ID: 1152532547

View in Genome Browser
Species Human (GRCh38)
Location 17:80927833-80927855
Sequence TGTGCAAATGGAGGAGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 372}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152532547_1152532556 12 Left 1152532547 17:80927833-80927855 CCCTCATCTCCTCCATTTGCACA 0: 1
1: 0
2: 3
3: 45
4: 372
Right 1152532556 17:80927868-80927890 CGCCCGCACGGAGGAGCTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 157
1152532547_1152532552 3 Left 1152532547 17:80927833-80927855 CCCTCATCTCCTCCATTTGCACA 0: 1
1: 0
2: 3
3: 45
4: 372
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532547_1152532553 9 Left 1152532547 17:80927833-80927855 CCCTCATCTCCTCCATTTGCACA 0: 1
1: 0
2: 3
3: 45
4: 372
Right 1152532553 17:80927865-80927887 TCCCGCCCGCACGGAGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 358
1152532547_1152532560 27 Left 1152532547 17:80927833-80927855 CCCTCATCTCCTCCATTTGCACA 0: 1
1: 0
2: 3
3: 45
4: 372
Right 1152532560 17:80927883-80927905 GCTGGAGGGTGTCAGCCTTGTGG 0: 1
1: 0
2: 0
3: 22
4: 260
1152532547_1152532551 0 Left 1152532547 17:80927833-80927855 CCCTCATCTCCTCCATTTGCACA 0: 1
1: 0
2: 3
3: 45
4: 372
Right 1152532551 17:80927856-80927878 TCTGAGAATTCCCGCCCGCACGG 0: 1
1: 0
2: 0
3: 2
4: 43
1152532547_1152532557 13 Left 1152532547 17:80927833-80927855 CCCTCATCTCCTCCATTTGCACA 0: 1
1: 0
2: 3
3: 45
4: 372
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152532547 Original CRISPR TGTGCAAATGGAGGAGATGA GGG (reversed) Intronic
900787637 1:4658696-4658718 TGGCCAAGTGGAGGAGCTGATGG + Intronic
900797369 1:4716676-4716698 GGTGGAAATGGTGGTGATGATGG + Intronic
900975165 1:6012137-6012159 GGTGGAAGTGGAGGTGATGAAGG + Intronic
903169095 1:21541163-21541185 TGGGCAAGTGGGGCAGATGAGGG - Intronic
904252423 1:29234699-29234721 TGTGCAAAGGCAGGAGCTGGTGG - Intergenic
904673939 1:32186290-32186312 TGTGTGACTGGAGGAGAGGACGG + Intronic
905327628 1:37168833-37168855 TCTGCACAAGCAGGAGATGAAGG - Intergenic
905636704 1:39558796-39558818 TGAGCACAGGGAGGAGAGGAAGG + Intergenic
906522179 1:46474159-46474181 AGTGCTGATGGAGGAGGTGAAGG + Intergenic
908481476 1:64544484-64544506 TTTGGTAAGGGAGGAGATGATGG + Intronic
908498809 1:64722402-64722424 TGTTCAAATAGAGGAGGTAAGGG + Intergenic
908510728 1:64848156-64848178 TCTGCAAATGGAGGTAATAATGG + Intronic
911494253 1:98611382-98611404 TGTAAAAATGGAGAAGAGGAAGG + Intergenic
911526331 1:98991405-98991427 TTTGCAAATGGAGTAGAAAATGG - Intronic
912299740 1:108502670-108502692 AGAGAAAACGGAGGAGATGATGG + Intergenic
912622408 1:111176110-111176132 TGTGAAGGGGGAGGAGATGAAGG + Intronic
912777746 1:112516494-112516516 TGTGAAGATGGAAGAGCTGAAGG + Intronic
917412851 1:174777925-174777947 TGTGTAATTGGAGGACCTGAAGG + Intronic
918239036 1:182605676-182605698 TGGGCAGAGGGAGGAGTTGAAGG + Intergenic
919000005 1:191818475-191818497 TGTCCAAGTGCAGGAGAAGATGG + Intergenic
919172356 1:193971073-193971095 AATGCAAGTGGAGGAGAAGAAGG + Intergenic
920245614 1:204585443-204585465 GGTGCAGATGGAGGGGATGCGGG - Intergenic
920410497 1:205756254-205756276 TGGGAAAAATGAGGAGATGATGG - Intergenic
