAGGAAGAGGG + Intergenic
1099439584 12:82684971-82684993 ATGCAGGAGATGAGGGCAGCTGG + Intergenic
1099735019 12:86555889-86555911 ATGGGGGTGATGAAGTCAGGGGG - Intronic
1100335708 12:93627023-93627045 ATGTTGGAGATGAGGTCTGGTGG + Intergenic
1100553706 12:95671864-95671886 ATGCAGTGCATGAGGGCAGGAGG - Intronic
1100587139 12:95990781-95990803 AGGGAGGAAAGGAGGGCTGGAGG + Intronic
1100728898 12:97441756-97441778 ATGGAGGAGAGGAGAGAGGGAGG + Intergenic
1100782081 12:98037778-98037800 AGGAAGGAAATGAGGGAAGGAGG + Intergenic
1100785326 12:98072225-98072247 ATGGTGGGGATGAGGGGAGGGGG + Intergenic
1101372562 12:104142681-104142703 TAGGAGGAGATGAGGGTAGAGGG - Intergenic
1101410998 12:104468231-104468253 TTGAAGGAGATGAGGGTAGATGG + Intronic
1101698377 12:107148534-107148556 ATGGAGGAGGACATGGCAGGCGG + Intergenic
1101824415 12:108209566-108209588 AGGGTGAAGATGAAGGCAGGTGG + Intronic
1101825520 12:108217424-108217446 ATGCAGGAAATGAGGGAAGTGGG + Intronic
1101850341 12:108396897-108396919 AGGAAGGAGATGAGCGGAGGAGG + Intergenic
1102204770 12:111082916-111082938 ATGGAGGACATTTGAGCAGGAGG + Intronic
1102543308 12:113637920-113637942 GGGGAGGAGGGGAGGGCAGGAGG - Intergenic
1102573853 12:113843822-113843844 AGGGAGCAGATGAGGTCAGCAGG - Intronic
1102780929 12:115563706-115563728 AGGGAAGAGAGGATGGCAGGAGG + Intergenic
1102782702 12:115579150-115579172 TTGGAGGAGATGGGGGCAGTGGG + Intergenic
1103361018 12:120353684-120353706 GTGCAGGAGATGAGGACAGGAGG - Intronic
1103580167 12:121908906-121908928 GGGGAGGAGGTGAGGCCAGGAGG + Intronic
1103911668 12:124355478-124355500 GCAGAGGAGATGAGGGGAGGCGG + Exonic
1104145121 12:126025925-126025947 ATGCACAAGATGAGGGTAGGGGG - Intergenic
1105492494 13:20902480-20902502 AAGGAGGGGACGACGGCAGGAGG + Intronic
1105806760 13:23955958-23955980 AAGAAGGTGATGAGAGCAGGAGG + Intergenic
1106116182 13:26819751-26819773 TTGGAGGTAATGAGGTCAGGAGG + Intergenic
1106552518 13:30784514-30784536 ATGGAGCAGAAAAGGGAAGGGGG + Intergenic
1106556113 13:30810018-30810040 AAGGAGGAGGTGAGGGAAAGTGG + Intergenic
1106559810 13:30838483-30838505 ATGCAGGAGATGGGGCCTGGTGG - Intergenic
1107629279 13:42326958-42326980 GTGGAGGTGAGAAGGGCAGGTGG + Intergenic
1108151624 13:47541804-47541826 ATGGAGAATATGAGGGAGGGAGG + Intergenic
1108576585 13:51796451-51796473 ATGGAGGTGAGGGGGGCAGTAGG + Intronic
1108696832 13:52909595-52909617 ATGGAAGAGTGGAGGGCAGGAGG + Intergenic
1110554997 13:76849665-76849687 ATGGAGGAGAGGATGGCGAGTGG - Intergenic
1111453517 13:88449849-88449871 CTGGAGGAGATGAATGAAGGAGG - Intergenic
1111770709 13:92592395-92592417 ATGGAAGAGAGGAAAGCAGGAGG - Intronic
1111912192 13:94325142-94325164 AGGGAGGAGAGGAGGGAGGGAGG + Intronic
1112389472 13:98969856-98969878 CTGCAGGAGATGAGGTCAGCAGG + Intronic
1112669036 13:101613702-101613724 ATGGAGGAGATGAGGGCACTTGG + Intronic
1112767089 13:102756830-102756852 ATGGAGAAGAAGAGGTTAGGGGG - Intronic
1113159130 13:107359587-107359609 AGGGAGGAAATGAAGGAAGGAGG - Intronic
1113236280 13:108278661-108278683 AAGGAGGAGAGGAGGAGAGGAGG - Intronic
1113596487 13:111537585-111537607 ATGGGAGAGATGAGGGCACATGG + Intergenic
1113598892 13:111554472-111554494 AGGGAGGAGAGGAGGCCAGATGG - Intergenic
1114252240 14:20971444-20971466 AGGGAGGGGAGGAGGGCTGGGGG - Intergenic
1114415568 14:22540989-22541011 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1114546915 14:23509748-23509770 AGGGAGGAGATGGGGTCAGCTGG + Intronic
1114602314 14:23966715-23966737 ATGAAACAGATGAGGGCAGTGGG + Intronic
1114606481 14:24001815-24001837 ATGAAACAGATGAGGGCAGTGGG + Intronic
1114612035 14:24049109-24049131 ATGAAACAGATGAGGGCAGTGGG + Intergenic
1114635974 14:24187071-24187093 ATAGATGAGGTGAGGACAGGTGG - Exonic
1114813620 14:25929432-25929454 ATGGGCTAGATGAGGGCAGCTGG - Intergenic
1114882170 14:26799307-26799329 AAGGAGGAGATAAGGGAATGGGG + Intergenic
1115490522 14:33953584-33953606 CTGGAGGAGATCACTGCAGGAGG - Intronic
1115797634 14:36957170-36957192 GTGGAGGAAAGAAGGGCAGGGGG - Intronic
1116289982 14:43022375-43022397 AGGGAGGAGAAGAGGGAGGGAGG - Intergenic
1116442703 14:44972008-44972030 AAGGAGGAAGAGAGGGCAGGAGG + Intronic
1117206476 14:53448857-53448879 ATGGAGGAGAAGAGAGCTGAGGG + Intergenic
1118381540 14:65221572-65221594 CTCGAGGAGGTGAGGGGAGGTGG - Intergenic
1118730007 14:68659462-68659484 GGGGAGGAGAAGAGGGCGGGAGG + Intronic
1118753046 14:68820327-68820349 AAGGGGGAGGTGAGGGCAGGTGG - Intergenic
1118921548 14:70153786-70153808 AGTGATGAGATGAGAGCAGGAGG - Intronic
1118994342 14:70822721-70822743 AAGGAGGGGAGGAGGGGAGGAGG - Intergenic
1119125050 14:72117617-72117639 AGGGAAGAGAGGAGGGCATGGGG + Intronic
1119180158 14:72600086-72600108 AAGGAGGAGAAGAAGGGAGGGGG - Intergenic
1119238163 14:73036911-73036933 ATGTAGGAGATCTAGGCAGGAGG + Intergenic
1119530037 14:75353521-75353543 ATGGAGGAGGAGAGGAAAGGAGG - Intergenic
1119610414 14:76056982-76057004 ATGAAGGTTATGAGGGCAGAAGG - Intronic
1119882859 14:78114807-78114829 ACTGAGTGGATGAGGGCAGGAGG - Intergenic
1120015630 14:79470219-79470241 AAGGGGGAGATGAAGGCAGGTGG + Intronic
1120560837 14:85990430-85990452 ATTGAGGAGATAAGGGCTGAAGG + Intergenic
1120597969 14:86464760-86464782 AGGGAGGAAAAGAGGGAAGGGGG - Intergenic
1120903125 14:89593070-89593092 AGGGAGGGAATGAGGGAAGGAGG + Intronic
1121031192 14:90659981-90660003 AAGGAGGAGAGAATGGCAGGTGG + Intronic
1121237096 14:92399864-92399886 AGGGAGGAGTCGATGGCAGGTGG + Intronic
1121447550 14:93988280-93988302 ATGGAGGAGGGGATGGGAGGAGG + Intergenic
1121481246 14:94276669-94276691 ATGCTGGAGATGAGGCCTGGTGG - Intronic
1121777023 14:96597983-96598005 AGGAAGGAGAAGAGGGGAGGAGG - Intergenic
1121994336 14:98590433-98590455 ATGGGGGAGATGGGAGCAGAAGG + Intergenic
1122027334 14:98887222-98887244 CGGGAGGAGATCAGAGCAGGGGG + Intergenic
1122141332 14:99664609-99664631 AAGTGGGAGCTGAGGGCAGGGGG - Intronic
1122426324 14:101608047-101608069 GTGGAGGAGAGGAGGAGAGGTGG - Intergenic
1122476966 14:102016994-102017016 ATGGAGGTAAAGAGGCCAGGAGG + Exonic
1122874068 14:104655180-104655202 AGGGAGGAAAGGAGGGAAGGAGG + Intergenic
1122919483 14:104874149-104874171 TTGGAGGAGGTGAGTGCTGGGGG + Intronic
1124439900 15:29678135-29678157 AGGGAGGAGATGGTGGCAGCAGG + Intergenic
1124685668 15:31779777-31779799 ATGGAGGAGGTGGGTGCAGAGGG + Intronic
1124955668 15:34358713-34358735 ATATAGGAGATGACAGCAGGAGG + Exonic
1125355430 15:38812711-38812733 AGGGAGTAGAAGAGGGGAGGCGG - Intergenic
1125649111 15:41298920-41298942 ATAGAGGAGTTGGGGGCAGAGGG + Intergenic
1125927128 15:43572008-43572030 ATGGTAGAGATGAGGGAATGAGG - Intronic
1125940272 15:43671573-43671595 ATGGTAGAGATGAGGGAATGAGG - Intergenic
1126095985 15:45091098-45091120 AAGGAGTGGATGAGGACAGGAGG - Intergenic
1126485960 15:49181098-49181120 GAAGAGGAGATGAGGGGAGGGGG - Intronic
1126886819 15:53159639-53159661 ATGGAGCACATAAGGGAAGGAGG - Intergenic
1126889591 15:53190070-53190092 AGGGAGGAAAAGAGGGAAGGAGG + Intergenic
1127153387 15:56102828-56102850 ATGGAGGAGATGAGAGGAAGGGG - Intronic
1127346926 15:58110324-58110346 ATGGAGAAGGTGAGGGTAGAAGG + Intronic
1127515570 15:59689797-59689819 ATGGATGAAATAAGGGGAGGAGG + Intergenic
1127667429 15:61162449-61162471 ATGGAGGAGATGCTGCCAGTAGG + Intronic
1128107143 15:65053537-65053559 ATGGAGGAGCTGAGGTCAGAGGG - Exonic
1128407179 15:67354623-67354645 AAGGAAGAGAAGAGGGAAGGAGG + Intronic
