ID: 1152532546

View in Genome Browser
Species Human (GRCh38)
Location 17:80927829-80927851
Sequence CAAATGGAGGAGATGAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 401}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152532546_1152532553 13 Left 1152532546 17:80927829-80927851 CCTGCCCTCATCTCCTCCATTTG 0: 1
1: 0
2: 4
3: 51
4: 401
Right 1152532553 17:80927865-80927887 TCCCGCCCGCACGGAGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 358
1152532546_1152532552 7 Left 1152532546 17:80927829-80927851 CCTGCCCTCATCTCCTCCATTTG 0: 1
1: 0
2: 4
3: 51
4: 401
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532546_1152532551 4 Left 1152532546 17:80927829-80927851 CCTGCCCTCATCTCCTCCATTTG 0: 1
1: 0
2: 4
3: 51
4: 401
Right 1152532551 17:80927856-80927878 TCTGAGAATTCCCGCCCGCACGG 0: 1
1: 0
2: 0
3: 2
4: 43
1152532546_1152532556 16 Left 1152532546 17:80927829-80927851 CCTGCCCTCATCTCCTCCATTTG 0: 1
1: 0
2: 4
3: 51
4: 401
Right 1152532556 17:80927868-80927890 CGCCCGCACGGAGGAGCTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 157
1152532546_1152532557 17 Left 1152532546 17:80927829-80927851 CCTGCCCTCATCTCCTCCATTTG 0: 1
1: 0
2: 4
3: 51
4: 401
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152532546 Original CRISPR CAAATGGAGGAGATGAGGGC AGG (reversed) Intronic
900287955 1:1910757-1910779 CAGCTGGAGGTGATGAGGGTGGG + Intergenic
900601189 1:3503307-3503329 TAACTGGAGCAGATGAGTGCTGG + Intronic
901264421 1:7899185-7899207 CCAATGTTGGAGATGAGGCCTGG - Intergenic
901473184 1:9471907-9471929 CAAATGGTGGGGATGAGGGCGGG - Intergenic
901570401 1:10155572-10155594 CACATGGAGGTGATGAGCACTGG - Intronic
901820382 1:11825477-11825499 CAAATGGCTGAGCTGAGGGAAGG - Intronic
903019972 1:20386979-20387001 CACCTGGAGGAGATGGGGGGAGG + Intergenic
903799333 1:25954934-25954956 CAAAGGGAGGAGCTGGGGGCAGG - Intergenic
904337503 1:29807644-29807666 CACATGGGGAAGATGAGGCCTGG + Intergenic
905008595 1:34731149-34731171 GGGATGCAGGAGATGAGGGCAGG - Intronic
905353935 1:37367747-37367769 CAAATGGAAGCCATTAGGGCTGG + Intergenic
905395115 1:37661728-37661750 CAGAGGGAGGGGCTGAGGGCCGG + Intergenic
907678349 1:56539651-56539673 GCAATGGAGGAGAGGGGGGCAGG + Intronic
907705462 1:56828609-56828631 CATATGGGGGAGAACAGGGCAGG + Intergenic
910830582 1:91457181-91457203 TAACTGGAGGAACTGAGGGCTGG - Intergenic
910872780 1:91850310-91850332 CAAAAGGAAAAGATAAGGGCGGG + Intronic
911054230 1:93697026-93697048 CTAAGGGAGGAGAGGAGGGCTGG - Intronic
912817495 1:112841231-112841253 TAAATGTAGGAGATGAAGTCAGG - Intergenic
913204881 1:116529181-116529203 AAAATTGAGAAGTTGAGGGCAGG - Intronic
915026743 1:152837663-152837685 CAACTGGAAGAGATTAGGGAGGG + Intergenic
915204571 1:154260570-154260592 CCCATGGAGGAGAAGAGGGGAGG + Intronic
915722949 1:157997188-157997210 CAAATGGTGGAGGTGGGAGCTGG - Intronic
917049492 1:170903675-170903697 AAGATGCAGGAGATGAGGGCTGG - Intergenic
917578212 1:176346210-176346232 CCAATGTTGGAGATGAGGCCTGG - Intergenic
917820510 1:178758538-178758560 GCAGTGGAGGGGATGAGGGCAGG - Intronic
918238371 1:182601022-182601044 CAAGAGCAGGAGATGAGGTCAGG - Intronic
918283449 1:183028155-183028177 CAAATGGAAGAGGTGGGGGGGGG - Intronic
919114559 1:193264493-193264515 CAAAAGGAGGAGAGGAGGTTTGG - Intergenic
919436431 1:197567979-197568001 CAAACTGGGGAGATGAGGGGAGG + Intronic
919973904 1:202598699-202598721 TAAATGTTGGAGATGAGGTCTGG - Intronic
922595393 1:226809152-226809174 CAGATGGTGCAGATGAGGGAGGG + Intergenic
922807345 1:228397250-228397272 CAAATGTAGGAGAGGGGGACGGG - Intronic
923545984 1:234923626-234923648 CAGATGGAGGTGCTGAGGTCAGG - Intergenic
1063028774 10:2210388-2210410 CAACTGCTGGAAATGAGGGCCGG - Intergenic
1063985643 10:11498716-11498738 AAATTGGAGGAGATCAGGGAAGG + Intronic
1065047080 10:21754319-21754341 CAGCTGGAGAAGATGAGGACAGG + Intergenic
1065410119 10:25416937-25416959 CAAATGGATTCCATGAGGGCAGG + Intronic
1065483744 10:26217399-26217421 CAGATAAAGGAAATGAGGGCTGG + Intronic
1066199831 10:33134131-33134153 CTAATGGAGGAAGTGAGGACAGG + Intergenic
1066638605 10:37533014-37533036 CAGATGGACGAAATGAAGGCAGG - Intergenic
1067220397 10:44339970-44339992 AAAATGAAGGAGATGTGGACTGG - Intergenic