921972896 1:221169734-221169756 TGTGGAAATGGGGGAGGGGAGGG - Intergenic
922356051 1:224776830-224776852 TCTCCAAATGGAGGAAAAGATGG + Intergenic
922378108 1:224990451-224990473 AGGGGAAATGGAGGAGATTATGG - Intronic
923389402 1:233499076-233499098 TGTGCAAGGGGAGGAGAGGTAGG - Intergenic
924861850 1:247933355-247933377 TGTGAAAATGGAGCAGAGCAAGG + Intergenic
1063144266 10:3282531-3282553 GGAGCCAAAGGAGGAGATGAAGG - Intergenic
1064329352 10:14379299-14379321 TGTGGGAAGGGAGGAGATGGAGG - Intronic
1064499834 10:15958609-15958631 TTTGCAAATGAAGGAAATAATGG + Intergenic
1065818687 10:29506144-29506166 TGCGGAACTGGAAGAGATGAAGG + Intronic
1065954232 10:30678252-30678274 TGCGGAACTGGAAGAGATGAAGG - Intergenic
1067016668 10:42761391-42761413 TGTGGAAATTGAGGCCATGAAGG + Intergenic
1067906233 10:50294363-50294385 TGTGAAGATGCAGGAGATGTTGG - Intergenic
1067907990 10:50314285-50314307 TGTTTAAATGGAGGGGATGGGGG + Intronic
1068079775 10:52306027-52306049 TGTGCAAGGGTAGGAGAAGATGG - Intergenic
1069760235 10:70805435-70805457 GGTGGAAATGGGGGAGATGAAGG + Intergenic
1070639549 10:78157872-78157894 TGTCCAATTGCAAGAGATGAGGG + Intergenic
1071164560 10:82790001-82790023 AGTGCAAAAGGAGGAGAAAATGG - Intronic
1072256862 10:93629519-93629541 TGAGCAAATGGAGGAGTGGCAGG - Intronic
1074010123 10:109469824-109469846 TGTGCAAATGAAACAAATGATGG + Intergenic
1074934515 10:118164496-118164518 AGTGCACACGGAGGTGATGATGG - Intergenic
1075077035 10:119358558-119358580 TGTGGAAGAGGAGCAGATGAGGG - Intronic
1075093014 10:119453918-119453940 TGGGCCAATGGAGGAAATGCGGG + Intronic
1075239852 10:120768405-120768427 TATGCAAATGGCAGAGATGCTGG - Intergenic
1076842700 10:133053858-133053880 TGGGCACATGGATGAGCTGATGG + Intergenic
1077702373 11:4454282-4454304 TTTGCAAAGGGAGGAGGGGAGGG - Intergenic
1078435311 11:11320314-11320336 TGTACAACTGCAGGAGATGGAGG - Intronic
1078447882 11:11418455-11418477 TGGGTAAATGGAGATGATGATGG - Intronic
1079166792 11:18051644-18051666 TGTGCTAATTGATGGGATGAAGG - Intergenic
1079571350 11:21947222-21947244 TAAGCCAATGGATGAGATGAAGG - Intergenic
1080821511 11:35811124-35811146 TGTGGTAATGCTGGAGATGATGG + Exonic
1082194029 11:49280321-49280343 TGTCCAAAGGCAGGAGAAGAAGG + Intergenic
1083417855 11:62536846-62536868 TGTGAAAATGGAGGCAATAAAGG + Intronic
1084726413 11:70945331-70945353 TGAGCAGAGGGAGGAGGTGAAGG + Intronic
1085443113 11:76580635-76580657 TGTGTATATGGAGGAGAGGATGG + Intergenic
1086079495 11:82888777-82888799 TGTGTATATGGAGGAGGGGAAGG - Intronic
1086466292 11:87057230-87057252 TTTGAAAATGTAGGAGAGGAAGG + Intronic
1086672121 11:89560720-89560742 TGTCCAAAGGCAGGAGAAGAAGG - Intergenic
1087424514 11:97970499-97970521 GGTGGAACTGGAGGAGCTGAAGG + Intergenic
1088510083 11:110565188-110565210 TCTGGAGAGGGAGGAGATGAGGG + Intergenic
1088916969 11:114234881-114234903 GGGGCAAAGGGAGGAGAAGATGG + Intronic
1090466656 11:126940886-126940908 GATGCAGATGGAGGAGATGAAGG - Intronic
1090658480 11:128863265-128863287 TGTGCAACTGGAGCAGAGGGAGG + Intronic
1090878650 11:130814081-130814103 TGTCCAAAGGTAGGAGAGGAAGG - Intergenic