1128793525 15:70449547-70449569 ATGGAGGGAAGGAGGGAAGGAGG + Intergenic
1129669311 15:77598381-77598403 AGGGTGGAGATGGGGGCAGGGGG - Intergenic
1129822881 15:78616686-78616708 ATGGAGCAGAGGAGGGCCCGGGG - Intronic
1130727318 15:86452736-86452758 CGTGAGGAGATGAGGGCAGAAGG - Intronic
1130847147 15:87758145-87758167 AAGGAGGAAAGGAGGACAGGAGG + Intergenic
1130993249 15:88889262-88889284 ATGGGGGAGAGGAGGTAAGGGGG + Intronic
1131171461 15:90181777-90181799 GGGGAGGAGATGAGAGAAGGGGG + Intronic
1131395488 15:92082319-92082341 ATTGAGGAGACGAAGGCAAGTGG + Intronic
1131559275 15:93425099-93425121 ATGGAGAAATTGAGGGCAGGAGG - Intergenic
1132193640 15:99892415-99892437 ATGGAAGAGAGGAAAGCAGGAGG + Intergenic
1132448843 15:101954131-101954153 GTGGCTGAGATGAGGACAGGAGG - Intergenic
1132551508 16:555647-555669 AGGGAGGTGATGAGGGAAAGGGG + Intergenic
1132828313 16:1915804-1915826 ACGGTGGAGAGGAGGGAAGGAGG + Intronic
1132923333 16:2411918-2411940 GTGGGGGAGCTGAGGGCAGAGGG - Intergenic
1133392670 16:5422504-5422526 AAGGAGGAGGTGAGGAAAGGAGG + Intergenic
1133418017 16:5621522-5621544 ATGGAGGGAGGGAGGGCAGGAGG + Intergenic
1133451447 16:5907082-5907104 AGGGAGGAGATGGGGGTTGGAGG + Intergenic
1133583793 16:7171932-7171954 AGAGAGGAGATGTGGGCACGGGG + Intronic
1134476827 16:14581420-14581442 TGGGAGGAGATGAGGGGAGGAGG - Intronic
1134834939 16:17353346-17353368 GTGGGGGAAGTGAGGGCAGGAGG + Intronic
1135074480 16:19381790-19381812 ATGGAGCAGATGTGGACACGTGG - Intergenic
1135401146 16:22166870-22166892 GAAGAAGAGATGAGGGCAGGGGG - Intronic
1135725867 16:24853585-24853607 ATGAAGGAGAGAAGGGCGGGAGG + Intronic
1135786394 16:25353007-25353029 ATGGAGAACATGAGGACATGTGG + Intergenic
1135835560 16:25822344-25822366 TTGGAGGAGAGGAGGTCACGAGG - Intronic
1135961929 16:27002168-27002190 GTGGAGGAGATGAGGTCAGAAGG + Intergenic
1135975964 16:27109248-27109270 AGGGAGGAAAAAAGGGCAGGAGG + Intergenic
1136070240 16:27783067-27783089 GTGGAGGAGAAGAGGGGACGTGG + Intergenic
1136429178 16:30186983-30187005 CTGCAGTGGATGAGGGCAGGAGG + Intronic
1136459980 16:30404182-30404204 ATGGAGGAGAGGTAGGCAGAGGG - Intergenic
1137036738 16:35574895-35574917 CTGGAGGAGCTGTGGGCATGGGG - Intergenic
1137219836 16:46437618-46437640 AAGGAGGAAATGAGGGAAGAAGG - Intergenic
1137364372 16:47848105-47848127 ATGGAGTGGAGGTGGGCAGGTGG + Intergenic
1138158071 16:54724792-54724814 GTGGGGGAGATGAGGCCAGAGGG - Intergenic
1138197203 16:55060462-55060484 AGACAGGAGATGAGGCCAGGAGG - Intergenic
1138222298 16:55263158-55263180 ATGGATGAGATGGGGGCAGCTGG + Intergenic
1138293852 16:55870277-55870299 ATGGAGGAGGTGAGAGGAGGAGG + Intronic
1138437933 16:57016442-57016464 ATGGAGGAAATGAAGAGAGGCGG - Intronic
1138621244 16:58212973-58212995 AGGGAGGAAATGAGGGAAGAGGG + Intergenic
1139425005 16:66873901-66873923 AGGGAGGAGGAGGGGGCAGGAGG - Intergenic
1139545475 16:67647779-67647801 AGGGAGGGGGTGAGGGGAGGGGG + Intronic
1139547595 16:67656912-67656934 ATGCAGGAGATGTGGGAGGGTGG + Intronic
1139636943 16:68263868-68263890 AGGGAGGGGAAGGGGGCAGGAGG + Intergenic
1139835378 16:69834199-69834221 GAGGAGCAGATGAGGGCAGGAGG - Intronic
1139917396 16:70437267-70437289 ATGGAGGAAGGGAGGCCAGGGGG - Intronic
1140026718 16:71297607-71297629 AAGGAGGGGAGGAGGGGAGGAGG - Intergenic
1140495107 16:75379597-75379619 AAGGAGGGGGTGAGGGCAGGAGG + Intronic
1140667234 16:77238853-77238875 CTGGAGGATAAGAGGCCAGGTGG - Intergenic
1140673500 16:77303145-77303167 CTGGTGGAGATGAGGGGAGATGG - Intronic
1140840188 16:78831224-78831246 AAGGGGGAAATGAGGGCTGGAGG - Intronic
1140981208 16:80111571-80111593 ATGGGGTAGAAGAGGGCAGAGGG - Intergenic
1141069660 16:80942230-80942252 ATGCTGGAGATGAGGCCTGGTGG + Intergenic
1141113997 16:81292921-81292943 TCGGAGGTGAGGAGGGCAGGAGG - Intergenic
1141264761 16:82486973-82486995 AGGCAGGAGATCAGGGGAGGAGG - Intergenic
1141637285 16:85321014-85321036 ATCGGGGTGATGGGGGCAGGGGG - Intergenic
1141832991 16:86520047-86520069 ATGTAGGTCATGAGGACAGGAGG + Intergenic
1141894017 16:86947049-86947071 ATGGAGATGATGAGGCCTGGAGG - Intergenic
1142030651 16:87836809-87836831 AAGGAGGAAAGGAGGGAAGGAGG + Intronic
1142030673 16:87836870-87836892 AGGGAGGAGAGGAGGGAAGGAGG + Intronic
1142112309 16:88339323-88339345 ATGGGGGACATGGTGGCAGGGGG + Intergenic
1142112337 16:88339391-88339413 ATGGGGGACAGGATGGCAGGGGG + Intergenic
1142112382 16:88339503-88339525 ATGGGGGACATGGTGGCAGGGGG + Intergenic
1142112399 16:88339548-88339570 ATGGGGGACAGGATGGCAGGGGG + Intergenic
1142112406 16:88339571-88339593 ATGGAGGACATAGTGGCAGGGGG + Intergenic
1142112423 16:88339614-88339636 ATGGGGGACATGGTGGCAGGAGG + Intergenic
1142443709 16:90120411-90120433 ATGCAGGGGATGAGGTGAGGAGG - Intergenic
1142463719 17:114804-114826 ATGCAGGGGATGAGGTGAGGAGG + Intergenic
1142690670 17:1604726-1604748 CAGCAGGAGGTGAGGGCAGGGGG - Intronic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143326899 17:6104987-6105009 ATGGAGGAGATGATGCCGAGAGG + Intronic
1144390923 17:14792602-14792624 GTGGAGGGGATGAGAGCAGGAGG + Intergenic
1144572423 17:16407952-16407974 GTGGAGGAGTTGAAGGCTGGAGG + Intergenic
1144573752 17:16416337-16416359 AGGGTGGAGAAGGGGGCAGGGGG - Intronic
1144872065 17:18377820-18377842 AAGGAGGGCAGGAGGGCAGGTGG - Exonic
1145737787 17:27245189-27245211 ATGGAGAAGAGGAGGAAAGGAGG + Intergenic
1145904627 17:28509370-28509392 AGTGAGGAGATGAGGTAAGGAGG - Intronic
1145970013 17:28951016-28951038 AGGGGGGAGGTGAGGGGAGGGGG + Exonic
1146100382 17:29974946-29974968 TTTGAGAAGGTGAGGGCAGGAGG + Intronic
1146187184 17:30731719-30731741 CAGGAGGAGAGGAGGGAAGGAGG - Intergenic
1146273096 17:31497454-31497476 ACGGAGGAGTTCTGGGCAGGGGG + Intronic
1146332219 17:31937080-31937102 GAGGAGGAGAGGAGGGAAGGAGG - Exonic
1146484820 17:33234483-33234505 ATGAAGGAGATGAGTGCCTGTGG - Intronic
1146551344 17:33782860-33782882 GAGGAGGAGATAAGGTCAGGGGG - Intronic
1146829656 17:36057687-36057709 AGGGAGGACATGATGGCAGGAGG - Intergenic
1147209878 17:38866748-38866770 TTTGTGGAGATGGGGGCAGGTGG - Intergenic
1147247650 17:39132716-39132738 ATGGAGGAGCTGAGTCAAGGGGG + Intronic
1147458183 17:40551717-40551739 ATGAGGGAGATGAGGGCCTGGGG + Intergenic
1147546258 17:41404260-41404282 ACAAAGGAGATGAGGGCAGCTGG + Intergenic
1147635716 17:41962631-41962653 ATGGAGGACATGGAGGCAGAGGG + Intronic
1148019005 17:44541511-44541533 ATTTAGGAGAAGAGTGCAGGTGG - Intergenic
1148053187 17:44779290-44779312 ATGGAGGAGACAAGGACAGCGGG - Intronic
1148074256 17:44926503-44926525 AGGGAGGAAAGGAGGGAAGGTGG + Intronic
1148338703 17:46860234-46860256 AAGGAGGAGAGGAGGGAAGCGGG + Intronic
1148342480 17:46881584-46881606 AAGGCTCAGATGAGGGCAGGAGG - Intronic
1148353104 17:46955673-46955695 CTGGAGGAGGTGAGTGCAGAAGG - Intronic
1148382065 17:47207081-47207103 AGGCAGAAGATGAGGGGAGGAGG + Intronic
1148710519 17:49677686-49677708 ATGGGGGGGCTGAAGGCAGGGGG + Intronic
1148789589 17:50165973-50165995 AGGGAGGAGAGGAGGGAAGGAGG - Intronic
1148935836 17:51164192-51164214 ATGGGGGAGAAGAGGGTAGTTGG + Intronic
1149578028 17:57727684-57727706 AGGGAGGAGGGAAGGGCAGGAGG + Intergenic
1150828615 17:68498612-68498634 CTGCAGGAGATAAGGGCATGGGG - Intergenic
1150964180 17:69948495-69948517 AAGGAGGAGGAGAGGGGAGGGGG + Intergenic
1151030955 17:70738602-70738624 ATGAAGAAGATGAGGGAATGGGG - Intergenic
