ID: 1152532545

View in Genome Browser
Species Human (GRCh38)
Location 17:80927826-80927848
Sequence ATGGAGGAGATGAGGGCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1061
Summary {0: 1, 1: 1, 2: 10, 3: 108, 4: 941}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152532545_1152532553 16 Left 1152532545 17:80927826-80927848 CCGCCTGCCCTCATCTCCTCCAT 0: 1
1: 1
2: 10
3: 108
4: 941
Right 1152532553 17:80927865-80927887 TCCCGCCCGCACGGAGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 358
1152532545_1152532557 20 Left 1152532545 17:80927826-80927848 CCGCCTGCCCTCATCTCCTCCAT 0: 1
1: 1
2: 10
3: 108
4: 941
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1152532545_1152532556 19 Left 1152532545 17:80927826-80927848 CCGCCTGCCCTCATCTCCTCCAT 0: 1
1: 1
2: 10
3: 108
4: 941
Right 1152532556 17:80927868-80927890 CGCCCGCACGGAGGAGCTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 157
1152532545_1152532551 7 Left 1152532545 17:80927826-80927848 CCGCCTGCCCTCATCTCCTCCAT 0: 1
1: 1
2: 10
3: 108
4: 941
Right 1152532551 17:80927856-80927878 TCTGAGAATTCCCGCCCGCACGG 0: 1
1: 0
2: 0
3: 2
4: 43
1152532545_1152532552 10 Left 1152532545 17:80927826-80927848 CCGCCTGCCCTCATCTCCTCCAT 0: 1
1: 1
2: 10
3: 108
4: 941
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152532545 Original CRISPR ATGGAGGAGATGAGGGCAGG CGG (reversed) Intronic