1090900223 11:131024084-131024106 TCTGGAAATGGACGTGATGATGG + Intergenic
1090944999 11:131421590-131421612 AGGGCCCATGGAGGAGATGACGG + Intronic
1091023417 11:132121434-132121456 TGATGAAATGCAGGAGATGAGGG + Intronic
1091762521 12:3096580-3096602 TGGGGAAATGGATGAGATTAGGG - Intronic
1092519003 12:9247144-9247166 GGTGCAAATGACTGAGATGATGG + Intergenic
1092966645 12:13650202-13650224 TGTCCACATGGAGGAGAGGAAGG - Intronic
1092990815 12:13897299-13897321 TGTGCTAATGGAGTAAGTGATGG - Intronic
1093201179 12:16188081-16188103 TGTAGAAATTAAGGAGATGAAGG + Intergenic
1093595315 12:20951849-20951871 GGTGGAACTGGAGGAGTTGATGG + Intergenic
1094077378 12:26491990-26492012 TGTGGAAATGAAGGAGGTCAGGG + Intronic
1094360238 12:29622787-29622809 TGAGTAGAAGGAGGAGATGAAGG + Intronic
1095757628 12:45786984-45787006 TGTGGAGATGGGGGAGATGTCGG + Intronic
1096585158 12:52615151-52615173 AGTGCTGAAGGAGGAGATGAAGG - Intronic
1096974398 12:55691326-55691348 TGGGGAGATGGAGGAGATGGTGG + Intronic
1097277255 12:57821971-57821993 TGTGGCAATGGAAGGGATGATGG + Exonic
1097755379 12:63401590-63401612 TAAGCAAATAGAGGAGATTATGG + Intergenic
1098161611 12:67650779-67650801 TCTGCACTTGGAGGAGGTGATGG + Intronic
1100352750 12:93800281-93800303 TGCCCAAATGCAGGAGAGGATGG + Intronic
1100397871 12:94200367-94200389 TTTGGATATGGAGGAGATGCTGG - Intronic
1101222284 12:102654222-102654244 TCTGCAGCTGCAGGAGATGAAGG - Intergenic
1101428722 12:104608800-104608822 CCTCCAAATGGAGTAGATGAGGG - Intronic
1101576393 12:106000987-106001009 TCTGCAGATGGAGGAGCTGATGG - Intergenic
1101578082 12:106016208-106016230 AGAGATAATGGAGGAGATGATGG + Intergenic
1101664734 12:106801879-106801901 TGTGTACATGCAGAAGATGAGGG - Intronic
1101727865 12:107403017-107403039 GGAGCAGATGGAGGAGAAGAAGG - Intronic
1101730334 12:107421796-107421818 TGTGCAGATGGAGAAACTGATGG + Intronic
1101755487 12:107617974-107617996 TTTGGGGATGGAGGAGATGATGG - Intronic
1101818968 12:108168400-108168422 TGACCTAATGGAGGAGATGGGGG - Intronic
1101921744 12:108938677-108938699 CGTGCACATGGAGCAGATGAGGG - Intronic
1102014822 12:109641121-109641143 TGTGCACATGCTGGGGATGACGG + Intergenic
1102927760 12:116839623-116839645 TGTCCAAGTGGAGGAGTGGATGG + Intronic
1103302304 12:119937418-119937440 AGTGAAAATGGATGAGGTGATGG - Intergenic
1103964931 12:124632654-124632676 TGTGCAAAGAGAGGAGAGGGAGG - Intergenic
1104158287 12:126154118-126154140 TGTCCAAAGGCAGGAGAAGATGG - Intergenic
1104315600 12:127697179-127697201 GGTGATAATGGAGGTGATGATGG + Intergenic
1104644401 12:130486626-130486648 TTTGCATCTGGAGGAGCTGAGGG - Intronic
1106388958 13:29316740-29316762 TTTGCAAATGAAGGAACTGAAGG - Intronic
1108243354 13:48490356-48490378 TAGGCAAGTGGAGGAAATGATGG + Intronic
1109945065 13:69422045-69422067 CATGCAAATGGAGGTGATGCTGG - Intergenic
1111583847 13:90259775-90259797 TATGTAAATGGAGGCAATGAAGG - Intergenic
1112811746 13:103226131-103226153 TCTGGAAAAGGAGGGGATGATGG + Intergenic
1113209312 13:107956836-107956858 TATGTACATGGAGGAGAGGAAGG - Intergenic
1113722325 13:112568598-112568620 TGTCCAAGTGGAGTAGATGTTGG - Intronic
1114050927 14:18919411-18919433 TGGGTAGATGGAGGAGAAGAGGG - Intergenic