1151129878 17:71885813-71885835 CTGGAAGAAATGAAGGCAGGTGG + Intergenic
1151345831 17:73500651-73500673 ATGGAGGAGATGGAGTGAGGAGG - Intronic
1151698011 17:75727872-75727894 GTGGAGGACAGCAGGGCAGGAGG + Intronic
1151801489 17:76382349-76382371 TTGGAGGTGAGGGGGGCAGGGGG + Intronic
1151827223 17:76530179-76530201 AAGGAGGAGAGGAGCGGAGGCGG - Intronic
1151852191 17:76697649-76697671 ATGGAGGAGGTGGAGGCGGGAGG + Intronic
1151896054 17:76981692-76981714 CTGGAGGAGCTCAGGGCTGGTGG - Intergenic
1152048372 17:77953836-77953858 AGGGAGGAGGTGATGGCAGGGGG - Intergenic
1152336216 17:79701317-79701339 AGGGAGGAGAGGAGCACAGGTGG + Intergenic
1152532545 17:80927826-80927848 ATGGAGGAGATGAGGGCAGGCGG - Intronic
1152796536 17:82310379-82310401 ATGGAGGAGATGAGGAGGGGAGG + Intergenic
1153721021 18:7903230-7903252 AAGGAAGAGAGGATGGCAGGTGG + Intronic
1153821709 18:8837665-8837687 ATGGATGTGATAATGGCAGGAGG - Intergenic
1153827909 18:8893670-8893692 CTGGAGGAGAGGAGGGAAGGGGG + Intergenic
1155053158 18:22165454-22165476 ATGGATGAGGGGAGGGCTGGAGG + Intergenic
1155316025 18:24570913-24570935 CTGGAGGTGATGAGGTCATGGGG + Intergenic
1156161204 18:34360348-34360370 AGTGAGGAGATGATGGCTGGAGG - Intergenic
1156384792 18:36595283-36595305 ATGGAGGAGAGGAAGGGAGAAGG - Intronic
1156920016 18:42510645-42510667 AAGGAGAAAATGAGGGAAGGAGG - Intergenic
1157267362 18:46238192-46238214 GTGGAGAATATGAGGGCAAGAGG + Intronic
1157475279 18:48020130-48020152 ATGGAGGAGGGGTGGGCTGGAGG - Intergenic
1157617055 18:48993184-48993206 AGGGAAAAGATGAGGGCAGATGG - Intergenic
1157723669 18:49945740-49945762 GTGGAGGGGAGGAGGGGAGGAGG + Intronic
1157793849 18:50557822-50557844 CTGGAGGATATGGGGGCAAGGGG - Intergenic
1157880642 18:51318105-51318127 ATGGAGGAGATGTGGGTAGGTGG - Intergenic
1158015800 18:52782433-52782455 ATGTAGGAGATGAGAGGATGGGG - Intronic
1158381558 18:56935873-56935895 ATGGTGGTGATGAAGGCGGGTGG - Exonic
1158675236 18:59512504-59512526 ATGGATGAGTTGAGGGCAGTGGG - Intronic
1158887094 18:61838882-61838904 AAGGAGGATGAGAGGGCAGGTGG - Intronic
1159136914 18:64347509-64347531 AGAAAGGAGCTGAGGGCAGGAGG - Intergenic
1159357648 18:67358169-67358191 AGGGGGGAGAGGAGGGGAGGGGG + Intergenic
1159566574 18:70057762-70057784 CTGGAGGTGATGAAGGCAGCAGG + Exonic
1160462189 18:79047646-79047668 AAGGAGAAGATGAGGACTGGAGG + Intergenic
1160624037 18:80190706-80190728 TTTGAGGAGTGGAGGGCAGGCGG + Intronic
1160636417 19:78421-78443 GTGGCTGAGATGAGGACAGGAGG + Intergenic
1160971262 19:1768788-1768810 ATGGAGGAGGTGTGGGGAGGTGG + Intronic
1161022221 19:2015745-2015767 AGGGAGGGGAGGAGGGAAGGAGG + Intronic
1161141653 19:2651436-2651458 AGGGAGGAAAGGAAGGCAGGAGG - Intronic
1161151624 19:2713131-2713153 ATGGAGGAGGTGATGGGTGGAGG - Intergenic
1161329093 19:3677968-3677990 ATGGAGGAATAGAGGGAAGGAGG + Intronic
1161500813 19:4614433-4614455 AGGATGGAGATGAGGACAGGGGG + Intergenic
1161877623 19:6924147-6924169 ATGGAGGAGTTGAAGTCAGGGGG + Intronic
1162570089 19:11466535-11466557 ACAGAGGTGATGGGGGCAGGTGG - Intronic
1162627401 19:11895629-11895651 ATGGAGGAAATGGGAGGAGGTGG + Intronic
1163061271 19:14763924-14763946 CAGGAGGAGAGGAGGGGAGGAGG - Intronic
1163124149 19:15235451-15235473 AGCGGGGAGATGAGGGCGGGGGG - Intergenic
1163161154 19:15464656-15464678 AGGGAGGAGAAGAGAGGAGGTGG + Intergenic
1163228172 19:15979621-15979643 AGGCAGGGGATCAGGGCAGGGGG - Intergenic
1163465819 19:17468039-17468061 AAGGAGGAGAGGAGGGGAGGAGG + Intergenic
1164742205 19:30584145-30584167 ATGATGGATAGGAGGGCAGGAGG - Intronic
1164835501 19:31352770-31352792 ATGGGGGAGTTGAAGGCAAGAGG - Intergenic
1165258093 19:34592132-34592154 CTGGAGGAGATGACGGCTGAGGG + Intergenic
1165598254 19:37030094-37030116 AGGGAGGAAATGAGGACACGTGG - Intronic
1165778971 19:38421084-38421106 CTGGAGGATATGAGGTCAGCAGG + Exonic
1166020699 19:40026047-40026069 ATGGAGGGGATGAAGGTAGTGGG - Intergenic
1166024136 19:40064661-40064683 ATGGAGGGGATGAAGGCAGTGGG - Intergenic
1166041463 19:40205288-40205310 AAGGAGAAGGTGAAGGCAGGGGG + Exonic
1166088746 19:40494303-40494325 AAGGAGGAAAGGAGGGAAGGAGG - Intronic
1166299764 19:41907075-41907097 ATGTAGGAGAAGAGGGGAGACGG - Intronic
1166347780 19:42177049-42177071 AGGGAGGAAGGGAGGGCAGGCGG + Intronic
1166568376 19:43778869-43778891 ATGGAGGTGGTGAGGGGCGGTGG + Intronic
1166815317 19:45541247-45541269 ACACAGGAGGTGAGGGCAGGGGG + Intronic
1166860038 19:45804763-45804785 GTGGAGGAGATGACGGAAGGTGG - Exonic
1166924332 19:46256115-46256137 ACTCAGGAGATGAAGGCAGGAGG + Intergenic
1166971669 19:46572849-46572871 AAGGATGAGAGGAGGACAGGAGG + Intronic
1166981848 19:46635737-46635759 ATGGAGGAGATGGAGGGAGGGGG + Intergenic
1167095375 19:47372617-47372639 ATGGAGGGGGTGGGAGCAGGAGG + Intronic
1167242309 19:48351588-48351610 AGAGAGGAGGTGAGGGCAGAGGG - Intronic
1167322427 19:48805462-48805484 ATGGAGGAGCTGAGGGGCTGGGG - Intronic
1167644220 19:50697057-50697079 AGGGAGGGGATGGGGTCAGGAGG - Intronic
1168095084 19:54109917-54109939 AAGCCGGAGATGAGGGCCGGGGG - Intronic
1168095294 19:54111008-54111030 ATGCTGGAGGTTAGGGCAGGAGG + Intronic
1168294514 19:55372381-55372403 AGGCAGGAGAGGAGTGCAGGGGG + Intergenic
1168323875 19:55528137-55528159 ATGGCAGAGCTGTGGGCAGGAGG - Intergenic
1168325587 19:55537040-55537062 TTGGAGGAGGTGAGGTCTGGAGG - Exonic
1168345989 19:55650449-55650471 AAGGCTGAGATGAGGGTAGGTGG - Intronic
1168389366 19:55993492-55993514 AGGGGGGAGAGGAGGGGAGGGGG - Intergenic
1168720139 19:58550298-58550320 ATGGAGAGGCTGTGGGCAGGGGG + Intronic
925462540 2:4075802-4075824 AAGAAGGAGATGAGAGGAGGAGG - Intergenic
925686874 2:6481995-6482017 GTGGAGGAGCTGTGGGCAGTGGG - Intergenic
926010035 2:9400253-9400275 AAGGAGAGGAAGAGGGCAGGAGG - Intronic
926236820 2:11051854-11051876 GTGGAGGAGATGAGGGGAGGAGG + Intergenic
926295871 2:11568007-11568029 TTGGAGGAAATCTGGGCAGGAGG + Intronic
926660672 2:15462612-15462634 GTGGAGGAGGTGAGGGAGGGAGG + Intronic
927713628 2:25340328-25340350 ACGGAGGGGATGAGGAGAGGGGG + Intronic
927885875 2:26718181-26718203 CTGTGGGAGATGGGGGCAGGTGG - Intronic
928143320 2:28749850-28749872 ATGGAAGAGATTTGGGCAAGTGG + Intergenic
928164794 2:28962812-28962834 AGGGAGGAAAGGAGGGAAGGAGG - Intronic
928217121 2:29371070-29371092 ATGTTGGAGCTGAGGGAAGGAGG + Intronic
928330964 2:30357557-30357579 ATGGGAGACAGGAGGGCAGGGGG + Intergenic
929423441 2:41818938-41818960 GAGGAGGAGAGGAGGGGAGGAGG + Intergenic
929537409 2:42792410-42792432 GGGGAGGAGGCGAGGGCAGGGGG + Intronic
929612169 2:43279067-43279089 ATGAAAGAGATGGGGGCAGATGG - Intronic
929879634 2:45824589-45824611 AGGGAGGAAATGAGGGAGGGAGG - Intronic
929884072 2:45863015-45863037 CTGGAGGAGAAGAGAGCAGTTGG + Intronic
930238434 2:48910134-48910156 GTGGAGGAGGTGGGGACAGGTGG - Intergenic
930257247 2:49106396-49106418 ATAGAGGATATGAGTGCATGGGG + Intronic
930739386 2:54814455-54814477 AGGGAGGAGATGAATGCAGCCGG - Intronic
931360698 2:61575346-61575368 AAGGAAGAGATGAAGGCAGAAGG - Intergenic
932223986 2:70024606-70024628 AGTGAGGAGAGGAGGGAAGGAGG - Intergenic
933234480 2:79850156-79850178 ATGGAGGAAGGGAGGGTAGGAGG - Intronic
933689543 2:85168998-85169020 ATGGAGGAAATAGAGGCAGGAGG - Intronic
933840562 2:86282921-86282943 GTGGAGAGAATGAGGGCAGGTGG - Intronic
933860421 2:86461288-86461310 ATGGAGGAACAGAGGGAAGGAGG - Intronic
934522206 2:95026494-95026516 GTGGAGGAGATGGGGGGTGGGGG + Intronic