1067905443 10:50286193-50286215 GGAGTGGAGGAGAAGAGGGCTGG + Intergenic
1068654899 10:59564436-59564458 CCAAGGAAGGAGAAGAGGGCAGG + Intergenic
1068923453 10:62510568-62510590 CAAATGGAGTAGTTGAGTCCTGG + Intronic
1069533721 10:69237910-69237932 GAAATGGAGGAGGTGCGGTCAGG + Intronic
1069589338 10:69632130-69632152 GAAGTGGAGGAGATGAGCCCTGG + Intronic
1069914415 10:71778532-71778554 CCCATGAAGGAGAGGAGGGCAGG - Intronic
1070548341 10:77470314-77470336 CAAACTGAGGAGGTGAGGCCCGG + Intronic
1070604935 10:77892016-77892038 TAAATGCAGATGATGAGGGCAGG - Intronic
1070750295 10:78960089-78960111 GAAATGGATGGGATGGGGGCTGG - Intergenic
1072915257 10:99533710-99533732 CAAAAGGGGGAAATGAGGGAAGG + Intronic
1073178768 10:101571388-101571410 CAAATGGAGGTGGAGAGGTCAGG + Intronic
1074861745 10:117515213-117515235 CAAATGGGGGCCATGTGGGCTGG - Intergenic
1075838498 10:125476862-125476884 CCAATGTTGGAGATGAGGCCTGG - Intergenic
1076722593 10:132399200-132399222 CACATGCAGGGGATAAGGGCGGG - Intronic
1078657463 11:13255120-13255142 CAAATGGAGAAGCTGGGGGTGGG + Intergenic
1079331847 11:19540158-19540180 CCACTGCAGGAGATGAAGGCAGG - Intronic
1080266487 11:30407120-30407142 TAAATGATGGAGATGAAGGCAGG + Intronic
1080399254 11:31919059-31919081 CACCTGAAGGAGATGAGGGAGGG + Intronic
1081166609 11:39815496-39815518 CAGATGGAGCAAAGGAGGGCTGG - Intergenic
1081444757 11:43119896-43119918 AATATGGGGGAGAAGAGGGCTGG - Intergenic
1082081145 11:48013449-48013471 CCAGTGGGGGAGATGAGGCCTGG + Intronic
1083209421 11:61173771-61173793 CAAAAGGAGGAGAGGACGGGTGG - Intergenic
1083842419 11:65312149-65312171 CAAGGTGAGGAGGTGAGGGCAGG + Intergenic
1085514161 11:77102715-77102737 CAAAGGGAGGGGAAGAGGGAAGG + Intronic
1085740530 11:79074710-79074732 CACCAGGAGGAGATGGGGGCAGG + Intronic
1086694338 11:89825735-89825757 AACATGGAGGAGGTGAGGCCGGG + Intergenic
1086711808 11:90018776-90018798 AACATGGAGGAGGTGAGGCCGGG - Intergenic
1086886670 11:92214039-92214061 CTAATGCAGGGGATGAGGGCAGG - Intergenic
1087373401 11:97314167-97314189 AAAATGAAGGAGAGGAGGGCAGG + Intergenic
1088410266 11:109526285-109526307 CCAATGGAGGAGGTGAGGCCTGG + Intergenic
1088510084 11:110565192-110565214 GAGAGGGAGGAGATGAGGGCAGG + Intergenic
1088790619 11:113223136-113223158 CAGAAGGAGGAGATGAGCTCTGG - Intronic
1088920260 11:114255468-114255490 CAGAGGGAGGAGGGGAGGGCGGG - Intergenic
1089340383 11:117753338-117753360 CAAAGGGAGGAGAAGAATGCGGG - Intronic
1089605267 11:119638017-119638039 GAGGTGGAGGAGGTGAGGGCAGG - Intronic
1090155399 11:124432435-124432457 CAAATGCAAGAGATGAGTGGGGG + Intergenic
1090265617 11:125351273-125351295 CACATGGAGGACCTGTGGGCAGG - Exonic
1091041243 11:132283951-132283973 CAAGAGGAGGAGAGGAGGCCAGG - Intronic
1092939122 12:13391053-13391075 CACATGGAGGAGATGAAGCCAGG - Intergenic
1093017201 12:14166634-14166656 TAAAGGGAGGGGATAAGGGCAGG - Intergenic
1093193283 12:16100133-16100155 CAAGTGGAGGAGGGGAGGGCAGG + Intergenic
1094735266 12:33227324-33227346 CAAATTGTGGTGATGATGGCAGG - Intergenic
1094802739 12:34055949-34055971 CAAATGCAGTTGATGAGGGCTGG - Intergenic
1095116149 12:38354440-38354462 CAAATGCAGTTGATGAGGGCTGG - Intergenic
1095420538 12:42019429-42019451 CAAATGGATCACATGAGGCCAGG + Intergenic
1095975855 12:47940783-47940805 GAAATGGAGGAGGTGAGGGTTGG + Intronic
1096182692 12:49559307-49559329 GAAATGGGGCAGGTGAGGGCTGG + Intronic
1096459161 12:51812678-51812700 CAAGTCGAGGAGGTGAGGGAAGG - Exonic
1096553259 12:52388199-52388221 CAGGTGGAGGGGATGAGGTCAGG - Intergenic
1096738880 12:53677216-53677238 TAAATGGAGGAGCTCGGGGCCGG - Intronic
1096966570 12:55632700-55632722 GAAATGGGGGAAATGAGGGAAGG - Intergenic
1097247993 12:57617126-57617148 CAAAAGGAGGATATGTGGGTGGG + Exonic
1098224402 12:68307185-68307207 CAAAAGGGGGAGAAGAGGGAGGG + Intronic
1099133045 12:78860614-78860636 TAAATGGATGAGATGATGGGAGG + Intergenic
1099946490 12:89250622-89250644 AAAATGAAGCAGATGAGGACAGG + Intergenic
1100335707 12:93627020-93627042 CCAATGTTGGAGATGAGGTCTGG + Intergenic
1100643123 12:96501772-96501794 CAAATAGAGGATATGAGTGGTGG + Intronic
1100661785 12:96707586-96707608 AAAATGGAGGAGATGAAGCATGG + Intronic
1100851746 12:98719257-98719279 CCAAAGGAGGAAATGAGGGTGGG - Intronic