1114111632 14:19482511-19482533 TGGGTAGATGGAGGAGAAGAGGG + Intergenic
1114214015 14:20641920-20641942 TGTGAAGATGGAGGAGATGGAGG - Intergenic
1114567716 14:23644803-23644825 TGGGCAAAGGGAAGAAATGAAGG - Intronic
1115136988 14:30122101-30122123 TTTACAAATGAAGGAGTTGAAGG + Intronic
1115371239 14:32617067-32617089 AGTGCAAATGGAGAAGAGGCAGG - Intronic
1115456536 14:33610357-33610379 TTTGCACAATGAGGAGATGATGG - Intronic
1115732113 14:36282010-36282032 TGTGCTATTTGAGTAGATGATGG + Intergenic
1118260893 14:64245675-64245697 TGTGCAAATGGGAAAGATGAAGG - Intronic
1118873135 14:69760031-69760053 TGTGCTAATGATGGAGATGCTGG + Intronic
1121407221 14:93726321-93726343 TGTGGGGATGGAGGAGATGGAGG + Intronic
1121653351 14:95576306-95576328 TATGCTAATGGAGGAGATAAAGG - Intergenic
1123203231 14:106687092-106687114 TGTGCAAGAGGAGCACATGAGGG - Intergenic
1124208568 15:27743776-27743798 TGTGCAGTTGGAGAAGCTGACGG + Intergenic
1125167464 15:36724784-36724806 TGTTCAAATGCAAGAGATGAAGG - Intronic
1125265523 15:37875905-37875927 TCTGCAAATGATGGAGATGGAGG - Intergenic
1125858695 15:42976759-42976781 TGATCAAATGGAAGAGATAAAGG + Exonic
1126364138 15:47876521-47876543 TGTGTAGATGGAGGAGAGGAAGG - Intergenic
1126564968 15:50085314-50085336 CGTTAAAGTGGAGGAGATGATGG - Intronic
1127713504 15:61624826-61624848 TGTCCAAATGGAGGAGAAGGTGG + Intergenic
1128337811 15:66798678-66798700 TGGGCAAATGTAGGTGATGCTGG + Intergenic
1129625529 15:77194451-77194473 AGTGGACATGGAGGAGATAATGG - Intronic
1130760618 15:86815670-86815692 TGTGGACTGGGAGGAGATGAGGG + Intronic
1130939351 15:88494839-88494861 AGTGCAAACAGAGGAGCTGAAGG - Intergenic
1134341411 16:13350191-13350213 TGTCCAAAGGCAGGAGAAGAAGG - Intergenic
1134743449 16:16569215-16569237 TGAGCTAAGGGAGGAGAGGAGGG - Intergenic
1134821977 16:17254246-17254268 TGAGGAAAAGGAGGAGAAGAAGG - Intronic
1134924106 16:18143246-18143268 TGAGCTAAGGGAGGAGAGGAGGG + Intergenic
1136016302 16:27403243-27403265 TGTGCATGTGGAGGAGAGGAGGG + Intronic
1138520806 16:57569885-57569907 AGTGCAGGTGGAGGAGATGATGG - Intronic
1141105378 16:81229142-81229164 TCCGCAAAAGGAGGAGGTGAAGG + Intergenic
1142706394 17:1697687-1697709 TGGGGAGATGGAGGAGATGGGGG - Intergenic
1143768836 17:9154975-9154997 TGTGCAAATGCAGGCTCTGATGG - Intronic
1143978307 17:10846475-10846497 GGTGGAAATGGAGGTGATGGTGG + Intergenic
1143982632 17:10883228-10883250 TGAGGCAATGGAGGAGTTGAGGG + Intergenic
1144149970 17:12433896-12433918 TATGCATATGGAGGAGGGGATGG - Intergenic
1144335649 17:14266921-14266943 GGTACACATGGAGGAAATGAAGG - Intergenic
1144453269 17:15398685-15398707 TGTGCAGATGGAGGAGGAAATGG + Intergenic
1144757261 17:17687210-17687232 TGTGCAGAGGCAGGAGAGGAGGG + Intronic
1145025611 17:19465878-19465900 TGTGCAAATGAAGGGGATTAAGG + Intergenic
1145209465 17:21002806-21002828 TTTGAAGATGGATGAGATGAGGG - Exonic
1145994537 17:29097842-29097864 TATGGAAATGGAGGTGATGGAGG - Exonic
1148234139 17:45956184-45956206 TGTGCAAAGGAATGAGCTGAAGG + Intronic
1148524403 17:48316963-48316985 TGTGATAAGGGAGAAGATGAAGG - Intronic
1149325978 17:55530339-55530361 TGTGTAAATGGCAGAGAGGAAGG - Intergenic