934757232 2:96832696-96832718 CTGGAGGGGATGGGGGCAGGCGG - Exonic
935101326 2:99998482-99998504 ATGGGGGAGAGGTGGGCAGAGGG + Intronic
936100233 2:109571087-109571109 AAGGAGGAGGAGAGTGCAGGGGG - Intronic
936246006 2:110827764-110827786 GGGGAGGAGAGGAGGGCAAGGGG + Intronic
936565064 2:113576629-113576651 GTGGCTGAGATGAGGACAGGAGG - Intergenic
936626126 2:114151349-114151371 TTGGAGAAGATGGGGGCAAGGGG - Intergenic
936828309 2:116608528-116608550 ATGGAGGAGAGGAGGGCTATAGG + Intergenic
937250250 2:120519348-120519370 ATGAAGGAGGAGAGGGAAGGAGG - Intergenic
937814047 2:126231620-126231642 ATGGAGGAGGAGATGGAAGGAGG - Intergenic
938047546 2:128136041-128136063 AGGGACGAGAAGAGGGCATGTGG + Intronic
938673889 2:133611268-133611290 ATGGAGGAGGTGGTGGCGGGTGG - Intergenic
939240454 2:139552200-139552222 ATGGAGGAGGTCAAGGAAGGAGG - Intergenic
939639099 2:144617889-144617911 ATGGAGGATACGTGGGAAGGGGG - Intergenic
940951968 2:159685876-159685898 AGGAAGGAGTTGAGGTCAGGGGG - Intergenic
941125498 2:161579135-161579157 ATGGGGTAGTTGAGGGGAGGAGG + Intronic
941822034 2:169853227-169853249 ATGGAGAAGAGCTGGGCAGGAGG + Intronic
942113060 2:172701015-172701037 AGGGAGGAGAGGAGGAGAGGAGG + Intergenic
942119123 2:172759394-172759416 ATGGAGGTGCAGAGGGCAAGGGG + Intronic
942649210 2:178149343-178149365 GTGGAGGGGACGAGGCCAGGAGG + Intergenic
942675146 2:178418567-178418589 CTGTAGGAGATTGGGGCAGGAGG - Intergenic
943900140 2:193423343-193423365 TTCAAGGAGATGAGAGCAGGGGG + Intergenic
944037590 2:195314430-195314452 ATGAAGGAGAGGTGGGTAGGTGG + Intergenic
945135575 2:206624192-206624214 ATGGAGGAGACAAGGGCTGAGGG + Intergenic
946080718 2:217116174-217116196 ATGGATGGGACGAGGGAAGGAGG - Intergenic
946174494 2:217914073-217914095 ATAGAAGAGAGGAGGGAAGGAGG - Intronic
946491833 2:220156209-220156231 ATGCAAGGGATGAGAGCAGGAGG - Intergenic
946713142 2:222526442-222526464 ATGGAGGGAAGGAGGGGAGGAGG + Intronic
947252339 2:228121914-228121936 ATGGATGCTATGAGGACAGGTGG + Intronic
947357543 2:229312536-229312558 ATGGAGAAGAGGACAGCAGGAGG - Intergenic
947383137 2:229564216-229564238 ATGATGGAGATGAGGTGAGGAGG - Intronic
947655339 2:231821882-231821904 ATGGAGGGGGTGCGGGCAGGAGG - Intergenic
948300236 2:236900631-236900653 ATGGAGCAGGCAAGGGCAGGAGG - Intergenic
948458836 2:238119500-238119522 ATGGAGGAGGTGGGTGGAGGAGG + Intronic
948600720 2:239106185-239106207 GCGGAGGAGCTGAGGGCGGGCGG + Intronic
948728273 2:239947679-239947701 ATGGAGGAGCTCACGGCAGCAGG - Intronic
948878124 2:240840991-240841013 CTGGAGGAGATGAGGCCAGCTGG - Intergenic
1168819349 20:762668-762690 ATGGAGGATTTGAGGGAAGCAGG - Intronic
1168960063 20:1862895-1862917 TTGGTGGAGAGGAGGGAAGGAGG - Intergenic
1169213412 20:3779822-3779844 AAGGAGGAGGTGAGAGAAGGTGG + Intronic
1169236812 20:3936265-3936287 AGGGAGGAGAGCAGGACAGGTGG + Intronic
1169558269 20:6770745-6770767 ATGGGGAAGATGAGGGCAAAAGG + Intronic
1169719374 20:8657059-8657081 AGGGAGAAGGTGAGGGAAGGGGG + Intronic
1170066841 20:12320292-12320314 AAGGATGAGATGGGGACAGGAGG + Intergenic
1170278492 20:14619505-14619527 AAGGAGGAAAGGAGGGAAGGAGG + Intronic
1170369451 20:15632822-15632844 AAGAAGGAGAGGAGGGAAGGAGG - Intronic
1170405605 20:16032668-16032690 ATGGATGAGAAGAGGGAAGGAGG + Intronic
1170461355 20:16579606-16579628 ATGGAGGAGAGGAGGGAAGTAGG - Intergenic
1170567777 20:17616508-17616530 CTGGAGGAGTTGGGGGGAGGTGG - Intronic
1170691853 20:18623558-18623580 ATAGAGCAGATGTGGGGAGGAGG - Intronic
1170744938 20:19090963-19090985 AGGGAGGAGAGAAGGGAAGGTGG + Intergenic
1170880956 20:20296192-20296214 AGGGAGGAGAGAAGGGAAGGAGG - Intronic
1170880977 20:20296270-20296292 AGGGAAGGGATGAGGGAAGGGGG - Intronic
1170907522 20:20529088-20529110 AGGCAGGAGAGGAGGGCAGTGGG + Intronic
1171252553 20:23660369-23660391 ATGGAGGAGGGCAGGCCAGGTGG - Intergenic
1171878257 20:30598151-30598173 TAGGAGGGGAGGAGGGCAGGAGG - Intergenic
1171986808 20:31666418-31666440 GTGCAGGAGAGGAGGGCATGGGG + Intronic
1172099775 20:32478136-32478158 AGGGAGGAGATGTGGTGAGGTGG - Intronic
1172184614 20:33023588-33023610 AGGGGGGAGATGAGGGAAGAGGG - Exonic
1172211293 20:33200298-33200320 ATGGAGGAGATGAGGGCTGGTGG - Intergenic
1172596981 20:36156283-36156305 CTGGAGGAGATCAGTGCAGAGGG + Intronic
1172772976 20:37392345-37392367 ATGGAGAAGTTGAGGCCAGGAGG - Intronic
1172781754 20:37440507-37440529 ATGGAGGAGAGGCTGGCTGGAGG + Intergenic
1172908037 20:38383982-38384004 ATGCAGCAGCTGGGGGCAGGAGG - Intergenic
1173252069 20:41369083-41369105 ACAGAGGAGGTGGGGGCAGGAGG - Intergenic
1173418236 20:42877523-42877545 ATGAAAGAGAAAAGGGCAGGAGG + Intronic
1173538352 20:43832703-43832725 AGGGAGGAGGTGTGGGGAGGGGG - Intergenic
1174165486 20:48580893-48580915 ATGGAGAAAAAGAGAGCAGGAGG - Intergenic
1174216540 20:48920859-48920881 ATGGAGGAGATGAGGTGGTGTGG - Intergenic
1174830792 20:53810547-53810569 GTGAAGGAGATGAGGGTGGGAGG + Intergenic
1174838036 20:53876609-53876631 AGGGAAGGGATGAGGGGAGGTGG - Intergenic
1175479001 20:59298628-59298650 ATGAAGGTGATGATGTCAGGAGG + Intergenic
1175569752 20:60009947-60009969 ATGGGGGAGCTGGGGGCAGGGGG - Intronic
1175711146 20:61222056-61222078 ATGGGGAAGAGGAAGGCAGGAGG + Intergenic
1175920622 20:62449076-62449098 AGGGAGGTGAGTAGGGCAGGAGG - Intergenic
1176052977 20:63130306-63130328 GGGGAGGAGAGGAGGGGAGGAGG - Intergenic
1176093387 20:63328817-63328839 AAGGAGGACAGGAGGGCGGGAGG - Intronic
1176107819 20:63397867-63397889 ACGGAGGAGCAGAGGGCAGCTGG - Intergenic
1176142337 20:63550213-63550235 AGGGAGGAGGTGAGGTCATGTGG - Intronic
1177012238 21:15743533-15743555 AATGAGGAGATGTGGGCTGGAGG + Intronic
1177047055 21:16183834-16183856 AGAGGGGAGAGGAGGGCAGGGGG - Intergenic
1177638573 21:23817178-23817200 AGGGAGGAGAGGATGGGAGGAGG - Intergenic
1178258521 21:31077323-31077345 AAGAAGGGCATGAGGGCAGGTGG - Intergenic
1178407580 21:32337220-32337242 AGGGAGGGTATGAGGGCAGGTGG - Intronic
1178636546 21:34308695-34308717 GTGCACGAGATGAGGGCAGTGGG - Intergenic
1179273486 21:39869555-39869577 GAGGGGGAGAAGAGGGCAGGAGG - Intronic
1179564725 21:42240095-42240117 AGGCAGGAGAGGAGGGCAGGTGG + Intronic
1179637282 21:42721188-42721210 AAGGAAGAGAGGAGGGCAGGGGG + Intronic
1179933861 21:44590606-44590628 GTGGAGGAGATGAGGGCTGCAGG + Intronic
1179941032 21:44638934-44638956 GTGGAGGAGATGAGGGCTGCAGG - Intronic
1179963976 21:44789819-44789841 TGGGAGGAGATTAGGTCAGGAGG + Intronic
1180079683 21:45480966-45480988 CTAGAGGAGATGAGGTGAGGAGG - Intronic
1180180640 21:46117377-46117399 CTGAAGGAGAAGGGGGCAGGAGG - Intronic
1180564162 22:16649025-16649047 ATGGGGGAGGGGAGGGGAGGGGG + Intergenic
1180641606 22:17303744-17303766 GTGGAGGTGATGAGGGAAGCTGG + Intergenic
1180783536 22:18534814-18534836 TGGGAGGAGATGGGTGCAGGGGG - Intergenic
1180883481 22:19223303-19223325 TTGGAGGAAATGAGGTCATGTGG - Intronic
1181127103 22:20708865-20708887 TGGGAGGAGATGGGTGCAGGGGG - Intronic
1181151160 22:20884437-20884459 CTGCAGGTGATGAGGGCAGAAGG - Intronic
1181240438 22:21474166-21474188 TGGGAGGAGATGGGTGCAGGGGG - Intergenic
1181630238 22:24147316-24147338 AGGGAGGAGAGGAGGGAGGGAGG - Intronic
1181966047 22:26657404-26657426 AGGGTGGAGGTGAGGGCCGGGGG + Intergenic
1182045185 22:27268624-27268646 CTGCAGGAGATGAGGCCATGAGG - Intergenic
1182711857 22:32328170-32328192 ATGGGGGAACTGAGGGCAGAAGG - Intergenic