1101699640 12:107160307-107160329 GAAAGGGAGGAGAGGAGGTCAGG + Intergenic
1102688000 12:114739149-114739171 GCAGTGGAGGAGATGAAGGCTGG + Intergenic
1102815497 12:115862162-115862184 CAATTGTAGGATATGAGAGCTGG + Intergenic
1103554271 12:121756611-121756633 GAAATGGAGGAGATTCGGGGGGG - Intronic
1103763970 12:123269194-123269216 CAAATGGAGAAACTGAGGACTGG - Intronic
1104248293 12:127063894-127063916 TTAATGGAGGAGGTCAGGGCAGG - Intergenic
1104505592 12:129329139-129329161 TATATGGAGGAGATGAGGTCAGG - Intronic
1104726172 12:131077005-131077027 GAAATGCTGGAGATGTGGGCAGG + Intronic
1105586048 13:21743733-21743755 CATATGGAGGAGATGAAGTCAGG - Intergenic
1105806759 13:23955955-23955977 CAAAAGAAGGTGATGAGAGCAGG + Intergenic
1106076341 13:26464416-26464438 CAAATGGAGCAGACCAGGACTGG + Intergenic
1106499341 13:30312076-30312098 CAAAGGGAGGAGAGGAGGTTGGG - Intergenic
1106559811 13:30838486-30838508 CCAATGCAGGAGATGGGGCCTGG - Intergenic
1107777830 13:43865091-43865113 CAAATGGAAGAGATGATGCGTGG - Intronic
1108151623 13:47541801-47541823 GAAATGGAGAATATGAGGGAGGG + Intergenic
1108696831 13:52909592-52909614 GAAATGGAAGAGTGGAGGGCAGG + Intergenic
1109044655 13:57393858-57393880 CTAATTGAGAAGATGAGGCCTGG - Intergenic
1109267049 13:60213373-60213395 CTAATGGGGGAGATTGGGGCAGG + Intergenic
1109773773 13:67012709-67012731 TAGTTGGAGGAGAGGAGGGCAGG - Intronic
1110263292 13:73510445-73510467 CATATGATGGAGATGAGAGCAGG + Intergenic
1110289216 13:73784929-73784951 CTAAAGAAGGAGATGAGGCCGGG - Intronic
1111700849 13:91685833-91685855 CAAATAGAGAAAATGAGGACAGG + Intronic
1111781986 13:92740064-92740086 CAACTGGAGGAGAAGAGGATAGG - Intronic
1113225930 13:108159520-108159542 AAAAAAGAGGAGATGAGGCCGGG + Intergenic
1113644623 13:111984562-111984584 CAAATGGAAGAGATGATTGTGGG + Intergenic
1114351447 14:21856318-21856340 AAAAGGGAGGAGATGGGGGGAGG - Intergenic
1114827272 14:26096196-26096218 CATATGGAGGAGAGTAGGGAAGG + Intergenic
1115136989 14:30122105-30122127 CAAATGAAGGAGTTGAAGGTTGG + Intronic
1115298874 14:31861565-31861587 AAGAAGGAGGAGAAGAGGGCAGG - Intergenic
1115502489 14:34061654-34061676 TAAATGGAGGAGATACAGGCAGG + Intronic
1116282103 14:42921992-42922014 CAAATGAAAGAGATGAGAACAGG + Intergenic
1118892848 14:69924209-69924231 CAGATGCAGGAGCTGAGGGAAGG - Intronic
1119009658 14:70971692-70971714 TAAATAGAGTAGTTGAGGGCGGG + Intronic
1120015629 14:79470216-79470238 CACAAGGGGGAGATGAAGGCAGG + Intronic
1121491616 14:94365148-94365170 CAGAAGGAGGAGACGGGGGCTGG + Intergenic
1121795246 14:96729096-96729118 GAAATGGAGGAGATGAGAAATGG + Intergenic
1122031401 14:98915217-98915239 GAAATGGAGGGGCTGAGGGCTGG + Intergenic
1122237328 14:100339190-100339212 CAAAAGGAGCAGATGAGTGTTGG + Intronic
1122280776 14:100621005-100621027 CAAATAAAGGATATGAGGACGGG - Intergenic
1122919496 14:104874211-104874233 CCAATGGAGGAGGTGATGTCTGG + Intronic
1125167462 15:36724780-36724802 CAAATGCAAGAGATGAAGGGTGG - Intronic
1126203343 15:46014749-46014771 CCACTGGAGGACCTGAGGGCAGG - Intergenic
1126239269 15:46422711-46422733 CAACTTGAGGAAATGATGGCTGG + Intergenic
1127160085 15:56173551-56173573 CAAGTGGATCAGATGAGGTCAGG + Intronic
1128462660 15:67883007-67883029 AAACTGAAGGAGATGAGGGAGGG + Intergenic
1128750948 15:70148640-70148662 TAAATGCAGGAGCTGTGGGCTGG - Intergenic
1129364135 15:75044028-75044050 GAAATGGAGGGGGTGGGGGCGGG - Intronic
1129669314 15:77598384-77598406 CCAAGGGTGGAGATGGGGGCAGG - Intergenic
1129692515 15:77721812-77721834 CAGATGGAGAAGCTGAGGCCCGG - Intronic
1130978022 15:88792176-88792198 GAGATGAAGGAGATGAGGGGAGG + Intergenic
1131547496 15:93328116-93328138 CAAATGGGGTGGGTGAGGGCAGG - Intergenic
1131559276 15:93425102-93425124 TAAATGGAGAAATTGAGGGCAGG - Intergenic
1131840305 15:96429735-96429757 CAAATTGAGGAGATGAGATTGGG - Intergenic
1132184632 15:99792462-99792484 GACATGGAGGAGATGAAGGTAGG + Intergenic
1134589373 16:15439905-15439927 GAAATGGAGGAGTTGGAGGCGGG + Intronic
1134743448 16:16569211-16569233 CTAAGGGAGGAGAGGAGGGCAGG - Intergenic
1134812798 16:17181640-17181662 CAAAGGGAGGAACTGAGGGTAGG + Intronic
1134924107 16:18143250-18143272 CTAAGGGAGGAGAGGAGGGCAGG + Intergenic