1150174279 17:63033745-63033767 TGTGAAATTTGAGGTGATGATGG + Intronic
1151546580 17:74796964-74796986 TGGGCAGAAGGAGGGGATGAAGG + Intronic
1151716838 17:75835402-75835424 TGTGCAGATGGATGAGGTGGGGG - Exonic
1151935249 17:77257287-77257309 TGATAAAATGGAGGAGATGATGG - Intergenic
1152532547 17:80927833-80927855 TGTGCAAATGGAGGAGATGAGGG - Intronic
1153432303 18:5030990-5031012 TGTCCAAAGGCAGGAGAAGATGG + Intergenic
1155237115 18:23831542-23831564 TGAGCTAGTCGAGGAGATGAGGG - Intronic
1156305269 18:35873361-35873383 GGTGGAACTGGAGGAGCTGATGG - Intergenic
1156943533 18:42798693-42798715 GGTGCCAATGGTGGAGAGGAGGG - Intronic
1157287388 18:46386301-46386323 TGTACAAATGTCAGAGATGAAGG - Intronic
1157995585 18:52551166-52551188 TGTGCCAATGATGGAGATCATGG + Intronic
1158377794 18:56891171-56891193 TTTTCAAATGGAAGAGATAACGG + Intronic
1159566573 18:70057755-70057777 TGTTCAGCTGGAGGTGATGAAGG + Exonic
1160307677 18:77755327-77755349 TTTGCAAATGGAGATGATGCAGG + Intergenic
1162080812 19:8216644-8216666 TCTGGACATGGTGGAGATGAGGG - Intronic
1162465061 19:10834933-10834955 TGTTAAAATGGAGGACATCAAGG - Exonic
1162903210 19:13807671-13807693 TGAGCAAATGGATGAGCTGGTGG + Intronic
1165984764 19:39758346-39758368 TGTGAAAATGGTGCAGGTGAAGG + Intergenic
1166976737 19:46609353-46609375 AGGGCAAAAGGAAGAGATGAGGG - Exonic
1167197906 19:48043536-48043558 TGTGATAATGGTGGTGATGATGG - Intronic
1168130153 19:54312596-54312618 TGTGCAGATGGATGAGACCATGG + Exonic
924963319 2:54416-54438 TGTGCATATGGAAGAGGAGATGG + Intergenic
925102536 2:1260440-1260462 TATGGTAATGAAGGAGATGAAGG + Intronic
926438873 2:12866304-12866326 TGTGAAAATGGAAGAGAAGATGG - Intergenic
928062961 2:28133577-28133599 TATGCCCATGGAGGAGATGGTGG - Intronic
928608106 2:32962954-32962976 TGTGGAAAGGGAGGAGGAGATGG - Intronic
928879887 2:36086432-36086454 TGTCCATGTGGAGGAGAGGAAGG + Intergenic
929180304 2:39030924-39030946 TGTGCAGATGGAGGCAAAGACGG + Intronic
929583170 2:43097297-43097319 GGGGCAAACTGAGGAGATGATGG + Intergenic
929859094 2:45660478-45660500 TCTGCAAATGGAGGACAAGTGGG - Intronic
929918647 2:46156515-46156537 TGTGCAAAGGAAGGAGAGAAGGG + Intronic
930173195 2:48272860-48272882 TGAATAAATGGAGGAAATGAAGG + Intergenic
931768050 2:65474300-65474322 TTTCCAAATTGGGGAGATGATGG - Intergenic
933311769 2:80669416-80669438 TGTGCTGATGGTGGTGATGATGG + Intergenic
934591631 2:95556784-95556806 TGTGCTAATGGAGTAGAGGCAGG - Intergenic
935204309 2:100884266-100884288 TGGTCAACGGGAGGAGATGAGGG - Intronic
935312831 2:101802449-101802471 TGTGTAGAAGGAGGAGAGGAGGG - Intronic
936051109 2:109224177-109224199 TGTGCAAATGGAGGGGGTGTGGG + Intronic
936774373 2:115955092-115955114 TGTCCAAATGGCAGAGATGAAGG + Intergenic
937376159 2:121337166-121337188 TGAGGAAATGGAGCCGATGAGGG + Intergenic
938181665 2:129190148-129190170 TGTGCAACTGGAGCAGAGTAAGG - Intergenic
938673892 2:133611275-133611297 TTTGCAGATGGAGGAGGTGGTGG - Intergenic
939842897 2:147210274-147210296 TGTGCAAATTGAGCAGACTAAGG - Intergenic
940990053 2:160087601-160087623 GGTGGAACTGGAGGAGCTGATGG + Intergenic
941107871 2:161380145-161380167 TGAGCAAATGGAGAAATTGAAGG + Intronic