1183315062 22:37132473-37132495 ACAGAGGAGAGGAGGGAAGGAGG + Intronic
1183404467 22:37623681-37623703 CTGGGGGAGGTGGGGGCAGGAGG - Intronic
1183601749 22:38844044-38844066 GAGGAGGAGAAGACGGCAGGCGG + Intergenic
1183653431 22:39171790-39171812 ATGGAGGATAGAGGGGCAGGAGG + Intergenic
1184059741 22:42074542-42074564 TTGGAGGAGAGGCGGGCTGGGGG - Intronic
1184089348 22:42284099-42284121 ATGGAGGAGCAGCGGGGAGGAGG + Intronic
1184266879 22:43352321-43352343 ATGGAGGGGAGCAGAGCAGGGGG + Intergenic
1184326920 22:43795453-43795475 AGAGGGGAGATGTGGGCAGGAGG - Intronic
1184610987 22:45602964-45602986 CTGGAGCAGAAGAGGGCAGGAGG + Intergenic
1185072657 22:48665929-48665951 ATGGGGGCGTTGGGGGCAGGTGG - Intronic
1185074059 22:48673711-48673733 ATGTAGGAGGTGAGGGAGGGTGG + Intronic
1185232956 22:49693827-49693849 ATGGAGGAGATGGGGAGATGGGG - Intergenic
949434419 3:4013060-4013082 ATGGAGGTGGGGAGGGGAGGTGG + Intronic
949483218 3:4513304-4513326 AGGAAGGAGATGGGGGGAGGAGG - Intronic
949578010 3:5357785-5357807 ATTGCAGAGATGAAGGCAGGAGG - Intergenic
949670042 3:6389032-6389054 AGGAAGGAGATGAGTGGAGGAGG + Intergenic
949815398 3:8052927-8052949 ATGGAAGGCATGGGGGCAGGCGG - Intergenic
949975142 3:9449705-9449727 ATGGAGGGGAGGAGGGCAATAGG + Intronic
950026801 3:9825734-9825756 ATGCAGGTGGAGAGGGCAGGGGG - Intronic
950350793 3:12349971-12349993 TTTGAGGACATGAGGACAGGTGG + Intronic
950461488 3:13124901-13124923 ACGGAGGTGGTGAGGGCGGGTGG - Intergenic
950552504 3:13675281-13675303 ACTGAGGTGATGAGGGGAGGAGG - Intergenic
951170714 3:19539019-19539041 AAGAAGGAGATGAGGGGAGGAGG - Intergenic
952344481 3:32471052-32471074 AAGGAGGAGAGGAGGAGAGGAGG + Intronic
953497057 3:43396775-43396797 ATTCAGGAGGTGAAGGCAGGAGG - Intronic
954001970 3:47565036-47565058 ATGAAGGAGTTGAGGGTGGGAGG - Intronic
954596776 3:51831528-51831550 AGGGAGGAGGTGAGGGCAGTAGG - Intergenic
954678261 3:52327363-52327385 AGAGAGGAGAGGAGGGGAGGTGG - Intronic
954692697 3:52404161-52404183 ATGGAGGAGATGTGGGTGGTGGG - Intronic
955178365 3:56640591-56640613 AAGGGGAAGATGATGGCAGGAGG - Intronic
955220517 3:57019423-57019445 AGGGAGGAGATGAGGAGGGGAGG + Intronic
955656144 3:61247008-61247030 ATGGAGGACAGGAGGGAGGGAGG - Intronic
955994580 3:64666901-64666923 ATTTAGGAGGTGAAGGCAGGAGG + Intronic
956790665 3:72677601-72677623 ATGGAGAAGAAGAGGCCAGCGGG - Intergenic
958450755 3:94269560-94269582 AGGGAGGAGATCAGAGCGGGTGG + Intergenic
958960434 3:100504609-100504631 AGGGAGGAGATGAAAGCGGGTGG - Intronic
959576582 3:107940750-107940772 ATGGTGGAGGTGGGGGTAGGGGG + Intergenic
959706146 3:109340596-109340618 AGGGAGGAAATGAGGGAGGGAGG - Intergenic
960291571 3:115891778-115891800 ATGGAAGAGAAGAGGGATGGTGG - Intronic
960383274 3:116990343-116990365 ATGAAGGAGATTAGAGCAAGGGG + Intronic
960417304 3:117400117-117400139 ATGCAGGAGGTCAGGGCAGAGGG + Intergenic
960463168 3:117961874-117961896 ATGAAGGTGATGGTGGCAGGAGG - Intergenic
961648579 3:128405932-128405954 ATGAAGGCACTGAGGGCAGGTGG - Intronic
961660253 3:128464859-128464881 AAGGAGGAAATGAAGGAAGGAGG - Intronic
961685144 3:128624887-128624909 GTGGAGGAGATGAGCACAGCTGG - Intronic
961796290 3:129411365-129411387 AGGGAAGAGATGAAGGAAGGAGG + Intronic
961798114 3:129424434-129424456 AAGGAGGAAGTGAGAGCAGGGGG - Intronic
962091747 3:132251595-132251617 ATGGAGCAAATGAAGGGAGGGGG + Intronic
962241902 3:133757016-133757038 CTGGAGGGGAGGATGGCAGGTGG - Intronic
962372356 3:134831238-134831260 CTGGAGCAGAGGAGGGCAGCTGG + Intronic
962518995 3:136180735-136180757 GAGGAGGAGAGGAGGGAAGGAGG + Intronic
962613554 3:137102285-137102307 TTGTGGGAGATGAGGGAAGGAGG - Intergenic
962940977 3:140124622-140124644 ATGGAGAAGATTGGGCCAGGAGG + Intronic
962976539 3:140451000-140451022 ATGGAGGAGAGGACTGGAGGTGG - Intronic
963119538 3:141764552-141764574 TTTGAGGAGGTGAGGGCAGTGGG - Intergenic
963252309 3:143114762-143114784 AAGGAGGAGGTGGTGGCAGGGGG - Intergenic
963809821 3:149764603-149764625 AGGGAGGAGAGGAGGGAGGGAGG - Intronic
964308901 3:155371280-155371302 CTGGATGAGATTATGGCAGGGGG - Intergenic
964420269 3:156495020-156495042 GTTGAGGAGTTGAGGGTAGGAGG - Intronic
964683658 3:159370218-159370240 ATCGGGGAGATGAGAGGAGGAGG - Intronic
965083881 3:164069447-164069469 AAGGAGGGAAAGAGGGCAGGAGG + Intergenic
965230414 3:166043841-166043863 ATGGAGGAAAAGAAGGCAGTTGG + Intergenic
965569933 3:170162144-170162166 ATGGAAGAGATGAGGGACTGGGG - Intronic
965754951 3:172016248-172016270 ATGGTGGGGAGGGGGGCAGGGGG - Intergenic
965939474 3:174160915-174160937 GTAGAGGGGTTGAGGGCAGGAGG - Intronic
966222281 3:177562764-177562786 ATGTAGAAGATGAGGGAGGGGGG + Intergenic
966877803 3:184333337-184333359 AAAGAAGAGATCAGGGCAGGAGG + Intronic
967124973 3:186415152-186415174 AAGGAGGAAATGAAGCCAGGAGG - Intergenic
967268182 3:187710177-187710199 AATCAGGAGTTGAGGGCAGGAGG - Intronic
967527818 3:190514544-190514566 AAGGAGGAGATGGGGGCGGGGGG - Intronic
967726729 3:192869283-192869305 AAGGAGGGGAGGAGGGGAGGAGG + Intronic
968364003 3:198171460-198171482 ATGCAGGGGATGAGGTGAGGAGG - Intergenic
968533935 4:1112593-1112615 CTGGGGGAGAAGCGGGCAGGCGG - Intronic
968952033 4:3700278-3700300 GTGGAGGGGAGGAGGGGAGGGGG + Intergenic
969371495 4:6734129-6734151 AAGGAGGGGATGAGGGGAGGAGG + Intergenic
969423057 4:7108412-7108434 ATGTCGGGGAGGAGGGCAGGGGG - Intergenic
970870395 4:20810431-20810453 ATGGAAGAGTACAGGGCAGGGGG + Intronic
971073366 4:23120446-23120468 GTGGAGGGGATGAGGGTGGGTGG + Intergenic
972127594 4:35789147-35789169 AGGGAAGAGAAGAGGGTAGGAGG + Intergenic
972351942 4:38244228-38244250 AGGGAGGGCAGGAGGGCAGGAGG - Intergenic
972351945 4:38244236-38244258 GTGGAGGAAGGGAGGGCAGGAGG - Intergenic
973011998 4:45087728-45087750 ATGTAGGAGGTAAGGGCTGGTGG + Intergenic
973291712 4:48477549-48477571 AGGGAGGAGCTGAGGGGAAGTGG - Intergenic
973596048 4:52490798-52490820 AGGGAGGGGAGGAGGGAAGGAGG + Intergenic
973897067 4:55423836-55423858 AAGGAGGTCATGAGGGTAGGTGG - Intronic
974021925 4:56699100-56699122 GGGAAGGAGATGATGGCAGGAGG + Intergenic
974293722 4:59967567-59967589 AGGGAGGAAACGAGGGAAGGAGG + Intergenic
975910939 4:79266091-79266113 AGTGGGGATATGAGGGCAGGTGG - Intronic
976068392 4:81215244-81215266 AGGGAAGAGAGGAGGGAAGGAGG + Intergenic
976245513 4:83002438-83002460 AGGGAGGAGGGGAGGGAAGGAGG + Intronic
976838545 4:89404285-89404307 CTGAAAGACATGAGGGCAGGAGG - Intergenic
977566178 4:98583053-98583075 GTTGAGGGGATGAGGGTAGGAGG - Intronic
977655213 4:99513649-99513671 AGGGAGGGAATGAGGGCAGGAGG - Intronic
977997989 4:103517676-103517698 AGGCAGGAGAGGAGGGAAGGAGG - Intergenic
978294348 4:107186284-107186306 ATGATGGAGATGAGGGCTGCTGG + Intronic
979453077 4:120895556-120895578 ATGAAGAAGATGAGGGCAGAGGG - Intronic
979905594 4:126286653-126286675 ATGGAGAAGATTAGGGCATTTGG - Intergenic
979994316 4:127412148-127412170 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
980463769 4:133149442-133149464 ACGGTGGAGATGAGGACAGAGGG + Exonic
980464330 4:133152792-133152814 ATGGAGGAGATGAGAGATGGTGG - Intronic
982283978 4:153715439-153715461 ATGGAGGAGATGGGGACAGGAGG + Intronic
982558625 4:156900878-156900900 AGGGAGGAAAGGAGGGAAGGAGG + Intronic
983152491 4:164301958-164301980 GTGGAGGAGATAAGAGCAGAGGG + Intronic
983155051 4:164336990-164337012 AAGGAAGAGAGGAGGGAAGGAGG + Intronic