1136016304 16:27403247-27403269 CATGTGGAGGAGAGGAGGGTGGG + Intronic
1136228149 16:28872523-28872545 CAAACGCAGGTGCTGAGGGCGGG - Exonic
1136698170 16:32105393-32105415 GAAAAGGAGGAAATGAGGGAAGG + Intergenic
1136798669 16:33048682-33048704 GAAAAGGAGGAAATGAGGGAAGG + Intergenic
1137800375 16:51257382-51257404 CAAGTGCAGGAGATGAGCCCTGG - Intergenic
1139356637 16:66370881-66370903 GAAGTGGAGGAGAGGAGAGCTGG + Intronic
1140088286 16:71815816-71815838 CAAAAGGAGGAGGGGAGGGGAGG + Intergenic
1140911001 16:79452780-79452802 CAACTGGAGGAGGTGTGAGCAGG - Intergenic
1141069659 16:80942227-80942249 CCAATGCTGGAGATGAGGCCTGG + Intergenic
1141466010 16:84206232-84206254 CAAAGTAAGGAGATGAGGTCAGG - Intergenic
1141680074 16:85538663-85538685 GAAGTGGAGGAGGAGAGGGCAGG + Intergenic
1141813445 16:86392302-86392324 GAAGTGGAGAAGATGGGGGCCGG + Intergenic
1141832990 16:86520044-86520066 CAAATGTAGGTCATGAGGACAGG + Intergenic
1142236951 16:88926916-88926938 CAGAGAAAGGAGATGAGGGCAGG - Intronic
1142264548 16:89057712-89057734 CAAGGGGAGGAGAGGAGGACAGG - Intergenic
1142435970 16:90057573-90057595 AAAATGGAGGGGATCAGTGCGGG + Intronic
1142690673 17:1604729-1604751 CAACAGCAGGAGGTGAGGGCAGG - Intronic
1142706392 17:1697683-1697705 GAGATGGAGGAGATGGGGGAGGG - Intergenic
1142959736 17:3545107-3545129 CACATGCTGGAGCTGAGGGCTGG + Intronic
1143432241 17:6895577-6895599 TAGATGGAGGAGATGAGAGAAGG - Intronic
1143462021 17:7109937-7109959 CAAAGAGAGGAGCTCAGGGCTGG - Intronic
1144335648 17:14266917-14266939 CACATGGAGGAAATGAAGGCTGG - Intergenic
1145885672 17:28381044-28381066 CCAGGGGAGGAGATGAGGGTGGG + Intronic
1146214547 17:30968804-30968826 GAAATGGAGAAGAGGAGAGCTGG + Intronic
1147371728 17:39997296-39997318 CAAAGAGAGGAGATGAGCGAGGG - Intronic
1148168099 17:45497923-45497945 CAAAGGGATGAAATGAGGGATGG - Intergenic
1148280717 17:46345037-46345059 CAAAGGGATGAAATGAGGGATGG + Intronic
1148302945 17:46562972-46562994 CAAAGGGATGAAATGAGGGATGG + Intronic
1148648277 17:49231381-49231403 CAAAAGGAGGAGATTAGGGTGGG - Intergenic
1148670503 17:49406692-49406714 CAAATGGGGAAGCTGAGTGCCGG + Intronic
1148864280 17:50620518-50620540 CAAGGGGAGGGGAGGAGGGCAGG - Intronic
1149590919 17:57829370-57829392 CAAATGGATGAGCTGGGGCCAGG + Intergenic
1150399283 17:64844339-64844361 CAAAGGGATGAAATGAGGGATGG - Intergenic
1150561617 17:66300257-66300279 AAAATGGAGGAGATTAAGGACGG - Intergenic
1151222656 17:72624536-72624558 CAAAGGCAGGAGATAAGGGAAGG - Intergenic
1151329099 17:73396386-73396408 GAACTGGGGGAGGTGAGGGCTGG - Intronic
1151852190 17:76697646-76697668 CCAATGGAGGAGGTGGAGGCGGG + Intronic
1152532546 17:80927829-80927851 CAAATGGAGGAGATGAGGGCAGG - Intronic
1153296591 18:3552127-3552149 CACCTGGAAGAGATGAGGGAAGG - Intronic
1153534710 18:6088463-6088485 GAAAGGGAGGAGATGCAGGCAGG + Intronic
1154306113 18:13232175-13232197 AACAGGGAGGAGATGAGAGCAGG - Intronic
1155103218 18:22634597-22634619 GAACTGAAGGAGATGAGGCCAGG - Intergenic
1155233675 18:23798079-23798101 AAAAAGGAGGAGACGAAGGCAGG - Intronic
1156465549 18:37346175-37346197 CAGTTGGAGGAGGTGGGGGCAGG - Intronic
1157586763 18:48806028-48806050 CTAGTGGAGGTGATCAGGGCTGG + Intronic
1158421410 18:57298051-57298073 CAAATGGATGAGAGGTGGGATGG - Intergenic
1159081981 18:63745328-63745350 CAAATGGAGGATCTTAGGGAAGG + Intergenic
1160079697 18:75713844-75713866 CAAATCGAGGTGTTGAGAGCTGG + Intergenic
1160224152 18:76999153-76999175 CAACGGGAGGAGGTGAGGGGAGG + Intronic
1160252114 18:77211548-77211570 CAAATGGAGAATCTGAGGGGAGG + Intergenic
1160407913 18:78655412-78655434 CAAATGGTGGAGAGCAGGGCAGG + Intergenic
1161142893 19:2659280-2659302 TAAATAAAGGAGAGGAGGGCCGG + Intronic
1161168865 19:2803120-2803142 GAAATGGAGCATCTGAGGGCTGG - Intronic
1161257307 19:3316511-3316533 GAAAGGGAGGAGGAGAGGGCAGG + Intergenic
1161300023 19:3538025-3538047 CAGAGTGAGGAGAGGAGGGCAGG + Intronic
1161328144 19:3673127-3673149 CAGAGGGAGGAGCAGAGGGCAGG - Intronic
1161345453 19:3766885-3766907 GAGAGGGAGGAGGTGAGGGCAGG + Intronic
1161422014 19:4181148-4181170 GAGAGGGAGGAGAAGAGGGCAGG - Intronic
1162288731 19:9762102-9762124 CAAATGGAAGAGCTGAGGACAGG - Exonic
1162327405 19:10007279-10007301 CAGATGGAGGAGATCAGGATAGG - Intronic