941163836 2:162064144-162064166 TGAGCATATGGAGGAGGTGTTGG + Intronic
941265809 2:163360419-163360441 TGTGCATATGTAGGAGTAGAGGG - Intergenic
942303427 2:174584442-174584464 TGTGAAAATGGTGAAAATGAAGG + Intronic
942564197 2:177250538-177250560 TGTGCATATGAAGGAGGTCATGG - Intronic
945023040 2:205593305-205593327 TGTTTAAATGGTGGTGATGAAGG + Intronic
946169829 2:217888292-217888314 GGAGCAGATGGAGGAGAGGAGGG - Intronic
946227837 2:218273853-218273875 TTTGCAGATGGAGGAGGGGATGG - Intronic
946483746 2:220080952-220080974 TGTTAAAATGGAGGAAATGCAGG + Intergenic
947447116 2:230172594-230172616 TGTCCAAAAGGAGGAGGGGACGG - Intronic
947926544 2:233926707-233926729 TGTGCAAATGCAGGATTTGACGG - Intronic
948487756 2:238291539-238291561 TCTGCAAATGGAGGAGGTGGTGG + Intergenic
1169555902 20:6749442-6749464 TGTGCACTTGGAGGGTATGAGGG + Intergenic
1172307787 20:33893829-33893851 TAAGCAAATGGAGGTGATGATGG + Intergenic
1172894788 20:38292765-38292787 GGTGCAATGGGAGGAGATGAGGG + Intronic
1172931894 20:38592247-38592269 TGTGCATATCAAGAAGATGATGG - Intergenic
1173324646 20:42021575-42021597 TGTCCAAGGGCAGGAGATGATGG - Intergenic
1173878400 20:46391704-46391726 TGTTCAGATGGAAGAGAGGAAGG - Intronic
1175270769 20:57732291-57732313 TTTGCCAATGGATGAGATGTGGG - Intergenic
1176155716 20:63619355-63619377 TGTGCACATGGAGGAGGTGGTGG - Exonic
1177126344 21:17198023-17198045 TGGGCAGATGGGGGAGAGGAAGG - Intergenic
1177732437 21:25045255-25045277 AGTGCAGATTGAGGAGATGCTGG + Intergenic
1178231705 21:30792910-30792932 TGAGCAAGTGGATGAGCTGATGG + Intergenic
1180165006 21:46020831-46020853 TGAGCAAATGGAGGCCCTGACGG - Intergenic
1180469404 22:15641786-15641808 TGGGTAGATGGAGGAGAAGAGGG - Intergenic
1180844291 22:18973001-18973023 TCTGCAAATGGATGGGGTGAGGG - Intergenic
1181087939 22:20451684-20451706 TATGCAATTGCAGGATATGAAGG + Intronic
1181293696 22:21818093-21818115 GATTCAGATGGAGGAGATGACGG + Intronic
1181434760 22:22904328-22904350 TTTTCAAATGGGGGACATGAGGG - Intergenic
1181579965 22:23822648-23822670 GGGGAAAAGGGAGGAGATGAGGG - Intronic
1182737313 22:32540084-32540106 TGTGAAACTGGAGGAGGTGCAGG - Intronic
1183251207 22:36731751-36731773 TTTCCAAATGGATGAGATGTGGG - Intergenic
1183665993 22:39245943-39245965 AGTGCAAGCGGAGGAGATGAGGG - Intergenic
1184184188 22:42853329-42853351 TGGGCACATGGTGGAGATAAGGG + Intronic
949670700 3:6396700-6396722 AGTCCAAATGCAGGAGTTGAAGG + Intergenic
950381074 3:12615708-12615730 TGCTCAAATGGAGGGGATCAAGG + Intronic
950419908 3:12892624-12892646 TGTGTAGCTGGAGGAGGTGAGGG - Intergenic
950710267 3:14809095-14809117 AGTGGAACTGGAGGAGATGAAGG - Intergenic
950754165 3:15158712-15158734 TATGTGAAAGGAGGAGATGAAGG - Intergenic
952181913 3:30925667-30925689 TGTGCACATGGAGGTGTTGAGGG + Intergenic
953545421 3:43860723-43860745 TCTGCAAAGGGAGCAGAGGATGG - Intergenic
955494171 3:59513807-59513829 ACTGCAGATGGAGGAGGTGATGG + Intergenic
957073179 3:75581229-75581251 TGGGCAAAGGGAGGAGATGTGGG + Intergenic
957439395 3:80224393-80224415 TGTCCAAAGGGAGGAGAAAAGGG - Intergenic
957987840 3:87594250-87594272 TGTCCAAGTGCAGGAGAAGATGG + Intergenic