983379635 4:166975638-166975660 AAGTAGGAGATGAGGGCAGTGGG - Intronic
983564614 4:169136382-169136404 CTGGAGCTGATGAGGACAGGGGG + Exonic
983734048 4:171035324-171035346 ATGGTGGCGATGAGGCCAGATGG + Intergenic
983846520 4:172526835-172526857 ATGGATAAGGTCAGGGCAGGGGG - Intronic
984717272 4:182937499-182937521 CTGCAGGACACGAGGGCAGGAGG - Intergenic
984785768 4:183566044-183566066 ATGGAGGAAATGAGGGAAGGAGG + Intergenic
985013084 4:185604460-185604482 ATGGAGGGGAGGAAAGCAGGTGG + Intronic
985511896 5:318071-318093 AGGGGGGAGATGAAGGGAGGGGG - Intronic
985663627 5:1169863-1169885 AAGGAGGGGAGGAGGGAAGGAGG + Intergenic
985747682 5:1656393-1656415 ATGGAGGAGCTGAGGGCATCGGG - Intergenic
985866676 5:2519552-2519574 AGGGAGGAGAGGAGGGCAGAGGG - Intergenic
986152458 5:5140213-5140235 GGGGAGGAGGTGAGGGCGGGGGG - Intergenic
986176988 5:5360784-5360806 CTGGAGAATATGAGGACAGGAGG + Intergenic
986264502 5:6180832-6180854 ATGGAGGGGAGGAGGGGAGGAGG - Intergenic
986342513 5:6803001-6803023 ATGGAGGAGAAGAAGACAGTTGG + Intergenic
986681082 5:10233253-10233275 GTGGAGGCCATGAGGGGAGGGGG - Intronic
988545678 5:32155427-32155449 TTGGAGGAGACCAAGGCAGGAGG - Intronic
988680691 5:33481189-33481211 GGGGAGGGGATGAGGGGAGGGGG - Intergenic
988711937 5:33787716-33787738 ATTGAGGAGGTGGGGGCAGTGGG - Intronic
990551892 5:56889844-56889866 CTGGAGGAGGTTATGGCAGGTGG - Intronic
990570774 5:57075996-57076018 ACTGAGGAGATCAAGGCAGGAGG + Intergenic
991012525 5:61898959-61898981 ATGGAGGAAATGAAGGTAGAGGG + Intergenic
991031552 5:62087134-62087156 ATGGAGGAGGTGGGGGAAAGAGG - Intergenic
991036669 5:62134485-62134507 TGGGAGGTGATGAGGTCAGGAGG - Intergenic
992787074 5:80180641-80180663 ATGCAGGAAAAGGGGGCAGGTGG + Intronic
992787523 5:80184241-80184263 ATGGAGTAGAAGAGAGAAGGTGG - Intronic
992904993 5:81337233-81337255 TCAGAGGAGCTGAGGGCAGGTGG + Intronic
993042216 5:82827089-82827111 CTGGAGGAGAGGAGAACAGGAGG + Intergenic
993174502 5:84466163-84466185 ATGGAGCAGATAAAGGAAGGTGG + Intergenic
993536979 5:89098630-89098652 AGGGAGGAAAGGAGGGAAGGAGG - Intergenic
994157227 5:96517531-96517553 ATAGAGGAGATTTGGGAAGGAGG + Intergenic
994168071 5:96628849-96628871 ATAGAGGACATGAGGGGCGGGGG + Intronic
994546850 5:101177502-101177524 ATGGTGGAGATGGGGCCTGGTGG + Intergenic
994558046 5:101330325-101330347 ATGGATGAGAGGAGGTCAGTTGG + Intergenic
994596412 5:101843259-101843281 AGGGAGGAAAGGAGGGAAGGAGG + Intergenic
994918992 5:106017717-106017739 AGGGAAGAGAAGAGGGAAGGAGG - Intergenic
995040918 5:107587240-107587262 AAGGAGGAGACAAGGACAGGAGG - Intronic
995679537 5:114701502-114701524 ATGGGGTAGAAGAGGGAAGGTGG - Intergenic
995876592 5:116796726-116796748 ATGTAGGAGCGGAGGGCAAGTGG - Intergenic
996231700 5:121071412-121071434 AGGCAGGAGGTGAAGGCAGGAGG + Intergenic
996759421 5:126972338-126972360 ATGGAAGAGATAATGGCAAGAGG + Intronic
997124230 5:131209767-131209789 TTCCAAGAGATGAGGGCAGGGGG + Intergenic
997171896 5:131730164-131730186 ATGGAATAGAAGAAGGCAGGGGG + Intronic
997578774 5:135004469-135004491 AGGGATGAGAGGAAGGCAGGTGG + Intronic
998071272 5:139199681-139199703 GTGGGGGATCTGAGGGCAGGAGG - Intronic
998499657 5:142621387-142621409 GTGGAGGAAAGGAGGGAAGGAGG - Intronic
998512507 5:142725087-142725109 GGGGAGGAGATGAGGTCAGGAGG + Intergenic
999467592 5:151822404-151822426 AAGGAGGGGGTAAGGGCAGGGGG - Intergenic
1000193754 5:158938340-158938362 CTGGAGCAGAGGAGGGGAGGAGG - Intronic
1000441726 5:161271643-161271665 ATGGAGGGGGTGGAGGCAGGAGG + Intergenic
1000581543 5:163040579-163040601 ATGAAGGGGATTAGGGAAGGTGG + Intergenic
1000706437 5:164518931-164518953 ATGGAGGAGGAGAGGCAAGGAGG + Intergenic
1000828045 5:166070538-166070560 TTGGAGGAGGTGAGGGTAGATGG - Intergenic
1000984866 5:167855764-167855786 AGGGAGGGAATGAGGGAAGGAGG + Intronic
1001182563 5:169534162-169534184 TTGGATGAGATGAGAACAGGAGG + Intergenic
1001234773 5:170020160-170020182 ATGGTGGAGAAGAGGTAAGGCGG - Intronic
1001514334 5:172344948-172344970 ATGGAGGAAAGGAAGGAAGGAGG + Intronic
1001692709 5:173644695-173644717 ATGGAGGGGAGGAGGGCTGGAGG - Intergenic
1001857071 5:175022168-175022190 GTGGAGGAGATGAGGCCAGATGG + Intergenic
1002320886 5:178375257-178375279 CTGGGGGAGAGGAGGGGAGGTGG + Intronic
1002322249 5:178382925-178382947 GGGGAGGAGCTGAGGACAGGAGG + Intronic
1002340993 5:178516480-178516502 ATGCCGGAGAGGAGGGGAGGAGG - Intronic
1002363524 5:178692773-178692795 AAGGAGGGGCTGAGGGCGGGAGG + Intergenic
1002666732 5:180830982-180831004 ACGAAGGGGAGGAGGGCAGGAGG - Intergenic
1002852686 6:1010553-1010575 AGGGAGGAAATGAGGGAAGAAGG - Intergenic
1002917665 6:1542038-1542060 AGGGAGGAGGGGAGGGAAGGAGG + Intergenic
1002917714 6:1542182-1542204 AGGGAGGAGGGGAGGGAAGGAGG + Intergenic
1003007084 6:2392203-2392225 ATGCAGGAAAGGAGGGCAGGAGG + Intergenic
1003157135 6:3606526-3606548 GTGGGGGCGCTGAGGGCAGGGGG + Intergenic
1003578543 6:7318773-7318795 ATGGAGAATGTGGGGGCAGGAGG - Intronic
1003975165 6:11336078-11336100 CTGAGGGAGGTGAGGGCAGGAGG - Intronic
1005018948 6:21399547-21399569 AGGGAGGAGGGGAGGGGAGGGGG + Intergenic
1005089752 6:22043830-22043852 ATGGAGGAGGGGAGGCCTGGGGG + Intergenic
1005864653 6:29928332-29928354 AGGCAGGAGATGAGTGGAGGGGG + Intergenic
1005944564 6:30585950-30585972 CTGAAGGAGCTGAAGGCAGGCGG + Exonic
1006303722 6:33207246-33207268 ATGGGGGGGATTAGGGGAGGGGG + Intergenic
1006392932 6:33769488-33769510 AGGCAAGGGATGAGGGCAGGTGG - Intergenic
1006418489 6:33919169-33919191 CTGGAGGAGATGTGAGCAGAAGG - Intergenic
1006435909 6:34026243-34026265 ATGGAGGGGGTGTGAGCAGGAGG - Intronic
1006471345 6:34230875-34230897 AGGTAGGAGATGAGGTCAGAGGG + Intergenic
1006595779 6:35191886-35191908 ATGGCGGAGCTGAGGGAAGGGGG - Intergenic
1006791456 6:36703954-36703976 CCTGAAGAGATGAGGGCAGGTGG + Intronic
1006902541 6:37512487-37512509 GTGGAGGGGATGCAGGCAGGAGG - Intergenic
1006935354 6:37713480-37713502 ATGGAGGAGATGAGAGTTGGAGG - Intergenic
1007078754 6:39084363-39084385 CTGAAGGAGATGGGGGCAGAAGG + Intronic
1007238194 6:40406050-40406072 ATGGAGGGGATAAAGCCAGGAGG + Intronic
1007345770 6:41228496-41228518 ATGGAGGGAAAGAGTGCAGGGGG + Intronic
1007367560 6:41405786-41405808 ATGGTGAAGATGAGGTCATGTGG - Intergenic
1007386596 6:41524281-41524303 GAGGAGGAGAGGAGGGGAGGGGG + Intergenic
1007512759 6:42386963-42386985 ATGGTGGTGATGATGGTAGGGGG - Intronic
1007553299 6:42746433-42746455 AGGGAGGAGCTGGGGGGAGGGGG - Intergenic
1007896132 6:45361027-45361049 ACTCAGGAGATGGGGGCAGGAGG + Intronic
1008265044 6:49414623-49414645 ATGGAGGAGCTGTGGGAATGAGG + Intergenic
1008501302 6:52185670-52185692 ATGGAGAAAAGGGGGGCAGGGGG - Intergenic
1008762903 6:54875662-54875684 ACGGAGGGGAAGAGGGAAGGTGG + Intronic
1008762918 6:54875720-54875742 GTGGAGGGGAAGAGGGAAGGTGG + Intronic
1008813864 6:55539697-55539719 ATGGAAGAGTTGAGGGGGGGAGG + Intronic
1010682239 6:78810323-78810345 GTTGAGGGGATGATGGCAGGAGG - Intergenic
1011417434 6:87137303-87137325 AAGGAGGGGAGGAGGGGAGGAGG - Intergenic
1013194201 6:107831147-107831169 AAGGAAGAGATGAGGGGAGGGGG + Intergenic
1013473032 6:110482421-110482443 ATGTTGGAGGTGAGGGCTGGTGG - Intergenic
1014286719 6:119507332-119507354 CTGGAGGAGAGAAGGGAAGGAGG - Intergenic
1014799528 6:125762573-125762595 ATGGATGAATTGAGCGCAGGAGG - Intergenic
1015018487 6:128443310-128443332 AAGAAGGAGATGAGGGAAGAGGG + Intronic