1162363154 19:10231374-10231396 AAAGGGGAGGAGAGGAGGGCGGG - Intergenic
1162429924 19:10622241-10622263 GAGAGGGAGGAGGTGAGGGCAGG + Intronic
1162557836 19:11398640-11398662 GAAATGAAGGAAATGAAGGCTGG - Intronic
1162854886 19:13460635-13460657 AGAATAGAGGAGATGAGGGGAGG - Intronic
1163121721 19:15222455-15222477 CAAAGGTAGGAGGTGAGGCCAGG - Intergenic
1164156958 19:22602875-22602897 GACAAGGAGGAGATGAAGGCAGG + Intergenic
1166049346 19:40248764-40248786 GGAGTGGAGGAGATGAGGACAGG + Intronic
1166049352 19:40248789-40248811 GGAGTGGAGGAGATGAGGACAGG + Intronic
1166049367 19:40248864-40248886 GGAGTGGAGGAGATGAGGACAGG + Intronic
1166049382 19:40248939-40248961 GGAGTGGAGGAGATGAGGACAGG + Intronic
1166049397 19:40249014-40249036 GGAGTGGAGGAGATGAGGACAGG + Intronic
1166049403 19:40249039-40249061 GGAGTGGAGGAGATGAGGACAGG + Intronic
1166049409 19:40249064-40249086 GGAGTGGAGGAGATGAGGACAGG + Intronic
1166382758 19:42363207-42363229 CTAAGGGAGCAGATGGGGGCTGG + Exonic
1167785974 19:51636582-51636604 CAAGAGGTGGAGATGAGGGTGGG - Intronic
925081788 2:1075139-1075161 AAAATGGATCAGATGAGGGTTGG + Intronic
925337536 2:3109030-3109052 CAAATGGAGGGGATGTGTCCTGG - Intergenic
925590488 2:5504558-5504580 CAAAGGCAGTAGATGAGGCCCGG + Intergenic
926099740 2:10106809-10106831 CAAATTGATGATCTGAGGGCTGG - Intergenic
926236819 2:11051851-11051873 ACAGTGGAGGAGATGAGGGGAGG + Intergenic
927751571 2:25674223-25674245 AAAAGGGAGGACATTAGGGCTGG + Intergenic
927922250 2:26982040-26982062 CTTGTGGAGGAGATGAGGGCTGG - Intronic
929161933 2:38840669-38840691 AGAATGGAGGAGTTGAGGTCAGG - Intronic
929265230 2:39911678-39911700 CAAATGATGGAGCTGAGGGTGGG + Intergenic
930246601 2:48990015-48990037 CAAAAGGAGGAGATGGGGAAGGG - Intronic
931247005 2:60500051-60500073 CGAAAGGAGGAGAGGAGGGAGGG - Intronic
931390874 2:61842835-61842857 GAAATAGAGGAAATGGGGGCAGG + Intronic
932437463 2:71711073-71711095 CAAGTGGAGGTGAACAGGGCAGG + Intergenic
933792940 2:85897566-85897588 CAAATGGAGAAGATGAGGAAGGG + Intergenic
933949646 2:87317534-87317556 CAAATGTTGGAGGTGAGGCCTGG - Intergenic
934851877 2:97706979-97707001 AAGATGAGGGAGATGAGGGCCGG + Intergenic
934855371 2:97725945-97725967 GAATGGGAGGAGGTGAGGGCAGG + Intronic
934979673 2:98829492-98829514 CATGGGGAGGAGGTGAGGGCTGG + Intronic
935199468 2:100843919-100843941 CAAACGGAGGACATGGGTGCTGG - Intronic
935312830 2:101802445-101802467 TAGAAGGAGGAGAGGAGGGCTGG - Intronic
935583823 2:104783250-104783272 CAACAGGAGAAGAAGAGGGCTGG + Intergenic
935877293 2:107523894-107523916 CAAATGTGGGAAATGAGGCCAGG - Intergenic
937667958 2:124508003-124508025 CAAATGGAGGGGATGACATCAGG + Intronic
938673890 2:133611271-133611293 CAGATGGAGGAGGTGGTGGCGGG - Intergenic
939968381 2:148633436-148633458 CAGAGGGAAGAGATGAGAGCTGG + Intergenic
942443657 2:176062390-176062412 CAAGTGACGGAGATGAGGGAGGG + Intergenic
943348523 2:186770175-186770197 AAAATGGAGGCGATGCGGGGAGG + Intergenic
946169828 2:217888288-217888310 CAGATGGAGGAGAGGAGGGCAGG - Intronic
946174495 2:217914076-217914098 CAAATAGAAGAGAGGAGGGAAGG - Intronic
946712596 2:222521814-222521836 CAACTGGAGGGGAGGAGGGACGG - Exonic
947022756 2:225699758-225699780 GAAATGCAGGGGATGAGGGATGG + Intergenic
947049703 2:226028343-226028365 TAAATGAGGGAGATGGGGGCAGG - Intergenic
947370652 2:229442096-229442118 AAAAGGAAGGACATGAGGGCAGG + Intronic
947817989 2:233050867-233050889 AAAAAGGAGGAGAGGAGGGAAGG + Intergenic
948078989 2:235190079-235190101 CCGAAGGAGGAGATGGGGGCAGG - Intergenic
1169461131 20:5796529-5796551 GAAAGGGGGGAGATGAGGCCGGG + Intronic
1170643045 20:18172858-18172880 GAAATGGGGGAGGTGTGGGCAGG + Intronic
1170790966 20:19509170-19509192 CAGATGAAGGAAATGAGGCCCGG + Intronic
1170792849 20:19521859-19521881 ATACTGGAGGAGATGGGGGCTGG - Intronic
1171562418 20:26137136-26137158 CAAAAGAAGGTGATGAGAGCGGG + Intergenic
1172005679 20:31817752-31817774 GAAATGGAGGAGAGGAGGACCGG + Intergenic
1172211294 20:33200301-33200323 AGAATGGAGGAGATGAGGGCTGG - Intergenic
1172650101 20:36496679-36496701 CAGATGGATGAGAGAAGGGCAGG - Intronic
1174008290 20:47427950-47427972 CAAATGGTTGAGATGGGGGAGGG + Intergenic
1175407787 20:58745910-58745932 CAGATGGAGGATATGGGGACTGG + Intergenic