958952995 3:100436495-100436517 GATGCAGAGGGAGGAGATGAGGG - Intronic
959651593 3:108756242-108756264 TGGGACAATGGAGGAGAGGAAGG + Intronic
959887062 3:111515196-111515218 TGTGCAGAGAAAGGAGATGATGG + Intronic
960407937 3:117284771-117284793 TTTGCAAAATGATGAGATGAGGG + Intergenic
961167291 3:124772261-124772283 TGTTTAATTGGAGGAGATGGGGG - Intronic
961942130 3:130649148-130649170 TGAGCGGATGAAGGAGATGATGG + Exonic
962091742 3:132251588-132251610 TGGACAAATGGAGCAAATGAAGG + Intronic
962165103 3:133039562-133039584 TGGGGAAATGGAGGAGAGGCAGG - Intronic
962364922 3:134772511-134772533 AGAGAAAATGGAGGAGAAGAGGG - Intronic
962895761 3:139713292-139713314 TGGACACATGGAGGAGAAGAGGG + Intergenic
964116816 3:153144896-153144918 AGTGCTAAGGGAGGAGAGGAAGG + Intergenic
965540860 3:169870262-169870284 TGTGCAAAGGAAGGAGGTGGGGG - Intergenic
967821096 3:193839844-193839866 GCTGGAGATGGAGGAGATGAGGG - Intergenic
967922744 3:194625017-194625039 TGTTCAAAAAGAGGGGATGAGGG - Intronic
968589958 4:1452651-1452673 TGTGAAAATGGTGGTGATGGTGG - Intergenic
969094417 4:4721134-4721156 TGTGGTTATGGAGGAGAGGAAGG - Intergenic
969102504 4:4779800-4779822 TTTGCAAATAGATAAGATGAAGG + Intergenic
970486099 4:16526265-16526287 TGTCCAAAGGCAGGAGAAGAAGG - Intronic
972343722 4:38175466-38175488 TGGTTAAATGGAGGAGATGAAGG + Intergenic
972463087 4:39325124-39325146 TGTGTAACTGGATGAGATCATGG - Intronic
972517799 4:39825455-39825477 TTTGCAAAGGGAGAAAATGAAGG - Exonic
972803142 4:42498810-42498832 TTTACAAATGTAGTAGATGAAGG + Intronic
972971268 4:44579134-44579156 TATGCAAATGATGGAGATGGAGG - Intergenic
974062628 4:57049368-57049390 GGTAAAAATGGAAGAGATGATGG - Intronic
975444922 4:74452219-74452241 TGCACAATTGGAGAAGATGATGG - Intronic
975838958 4:78454343-78454365 TGATCAAATGGAGGAAGTGAGGG + Intronic
976830996 4:89313543-89313565 TGTCCAAAGCGAGGAGAAGATGG + Intergenic
977586390 4:98779761-98779783 TGCACAAATGGAGGGGAGGAGGG - Intergenic
977627357 4:99201969-99201991 TGTGAATATGTAGGAGCTGATGG + Intergenic
979102249 4:116633256-116633278 TGAGGAAAAGGAGGAGATGTGGG + Intergenic
979490080 4:121315893-121315915 TTTGCAAATAGAGGAGATTAAGG - Intergenic
979606684 4:122645830-122645852 TGTCCATATGGAGAAGCTGAAGG - Intergenic
979708593 4:123750463-123750485 TGTGAAAAGTGAGGAGTTGAAGG + Intergenic
979722303 4:123915506-123915528 TGTGTAAATGATAGAGATGATGG + Intergenic
979845052 4:125497822-125497844 TGTGCAAATAGAGTAGGGGAAGG - Intergenic
979909049 4:126336865-126336887 AGTGGAAATGGTGGAAATGATGG - Intergenic
980020736 4:127706856-127706878 TGTGAAGGTGGAGAAGATGATGG + Exonic
980304210 4:131035789-131035811 TGTGGGAATTGATGAGATGAAGG - Intergenic
980764264 4:137279071-137279093 TGAATAAATGGAGGAGAAGAGGG + Intergenic
982534064 4:156586534-156586556 TCCGCACATGGAGGACATGAAGG + Intergenic
983504972 4:168543196-168543218 TTTACAAATGAAGAAGATGAGGG - Intronic
985839716 5:2297256-2297278 TGTGCAAATGAAGGTCAGGATGG - Intergenic
986069072 5:4264609-4264631 TGGCCAAGTGGAGGCGATGAGGG + Intergenic
986155244 5:5167813-5167835 TGTGGCAATTGAGGAGTTGAAGG + Intronic
986229875 5:5853297-5853319 TGTGCAAATGTACAAAATGAGGG - Intergenic