1015525590 6:134173011-134173033 ATGGTGGAGAGGTGAGCAGGGGG - Exonic
1015534558 6:134254594-134254616 GTGGAGGAGATGAGTCAAGGAGG - Intronic
1015846247 6:137523682-137523704 GTGCAGGAGATGGGGGCGGGGGG - Intergenic
1016045851 6:139479647-139479669 ATGGAGGAGGGGTGGGGAGGGGG + Intergenic
1016580432 6:145623536-145623558 AAGTAGGAGATGTGGTCAGGAGG + Intronic
1016658222 6:146544362-146544384 AGGGAGGCGAGGAGGCCAGGGGG + Intronic
1016686283 6:146885980-146886002 AGGGAGGAGAGGTGGGCAGGAGG - Intergenic
1017055812 6:150434721-150434743 ATGGAGGTGGGGAGGGAAGGGGG - Intergenic
1018291197 6:162293755-162293777 AAGGACCAGATGTGGGCAGGTGG + Intronic
1018757971 6:166865920-166865942 ATGGAGAAGGGGAGGGAAGGAGG + Intronic
1018793189 6:167165623-167165645 CTGGAGGAGAGGTGAGCAGGGGG + Intronic
1018853808 6:167661652-167661674 TGGGAGGAGGTGAGGGAAGGAGG - Intergenic
1018854899 6:167668233-167668255 AGGCAGCAGATGAGGGCAGAAGG - Intergenic
1018861921 6:167717191-167717213 CTGGAGGAGATGAGCCCAGGTGG - Intergenic
1019099876 6:169620879-169620901 CTGGAGGAGCAGAGTGCAGGAGG - Intronic
1019210733 6:170402472-170402494 ACGGAGGAGATGTGAGCAGTGGG + Intronic
1019251813 7:18204-18226 ATGCAGGGGATGAGGTGAGGAGG + Intergenic
1019437300 7:1028672-1028694 ATGGGGGAGATGAGGGAAGTAGG - Intronic
1019729563 7:2622711-2622733 CAGGAGGAGATGGGGGCAGGAGG - Intergenic
1019776161 7:2913170-2913192 AGGGAAGAGAAGAGGGGAGGAGG + Intronic
1019776167 7:2913190-2913212 AGGGAAGAGAAGAGGGGAGGAGG + Intronic
1019860139 7:3650702-3650724 AAGAAGGGGATGAGGGCAAGAGG - Intronic
1019906046 7:4066180-4066202 AGGGAGGAGAAAAGGGCAGGAGG - Intronic
1020875981 7:13694189-13694211 GAGGAGGAGATGAGGGCATGGGG - Intergenic
1021216628 7:17923880-17923902 ATTGAGGATTTGAGGGCAGTGGG - Intronic
1021227586 7:18046658-18046680 AGGGAAGAGATGAAGGGAGGGGG - Intergenic
1021281654 7:18727332-18727354 AAGGAGGAGGTGATGGCAGGAGG - Intronic
1021593773 7:22293327-22293349 AGGGGAGAGCTGAGGGCAGGAGG - Intronic
1021865677 7:24954634-24954656 TTGTAGGAGATGGGGTCAGGAGG - Intronic
1022246375 7:28563880-28563902 ATGGAGTAGAGGAGGGCACCAGG - Intronic
1022267637 7:28772810-28772832 ATGCAGTAGATGAGAGAAGGAGG - Intronic
1022570503 7:31448588-31448610 AAGGAGGAAATGAAGGCAGTGGG + Intergenic
1022704460 7:32789558-32789580 AAGGAGGAGATCGGGGCTGGGGG + Intergenic
1023931133 7:44707380-44707402 ATTGAGCAGGTGAGGGCAGGTGG + Exonic
1024587849 7:50856809-50856831 ATGGCTGAGGTGTGGGCAGGGGG - Intergenic
1024897889 7:54281461-54281483 ATGGGGGAGCTGAGTGCTGGAGG - Intergenic
1024919305 7:54541709-54541731 ATGAAGGAAAAGAAGGCAGGAGG + Intergenic
1024939482 7:54747053-54747075 AAGGAGGAGAAGACGGGAGGAGG - Intergenic
1025945366 7:66100324-66100346 AAGGAGGAGGGGAGGGGAGGGGG + Intronic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026452013 7:70537766-70537788 AAGGAGGAAATGAAGGCAGGTGG + Intronic
1026669629 7:72377967-72377989 TTGGGGGAAATGGGGGCAGGGGG - Intronic
1026927391 7:74204035-74204057 AGGGAGGGAATGAGGGAAGGAGG + Intronic
1026972611 7:74477462-74477484 TTGGAGTAGGTCAGGGCAGGTGG + Intronic
1027056093 7:75050493-75050515 TTGAAGGAAATGAGGGCGGGGGG + Intronic
1027305217 7:76887746-76887768 AAGGAGGAGGTGGGGGCAGGAGG - Intergenic
1029139537 7:98400549-98400571 AGGGAGGAGGGGAGGGAAGGAGG + Intronic
1029351848 7:100018916-100018938 AAGGAGGAAATGAGTCCAGGGGG - Intronic
1029426253 7:100495808-100495830 CAGTAGGAGATGGGGGCAGGGGG + Intergenic
1029438550 7:100575305-100575327 CTGGGGGAGAGGAGAGCAGGTGG + Intronic
1029524296 7:101085698-101085720 AGGCAGGAGGAGAGGGCAGGAGG + Intronic
1029707790 7:102284919-102284941 ATGGGGGAGATGAGGGGTGCTGG - Intergenic
1030084556 7:105805453-105805475 AGTGAGTAGATGAGGGCAGTGGG - Intronic
1030650941 7:112115429-112115451 ATGGAGGAGGTGAGAACAGTAGG - Intronic
1031972161 7:128072843-128072865 TTGTAGGAGAGAAGGGCAGGTGG - Intronic
1032516376 7:132509150-132509172 CTGGAGGAGAAGAGGGAGGGAGG + Intronic
1032522624 7:132557437-132557459 ATGGAGGAAATGGCGGCAGGGGG + Intronic
1032586226 7:133149373-133149395 ATGGAGGAAAGGGTGGCAGGGGG + Intergenic
1032833030 7:135648002-135648024 AGGGAGGACAGGAGGGTAGGTGG - Intronic
1032948387 7:136878377-136878399 ATGGAGGTACTGAAGGCAGGAGG + Intronic
1033327399 7:140390881-140390903 AGGCAGGAAATGAGGACAGGAGG - Intronic
1033407012 7:141079664-141079686 ATGGAGATGGAGAGGGCAGGAGG - Intronic
1034013889 7:147560737-147560759 AGGGAGGAAATGAGGGAGGGAGG + Intronic
1034337206 7:150331237-150331259 CTAGAGCAGATGAGGGGAGGCGG - Exonic
1034505921 7:151490851-151490873 ATGGAGGCTTTGAGTGCAGGAGG - Intronic
1034679210 7:152915826-152915848 GAGGAGGAGATGAGGGGAGGGGG - Intergenic
1034842464 7:154412157-154412179 TGGGAGGTGATGAGGGCATGAGG - Intronic
1034959806 7:155358244-155358266 AAGGAGGAGCTGTGGGCAGAGGG - Exonic
1035201933 7:157273222-157273244 ATGGATGTGCTGAGGTCAGGGGG - Intergenic
1035251422 7:157599943-157599965 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035251459 7:157600071-157600093 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035251478 7:157600133-157600155 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035251510 7:157600245-157600267 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035251514 7:157600261-157600283 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035898104 8:3426988-3427010 ATGAAGGAGAGGAATGCAGGGGG + Intronic
1035992758 8:4510752-4510774 AAGGAAGAGAGGAGGGAAGGAGG - Intronic
1036416407 8:8553679-8553701 AAGGAAGAGATTAGGGCAGGTGG + Intergenic
1037587973 8:20290992-20291014 GTGGAGGAGCTGAGGGGAGAAGG - Intronic
1037691533 8:21185298-21185320 ATGGAAGAGAGGAGAGCCGGAGG + Intergenic
1037920905 8:22804814-22804836 ATGGAAGAGATGAGGTCATGAGG - Intronic
1038375067 8:27032133-27032155 ATGGAGGGGAGGAGGGCAGCAGG + Intergenic
1038914476 8:32005131-32005153 ATGGAAGAGAGGAAGGAAGGAGG + Intronic
1039076098 8:33691787-33691809 ATGTTGGAGATGAGGCCTGGTGG + Intergenic
1039391016 8:37180776-37180798 GTGGAGGGGAGCAGGGCAGGTGG + Intergenic
1039550339 8:38438874-38438896 CTTGAGGAAATGAGGGAAGGAGG - Intronic
1039880330 8:41621579-41621601 AGGGAGGGGAAGAGGCCAGGTGG + Exonic
1040464283 8:47679578-47679600 CTGGAGGGGATGGAGGCAGGCGG - Intronic
1040464295 8:47679621-47679643 CTGGAGGGGATGGAGGCAGGCGG - Intronic
1041497964 8:58507818-58507840 ATGAAGCAGAAGAGGGCAGTGGG - Intergenic
1041578121 8:59423063-59423085 ATGTATGAGCAGAGGGCAGGGGG - Intergenic
1041789018 8:61670683-61670705 AGAGAGGTGATGAGGTCAGGAGG + Intronic
1042174675 8:66027273-66027295 ATGGAAGAGGTGAGGAGAGGAGG - Intronic
1042960114 8:74294239-74294261 GAGCAGGAGCTGAGGGCAGGTGG - Intronic
1044557483 8:93579319-93579341 ATGGATTAGATGAGGACATGGGG + Intergenic
1044825841 8:96195967-96195989 ATGGACGAGAAGAGGAGAGGAGG + Intergenic
1045055337 8:98363749-98363771 AGGGATGAGATGAGACCAGGAGG - Intergenic
1045325455 8:101114467-101114489 ATGGAGGTGGTGAGGGCAACTGG + Intergenic
1045404741 8:101854492-101854514 ATGCAGGAAATGAGGGGAAGTGG - Intronic
1046274670 8:111942590-111942612 ATTGAGGAAATGAGGGTAGTAGG - Intergenic
1046806532 8:118485351-118485373 GTGGAAGAGATGGGGGAAGGAGG + Intronic
1047061799 8:121235636-121235658 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061806 8:121235652-121235674 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061813 8:121235668-121235690 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047216916 8:122883325-122883347 ATGGAGGAGATGGAGGTGGGCGG + Intronic