1175600359 20:60267755-60267777 CACATGGAGGAGCTGTGGGTTGG - Intergenic
1176190543 20:63807639-63807661 AAAATGGAGTAGCTGAAGGCCGG - Intronic
1176664588 21:9673703-9673725 CTAATGGAAGAGATGAAGGCTGG - Intergenic
1176847946 21:13890983-13891005 CAAATGTTGGAGATGGGGTCTGG - Intergenic
1177687759 21:24462032-24462054 CAACTGGAGCCGATGAGGTCTGG + Intergenic
1178069299 21:28944992-28945014 CAAGTGGATCACATGAGGGCAGG + Intronic
1178376393 21:32071021-32071043 CAGAGGCAGGAGGTGAGGGCAGG - Intergenic
1178506937 21:33170140-33170162 CCAAGGGAGCAGAGGAGGGCAGG - Exonic
1179049857 21:37879961-37879983 CAAATGGATGAAATGTTGGCTGG + Intronic
1179233495 21:39525904-39525926 CAACTGGAGAAGAGGAGCGCGGG + Intergenic
1179456730 21:41505732-41505754 CAAGTGGAGGAAAGGAGGGAAGG - Intronic
1179473440 21:41627632-41627654 CAAATGCTTGAGATGAGGGCTGG - Intergenic
1179606253 21:42517391-42517413 CAGATAGAAGAGATGAGGGGCGG + Intronic
1179622872 21:42630398-42630420 CAAATGGAGAAGGGGAGGGCAGG - Intergenic
1179834490 21:44020829-44020851 GAAGTTGAGGAGCTGAGGGCTGG + Intronic
1180118195 21:45725898-45725920 CCAGTGCAGGAGATGAGGTCAGG + Intronic
1181496463 22:23289930-23289952 TAGCTGGAGGAGAGGAGGGCTGG - Intronic
1182501781 22:30753311-30753333 GAGATGGAGGTGAGGAGGGCAGG + Intronic
1183509586 22:38227058-38227080 GAGATGGAGGAGATGGGGGGTGG + Intronic
1184184189 22:42853333-42853355 CACATGGTGGAGATAAGGGAAGG + Intronic
949252692 3:2006619-2006641 GAAACAGAGGAGATTAGGGCTGG + Intergenic
949333987 3:2953454-2953476 CAAATGGAGAAGAAGTGGCCTGG - Intronic
949507060 3:4738300-4738322 CAAATAAAAGAAATGAGGGCAGG + Intronic
952719388 3:36516276-36516298 CAAAGGGAAAATATGAGGGCTGG - Intronic
953673878 3:44985111-44985133 CACATGGAGGTGGAGAGGGCTGG + Intronic
953920595 3:46948777-46948799 CACATGGAGGATATCTGGGCAGG - Intronic
954088240 3:48264088-48264110 CAGATGGAGCAAATGAAGGCTGG + Intronic
954112222 3:48440447-48440469 GAGATGGACGAGGTGAGGGCGGG + Exonic
954933269 3:54302852-54302874 CAGAAAGAGGAGATGAGAGCAGG - Intronic
955803958 3:62714497-62714519 CAAAGGGAAGACATGAGGGTGGG + Intronic
958054917 3:88396980-88397002 AAAAGGGAGGAGTTGAGGGATGG + Intergenic
958195707 3:90239756-90239778 AAAATAGAGGAAATGAGGCCTGG + Intergenic
958450754 3:94269557-94269579 GAAAGGGAGGAGATCAGAGCGGG + Intergenic
958952993 3:100436491-100436513 CAGAGGGAGGAGATGAGGGAGGG - Intronic
959920813 3:111866311-111866333 CAAATTGAGTACATGAGGCCGGG - Intronic
960581071 3:119279413-119279435 AAAAGGGAGGAGATGGGGGAAGG - Intergenic
962091744 3:132251592-132251614 CAAATGGAGCAAATGAAGGGAGG + Intronic
962364920 3:134772507-134772529 AAAATGGAGGAGAAGAGGGGAGG - Intronic
962444572 3:135453118-135453140 CAAGAGGAGGTGAAGAGGGCGGG - Intergenic
962778322 3:138685907-138685929 CAAGTGGATGAGTTGAGGCCAGG + Intronic
963166652 3:142211181-142211203 CAAATGGTGGTGAGGTGGGCTGG + Intronic
965793565 3:172414313-172414335 GAACTGGAGGAGAGGAGGACAGG + Intergenic
968165371 3:196460460-196460482 AGAATGTAGGAGTTGAGGGCTGG - Intergenic
968815030 4:2817754-2817776 AAAGTGGAGAAGGTGAGGGCGGG + Intronic
969152965 4:5186174-5186196 CTGATGGAGGAGGTGAGGCCTGG - Intronic
970964316 4:21910178-21910200 CAAAAGAAGGAGATGAGGTCAGG + Intronic
971268221 4:25113248-25113270 CAACTGGAGGAGGTGGGGGCGGG + Intergenic
972300960 4:37785199-37785221 CAACTGGAGTAGATGAGTGCTGG - Intergenic
972343723 4:38175470-38175492 TAAATGGAGGAGATGAAGGAAGG + Intergenic
972457007 4:39264609-39264631 AAAATGGAGGAGATGATCACTGG - Intronic
972576632 4:40357931-40357953 CAAATGGAGGAGAGGAAAGATGG - Intergenic
972578185 4:40371279-40371301 GAAATTGAGGAGATGTTGGCCGG + Intergenic
973897068 4:55423839-55423861 CAAAAGGAGGTCATGAGGGTAGG - Intronic
977295276 4:95202689-95202711 CAGGTGGAGGTGAAGAGGGCAGG + Intronic
979096230 4:116554031-116554053 CAGAGGGAGGATATAAGGGCTGG - Intergenic
980464331 4:133152795-133152817 CTGATGGAGGAGATGAGAGATGG - Intronic
980688219 4:136257891-136257913 CCAATGTTGGAGATGAGGCCTGG + Intergenic
981204863 4:142028394-142028416 CAAATGGAAGAGAGGAGAGGGGG - Exonic
981666387 4:147231377-147231399 CAAATGGAGTAGTTAAGGGTTGG + Intergenic
982236677 4:153257498-153257520 AAAATGGAGGAAATGAGAGAAGG - Intronic
