ID: 1152532547

View in Genome Browser
Species Human (GRCh38)
Location 17:80927833-80927855
Sequence TGTGCAAATGGAGGAGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 372}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152532547_1152532552 3 Left 1152532547 17:80927833-80927855 CCCTCATCTCCTCCATTTGCACA 0: 1
1: 0
2: 3
3: 45
4: 372
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532547_1152532557 13 Left 1152532547 17:80927833-80927855 CCCTCATCTCCTCCATTTGCACA 0: 1
1: 0
2: 3
3: 45
4: 372
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1152532547_1152532551 0 Left 1152532547 17:80927833-80927855 CCCTCATCTCCTCCATTTGCACA 0: 1
1: 0
2: 3
3: 45
4: 372
Right 1152532551 17:80927856-80927878 TCTGAGAATTCCCGCCCGCACGG 0: 1
1: 0
2: 0
3: 2
4: 43
1152532547_1152532556 12 Left 1152532547 17:80927833-80927855 CCCTCATCTCCTCCATTTGCACA 0: 1
1: 0
2: 3
3: 45
4: 372
Right 1152532556 17:80927868-80927890 CGCCCGCACGGAGGAGCTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 157
1152532547_1152532560 27 Left 1152532547 17:80927833-80927855 CCCTCATCTCCTCCATTTGCACA 0: 1
1: 0
2: 3
3: 45
4: 372
Right 1152532560 17:80927883-80927905 GCTGGAGGGTGTCAGCCTTGTGG 0: 1
1: 0
2: 0
3: 22
4: 260
1152532547_1152532553 9 Left 1152532547 17:80927833-80927855 CCCTCATCTCCTCCATTTGCACA 0: 1
1: 0
2: 3
3: 45
4: 372
Right 1152532553 17:80927865-80927887 TCCCGCCCGCACGGAGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152532547 Original CRISPR TGTGCAAATGGAGGAGATGA GGG (reversed) Intronic