1047338638 8:123958839-123958861 AGGGAGGAGAGCAGTGCAGGGGG + Intronic
1047354043 8:124103330-124103352 GTGGAGGAGATGGGGGAAGTTGG + Intronic
1047425195 8:124739068-124739090 ATGGTGGTGTTGGGGGCAGGGGG + Intergenic
1047907001 8:129483131-129483153 AAGGAGGAGAGGAGGGAAGGGGG + Intergenic
1048163310 8:132040141-132040163 AAGGAGGAATTGAGGGGAGGAGG - Intronic
1048325268 8:133434301-133434323 AGAGAAGAGATGAGGGCAGGAGG - Intergenic
1048366439 8:133742706-133742728 AAGGAGGGGAGGAGGGAAGGAGG + Intergenic
1048445470 8:134489665-134489687 CTGGCGGAGATGATGGAAGGAGG - Intronic
1048977387 8:139680517-139680539 ATGGAGGAGATCAGAGGAGGAGG + Intronic
1049003855 8:139842645-139842667 ATGGAGGAGGGGCTGGCAGGGGG + Intronic
1049102219 8:140588009-140588031 ATGGAGGAGATGGGGGAGGATGG - Intronic
1049234715 8:141506885-141506907 TTGGAGGAGAGGAGGTCAGGAGG - Intergenic
1049265502 8:141665869-141665891 ATGGAGAAGCTGAGTGGAGGAGG + Intergenic
1049508686 8:143017340-143017362 ATGTTGGCGGTGAGGGCAGGGGG - Intergenic
1049887360 9:36595-36617 GTGGCTGAGATGAGGACAGGAGG + Intergenic
1050176837 9:2876981-2877003 AGGGAGGGGATGATAGCAGGTGG + Intergenic
1051134432 9:13902289-13902311 AAGGAAGAAAGGAGGGCAGGGGG + Intergenic
1052274392 9:26661076-26661098 ATGGAGGAAAGGAGGGAGGGAGG + Intergenic
1052619580 9:30889152-30889174 ATAGAGAAGAAGGGGGCAGGAGG - Intergenic
1052993306 9:34535402-34535424 ATGAAGGAAAAGAGGGAAGGAGG - Intergenic
1054957424 9:70928687-70928709 ATGGAGGAGAAGAAATCAGGAGG + Intronic
1056381744 9:86062594-86062616 CTGGAGGGGAGGAGGGCAAGAGG + Intronic
1056807075 9:89737119-89737141 ATGGAGGACTTGGGGGAAGGGGG - Intergenic
1057173691 9:92978724-92978746 ATGGGGGAGGGGAGGGGAGGGGG - Intronic
1057390913 9:94640710-94640732 GTGGAGGAGATAAGGCCAGCGGG + Intergenic
1057412008 9:94825127-94825149 ATGGAGGAGAGGAGGGAAATTGG + Intronic
1057799200 9:98179635-98179657 GTGGCAGGGATGAGGGCAGGAGG + Intronic
1057843444 9:98504035-98504057 CTGGAGGAGATGGGGACAGGGGG - Intronic
1057844752 9:98514864-98514886 ATGGTGGAGGGGATGGCAGGCGG + Intronic
1058378205 9:104349496-104349518 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1058630720 9:106983880-106983902 ATGGAGGTGATTAAGGCAAGGGG - Intronic
1058946622 9:109863231-109863253 AGGTAGGAGATGAAGGAAGGAGG + Intronic
1059435891 9:114276003-114276025 ATGGATGAGATGAGGTCGGCAGG - Intronic
1059718312 9:116934042-116934064 ATGGAGGTGATCAGGGCACTTGG + Intronic
1059974401 9:119700202-119700224 TGGGAGAAGATGAGGGAAGGTGG - Intergenic
1060524376 9:124312253-124312275 AAGGTGGTGATGAGGGCAGTGGG + Intronic
1061220107 9:129245550-129245572 TCGGGGGAGATGAGGCCAGGAGG - Intergenic
1061266071 9:129505730-129505752 CTCCAGGAGAGGAGGGCAGGGGG - Intergenic
1061433739 9:130547504-130547526 GAGGAGGAGCTGCGGGCAGGTGG + Intergenic
1061551424 9:131336962-131336984 CCGGAGGAGATGAGGGGAGAGGG + Intergenic
1061628248 9:131855181-131855203 AGGGAGGGGCTGAGGCCAGGGGG - Intergenic
1061668483 9:132174431-132174453 AGGGAGGAGATGGGGCCCGGGGG + Intronic
1061705729 9:132451735-132451757 GTGGAGGGGGTGAGGGCTGGTGG - Intronic
1061926619 9:133809026-133809048 ATTGAGAAGGTGAGGGCAGATGG - Exonic
1061942675 9:133891740-133891762 ATGGAGGAGAGGCAGGGAGGGGG + Intronic
1062547750 9:137071213-137071235 AAGGAGGAGAGGAGAGCAAGAGG - Intergenic
1062748699 9:138235405-138235427 ATGCAGGGGATGAGGTGAGGAGG - Intergenic
1203779903 EBV:95551-95573 ATGAAGGGGATGAGGGTGGGGGG + Intergenic
1185520710 X:736488-736510 GATGAGGAGATGGGGGCAGGAGG - Intergenic
1185673171 X:1827365-1827387 ATGTTGGAGGTGAGGCCAGGTGG - Intergenic
1185808319 X:3080745-3080767 TAGGAGGGGATGAGGTCAGGAGG - Intronic
1186490804 X:9970554-9970576 AAGGAGGAGAGGAGGGAGGGAGG - Intergenic
1186767724 X:12788909-12788931 ATGGAGGAGAGAAGGGCCAGGGG + Intergenic
1187668702 X:21646131-21646153 GTGTAGGGGATGGGGGCAGGGGG + Intronic
1187751042 X:22465437-22465459 ATGGAGGGAGGGAGGGCAGGGGG - Intergenic
1189286798 X:39857593-39857615 AGGGAAGAGATGAGCACAGGAGG + Intergenic
1189294891 X:39911026-39911048 ATGGGGGCGCTGAGGGCTGGGGG - Intergenic
1189330838 X:40144072-40144094 CTGGAGGGGAAGAGGGAAGGTGG + Intronic
1189348778 X:40262029-40262051 ATGGAGGAGTAAAGGGCAGGGGG - Intergenic
1189385837 X:40536182-40536204 AAGGTGGAGGTGGGGGCAGGGGG + Intergenic
1189388248 X:40555034-40555056 ATGGCGGTGATGGGGGCTGGGGG - Intergenic
1189455878 X:41189187-41189209 ATGGAGAGGCTGAGGCCAGGTGG + Intronic
1189588663 X:42488554-42488576 AGGGAGGAAAGGAGGGAAGGAGG - Intergenic
1189729880 X:44008573-44008595 AAGGAGGAGAAGAGGGAGGGAGG + Intergenic
1189737111 X:44082859-44082881 ATGGTGGGGGTGAGGGCAGGGGG + Intergenic
1190129039 X:47730252-47730274 ATGGAAGAGATGGGGGGATGTGG + Intergenic
1190248825 X:48707398-48707420 AGGGAGGAGAGGAGGGAAGGAGG - Intronic
1190560124 X:51678704-51678726 ATGGATGCCAAGAGGGCAGGTGG - Intergenic
1190564167 X:51714617-51714639 ATGGATGCCAAGAGGGCAGGTGG + Intergenic
1190681701 X:52831530-52831552 AAGGAGGTGCTGAGGGCAGCTGG + Intergenic
1190797753 X:53760307-53760329 ATGGGGGAGCTGAGGGCAGGCGG - Intergenic
1190909058 X:54755598-54755620 ATGGAAGGGATAAGGGCAGCAGG + Intronic
1190917403 X:54820907-54820929 ATGGGGGAGCTGAGGGCAGGCGG + Intergenic
1192226458 X:69231515-69231537 ATGGGGGAGTGGAAGGCAGGTGG + Intergenic
1192496509 X:71619915-71619937 AGGGGAGAGCTGAGGGCAGGTGG - Intergenic
1194546839 X:95246148-95246170 AGTGAGGAGCTGAGGGGAGGTGG + Intergenic
1194637587 X:96364404-96364426 ATGTTGGAGGTGGGGGCAGGTGG + Intergenic
1194732183 X:97468136-97468158 ATGGACGATATGATGGCAGAAGG - Intronic
1194982560 X:100455047-100455069 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1195765852 X:108296283-108296305 ATGGAGGAGAAGTGGGCCTGTGG - Intronic
1195992818 X:110699560-110699582 AAGGAGTAGAAGTGGGCAGGAGG - Intronic
1196067910 X:111486109-111486131 GTGGAGGTGAAGAGGCCAGGAGG - Intergenic
1196104559 X:111882432-111882454 CTGGAGGAGCTGAGGGCTAGAGG + Intronic
1196558386 X:117118772-117118794 ATGGAGGAGATGAGTGAAAACGG - Intergenic
1196900703 X:120380119-120380141 ATTCAGGAGATTAAGGCAGGAGG + Exonic
1197515967 X:127429345-127429367 AAGAAGGAGATGAGAGCAGAGGG + Intergenic
1197773622 X:130106350-130106372 GTGGGGGAGATGAGAGAAGGAGG - Intronic
1198250031 X:134870758-134870780 AAAGAGGAGAGGAAGGCAGGAGG + Intergenic
1198343710 X:135739700-135739722 ATGGAGCAGAGGAGGGGAGTGGG - Intergenic
1198651845 X:138871824-138871846 AGGTAGGAGATGAGGCCAGAAGG + Intronic
1199600372 X:149538106-149538128 ATGCTGGAGATGAGGTGAGGAGG - Intergenic
1199649710 X:149939507-149939529 AGGGAGGAGATGGGGAGAGGCGG + Intergenic
1199650213 X:149941834-149941856 ATGCTGGAGATGAGGTGAGGAGG + Intergenic
1199783188 X:151082045-151082067 ATGGAGGAGCTCAGGAAAGGGGG + Intergenic
1199834091 X:151571372-151571394 AAGGAGGAGATGAGCACAGATGG - Intronic
1200311855 X:155086344-155086366 AGGGAGGAAGCGAGGGCAGGCGG - Intronic
1200809034 Y:7463231-7463253 GTGGAGGAGATGCTGGTAGGGGG + Intergenic
1201146007 Y:11066182-11066204 AGGGAGGAGGGGAGGGAAGGAGG + Intergenic
1201550115 Y:15210423-15210445 AAGGAGGAAATGAGGGAGGGAGG + Intergenic
1201610789 Y:15840661-15840683 AGGAAGGAGTTGAGGTCAGGAGG + Intergenic
1202581991 Y:26391819-26391841 ATGGTGGAGATGGGGACAGAGGG + Intergenic