982283977 4:153715436-153715458 AAGATGGAGGAGATGGGGACAGG + Intronic
983284818 4:165726105-165726127 CACATGGAGGCGATCAGGGGAGG - Intergenic
984785767 4:183566041-183566063 AGAATGGAGGAAATGAGGGAAGG + Intergenic
985410062 4:189674362-189674384 CTAATGGAAGAGATGAAGGCTGG - Intergenic
985793752 5:1947049-1947071 AAGGTGGGGGAGATGAGGGCCGG - Intergenic
986015706 5:3755023-3755045 CCAAGGCAGGAGAGGAGGGCAGG + Intergenic
986301432 5:6481365-6481387 CCCATGCAGGAGGTGAGGGCGGG + Intronic
987865225 5:23528016-23528038 AAAATGGAGGGGATCAGTGCGGG - Exonic
988699296 5:33657329-33657351 CAAAGGGAGGAGATCCAGGCTGG + Intronic
989119969 5:37995184-37995206 CATATGTAGAAGATGAGGGCGGG + Intergenic
991975714 5:72182158-72182180 AAAATAGAGGTGATGAAGGCCGG - Intronic
992208450 5:74453711-74453733 CCTGTGGAGGAGATGAGTGCTGG + Intergenic
994546849 5:101177499-101177521 CCAATGGTGGAGATGGGGCCTGG + Intergenic
995021216 5:107369343-107369365 CAAATATAGGATAAGAGGGCTGG - Intergenic
995182438 5:109241406-109241428 GAAATGGAGGAGTAGAGGGGAGG - Intergenic
995862176 5:116652381-116652403 CAAATGGAGGAAAGGAGTGATGG - Intergenic
997356702 5:133267168-133267190 AAAAGGGAGGAGATGGGGTCTGG + Intronic
998568990 5:143240233-143240255 CAAATGGAGCAGCAGAGGGAAGG - Intergenic
999189088 5:149732952-149732974 CAGATGGAGGAAATGAGGCTCGG - Intronic
1001384609 5:171328515-171328537 CACATGGTGGAGATGAGGAAGGG - Intergenic
1001692710 5:173644698-173644720 AAAATGGAGGGGAGGAGGGCTGG - Intergenic
1001782668 5:174383623-174383645 CAGATGGAGGTAGTGAGGGCAGG - Intergenic
1002767824 6:257950-257972 CCCATGGAGGAGAGGAGGGCAGG + Intergenic
1002968132 6:1988418-1988440 CAAAGGGAGGAGATGAGGGTGGG - Intronic
1003007083 6:2392200-2392222 CAAATGCAGGAAAGGAGGGCAGG + Intergenic
1003095968 6:3143914-3143936 CAAAGGCAGGAGCTGAGGGGTGG - Intronic
1003671198 6:8161974-8161996 CCAATGCTGGAGATGAGGCCTGG - Intergenic
1006213478 6:32417582-32417604 CAAATGCAAGAGATGAGTCCTGG + Intergenic
1007648839 6:43404090-43404112 CGAATCAAGGTGATGAGGGCTGG - Intergenic
1007718884 6:43873667-43873689 CGAGTGGAGGAGCTGAGGTCAGG + Intergenic
1007962660 6:45974588-45974610 CATAGAGAGGAGTTGAGGGCAGG + Intronic
1008280361 6:49588905-49588927 CCAATGTTGGAGATGAGGCCTGG + Intergenic
1009673730 6:66788859-66788881 CCACTGGGGGATATGAGGGCAGG + Intergenic
1010941780 6:81927600-81927622 AAAATGGAAGAGATCAGTGCAGG + Intergenic
1012503421 6:99916247-99916269 AAAATTGAGGAGAGGAGGCCCGG + Intergenic
1013194198 6:107831144-107831166 GAAAAGGAAGAGATGAGGGGAGG + Intergenic
1013473033 6:110482424-110482446 CCAATGTTGGAGGTGAGGGCTGG - Intergenic
1015846250 6:137523685-137523707 CAAGTGCAGGAGATGGGGGCGGG - Intergenic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1017208575 6:151830283-151830305 CAAATGGAGGAGAAGAGAAGGGG - Intronic
1017506728 6:155075136-155075158 TAAATGTAGGAGGTGAGGGGAGG + Intronic
1017579714 6:155850401-155850423 GGAATGGTGGAGAGGAGGGCAGG - Intergenic
1018234654 6:161712320-161712342 CAACTGGATGAAATGTGGGCAGG + Intronic
1018291784 6:162298836-162298858 CAGGTGGAGGAGGGGAGGGCTGG + Intronic
1018560629 6:165098145-165098167 CTAAGGGAGGAGGGGAGGGCCGG - Intergenic
1019042898 6:169120990-169121012 CTAATGGAGGAGAGGGGGTCTGG - Intergenic
1019137342 6:169918545-169918567 CAAAGTGAGGAGGTCAGGGCTGG + Intergenic
1019701927 7:2478266-2478288 CAAAGCGAGGGGATGACGGCCGG - Intergenic
1019738170 7:2660567-2660589 CAAGGGGAGGGGATGGGGGCGGG - Intronic
1019776619 7:2915370-2915392 GAACTGGAGGAGAAGAGGGAGGG + Exonic
1022245757 7:28557686-28557708 CACTTGGAAGAGATGAGGGAAGG + Intronic
1023779100 7:43639523-43639545 CATATGGTAGAGATGAGGGAAGG + Exonic
1023865933 7:44238474-44238496 CAAATGGAGAAGACGTGGGAGGG + Intronic
1024360748 7:48464890-48464912 CAAATGGAGCAGAGGAGGCAGGG + Intronic
1024464846 7:49701081-49701103 CAAGTGCAGGAGCGGAGGGCGGG + Intergenic
1025480891 7:60981577-60981599 AAAAAGGAGGAAATGAGGGAAGG + Intergenic
1026623384 7:71971151-71971173 CAAAGAAAGGAGATGAGGCCAGG + Intronic
1026849952 7:73718306-73718328 CAAGTGGGGGACATGAAGGCAGG + Intronic
1027677629 7:81179743-81179765 CCAATGATGGAGATGAGGCCTGG + Intronic
1027677891 7:81181794-81181816 CCAATGCTGGAGATGAGGCCTGG + Intronic
1029687366 7:102158007-102158029 CAACTGGAGGTGAGGAGGGCAGG - Intronic
1030636779 7:111959061-111959083 CAAATGATGGAGAAGAGGGAGGG + Intronic
1031262915 7:119545636-119545658 CAAATGGAGGAAATGTGGGAGGG - Intergenic
1031543367 7:123023322-123023344 CAGATAGAGGAGATGGGGGTTGG + Intergenic
1032817606 7:135493147-135493169 CAAATGGAGTAGGTCAGAGCAGG + Intronic
1033655399 7:143370261-143370283 GAAATGGAGAAGATGAGTGCCGG - Intergenic
1034013888 7:147560734-147560756 CAAAGGGAGGAAATGAGGGAGGG + Intronic
1034608244 7:152338152-152338174 GAAATTGAGTAGGTGAGGGCTGG - Intronic
1035101989 7:156406314-156406336 CAAATGGAAGTGATGATAGCAGG + Intergenic
1036180365 8:6579293-6579315 CAAATGGAGGAGAAGGGGACCGG - Intronic
1036283932 8:7426804-7426826 CAAAGAGAGGAGAAAAGGGCTGG - Intergenic
1036337543 8:7884726-7884748 CAAAGAGAGGAGAAAAGGGCTGG + Intergenic
1037098951 8:15019133-15019155 CAACTGGATGAGATTTGGGCAGG + Intronic
1038234804 8:25742318-25742340 CACATGGAAGACAAGAGGGCCGG - Intergenic
1039076097 8:33691784-33691806 CCAATGTTGGAGATGAGGCCTGG + Intergenic
1043631675 8:82342935-82342957 GAAATGGATGAGATGATGGTGGG + Intergenic
1044181268 8:89198230-89198252 GAAAAGGAGGTGATGATGGCTGG - Intergenic
1045724831 8:105159995-105160017 AAAGAGGAGGAGAAGAGGGCAGG + Intronic
1045768431 8:105704973-105704995 CAAATGGAGGACAAGATGACAGG + Intronic
1046971085 8:120224009-120224031 AAAAAAAAGGAGATGAGGGCAGG - Intronic
1047247845 8:123160407-123160429 AAAAGGGAGGAGAGGAGGGGAGG + Intergenic
1047456625 8:125019287-125019309 GAAATGGAGGAAAAGAGGCCAGG + Intronic
1049372939 8:142276320-142276342 CCAATGGAGGAGGAGAGGGAAGG + Intronic
1049477237 8:142802345-142802367 CAAATGGTGGAGAGAAGGGATGG + Intergenic
1051729971 9:20130955-20130977 CCCATGCAGGAGATAAGGGCAGG - Intergenic
1051784223 9:20724118-20724140 TAAATGTTGGAGATGAGGCCTGG - Intronic
1054408538 9:64785488-64785510 AAGAAGGAGGAGATGAGGGAAGG - Intergenic
1054488592 9:65752198-65752220 AAGAAGGAGGAGATGAGGGAAGG + Intergenic
1054777488 9:69135831-69135853 CAAATGGATCACATGAGGCCAGG - Intronic
1054840352 9:69731724-69731746 GAAAAGGGGGAGAGGAGGGCAGG - Intronic
1055193917 9:73563400-73563422 CAAATGGTTGAGATGAGTGGTGG - Intergenic
1055742946 9:79409592-79409614 CAAATGGAATAGATGAGTTCAGG + Intergenic
1056171329 9:83987871-83987893 CAAATGAAGGACATGTGGGTGGG + Intronic
1058189536 9:101896041-101896063 CAAATGGAAGAAAAGAGGGCAGG - Intergenic
1061005967 9:127928567-127928589 CAATTGGAGGAGGTGGGGGACGG - Intronic
1203661512 Un_KI270753v1:48045-48067 CTAATGGAAGAGATGAAGGCTGG + Intergenic
1203672695 Un_KI270755v1:31118-31140 CTAATGGAAGAGATGAAGGCTGG + Intergenic
1185638154 X:1570253-1570275 AAAATGGACAAGATGATGGCTGG + Intergenic
1186270960 X:7887676-7887698 AAAATGGAAGAAATGAGGGATGG - Intergenic
1186591558 X:10935371-10935393 CAAGTGGAGGTGATGAGAGCGGG - Intergenic
1186699468 X:12074341-12074363 CAACACAAGGAGATGAGGGCTGG - Intergenic
1188619596 X:32203658-32203680 CAAATGGAGGACATGAGCATTGG - Intronic
1188811132 X:34656040-34656062 CAAATGGATAAGATGGGGGTGGG - Intronic
1189337658 X:40180093-40180115 CAGATGGAGGAGATGAGTTTGGG - Intergenic
1189588692 X:42488823-42488845 CAAATGAAGGAAAAGATGGCTGG - Intergenic
1190708288 X:53048515-53048537 CAAATCGAGGAGAGGGGGGACGG + Intergenic
1190797754 X:53760310-53760332 CCAATGGGGGAGCTGAGGGCAGG - Intergenic
1190917402 X:54820904-54820926 CCAATGGGGGAGCTGAGGGCAGG + Intergenic
1190931204 X:54950854-54950876 CCAGTGGGGGAGCTGAGGGCAGG + Intronic
1192496510 X:71619918-71619940 CAAAGGGGAGAGCTGAGGGCAGG - Intergenic
1195244611 X:102984000-102984022 GAAATGGAGGATAGGAGGGTTGG - Intergenic
1195755954 X:108198888-108198910 AAAATGGAATAGATGAGGGGAGG - Intronic
1197164812 X:123365430-123365452 GAAATGGTGTAGATGAGGCCAGG + Intronic
1198573847 X:137988265-137988287 CAAGTGGAGAAGCTGAGGTCTGG + Intergenic
1199261247 X:145778290-145778312 CCAATGTTGGAGATGAGGCCTGG + Intergenic
1200058617 X:153474287-153474309 CAACTGCAGGAGGTGAGGGTGGG - Intronic
1200204837 X:154308389-154308411 GAAATGGAGGTGATGGGGGCTGG + Intronic
1201433981 Y:13936887-13936909 CAAATCAAGGAGATATGGGCAGG - Intergenic
1201550114 Y:15210420-15210442 GAAAAGGAGGAAATGAGGGAGGG + Intergenic