986376001 5:7131569-7131591 GGTGCAAGTGGACGAGATTATGG - Intergenic
986472677 5:8091655-8091677 TGTTCAAATGTTGGTGATGAAGG + Intergenic
986614771 5:9604917-9604939 TGTGCAAGGGCAGGAGAAGAAGG - Intergenic
987713736 5:21538592-21538614 TTTGTAAATGGTGGAGATAAAGG - Intergenic
987912954 5:24172496-24172518 TGTGAAAGTGGATGAGATTATGG - Intronic
988582690 5:32482020-32482042 TGTCCAAAGGCAGGAGAGGAAGG - Intergenic
989279156 5:39621759-39621781 TGAGCAAAGGGCGGAGAGGATGG - Intergenic
989556396 5:42801118-42801140 TGTGCTTATGGTGGTGATGAAGG + Exonic
990201767 5:53383768-53383790 TGTCCAAAGGCAGGAGAAGATGG - Intergenic
990669812 5:58115458-58115480 TGGACAACTGGAGGAGAGGAGGG - Intergenic
990795772 5:59538836-59538858 TGTGCATATGGTGGAGTTTAGGG - Intronic
991262364 5:64680659-64680681 TGTTCAAGGGGAGGAGAAGATGG + Intergenic
991716885 5:69459438-69459460 TGTCCAAAGGCAGGAGAAGATGG + Intergenic
992738303 5:79745908-79745930 TGTGCAAAAGGATGACATAATGG + Intronic
993589133 5:89772232-89772254 TGTGCAAATTCAGGAGAAAATGG + Intergenic
994776421 5:104040265-104040287 TGTCCAAACTCAGGAGATGATGG - Intergenic
995210367 5:109530769-109530791 TATTCAAATGAAGGGGATGATGG + Intergenic
997016865 5:129946589-129946611 AGGGCAAATGGGGGAGATGCTGG - Intronic
997866842 5:137471401-137471423 TGTAAAAATGGAGATGATGATGG + Intronic
998417328 5:141955439-141955461 TGTGGACAAGGAGGCGATGATGG - Exonic
1000349701 5:160343817-160343839 TGTGCAAGGGGAGAAGATGAGGG - Intronic
1000369844 5:160524494-160524516 TGTGGAAAGGAAGGAGATGAAGG + Intergenic
1001098926 5:168797900-168797922 TGTGAAAATGGAGGAACTGAAGG + Intronic
1001371422 5:171207540-171207562 TGGTCAAATGGAGGAGACAAAGG - Intronic
1003831575 6:10017630-10017652 TGTGATAATGGTGAAGATGAGGG - Intronic
1004473119 6:15946778-15946800 TGTGCAAATGTAGGAGGTAGTGG + Intergenic
1005501741 6:26434689-26434711 TGTGAAAAAGGAGGACATCAAGG + Intergenic
1005650303 6:27879445-27879467 TGTGGCAATGGAAGGGATGATGG + Intergenic
1005677119 6:28165959-28165981 TTTGCAGATAGAGCAGATGAAGG - Intergenic
1006202716 6:32310913-32310935 TGCCTAAATGGAGGAGGTGAAGG - Intronic
1006242457 6:32696567-32696589 TGAGCTTATGGAGGGGATGAGGG + Intergenic
1007318663 6:41010398-41010420 TGTTCAAAGGAAGGAGAAGATGG - Intergenic
1008838607 6:55869300-55869322 TGTACAGGTGGAGGAGATGCTGG - Intronic
1009266125 6:61556753-61556775 TGAGAAAATGGAGGTGAGGAAGG - Intergenic
1009802536 6:68557962-68557984 TTTACAAAAGGAAGAGATGAAGG + Intergenic
1009818612 6:68770321-68770343 TGTGCAAAGTGACGAGAAGAGGG - Intronic
1010397467 6:75408697-75408719 TGGGGAAAAGGAGGAGATGGAGG - Intronic
1010680390 6:78792438-78792460 TGGGCACATGGAGGAGATACTGG + Intergenic
1011762559 6:90584298-90584320 TATGCAAATGAAGAAGATGATGG + Intronic
1012156008 6:95820254-95820276 TGTTCCAGTGGAGGTGATGAGGG - Intergenic
1012197506 6:96362213-96362235 TGTCCAAAAGGAGGAGAATATGG - Intergenic
1012389657 6:98723226-98723248 TCAGCAAATGGAGGAGACGAAGG + Intergenic
1012589726 6:100966657-100966679 TGAGCAAATGGAACAGAGGAAGG - Intergenic
1013681560 6:112529795-112529817 TGTGCAAATCTTAGAGATGAGGG + Intergenic
1013998902 6:116342626-116342648 TGTGCAAATGGCAGAGAAAAAGG - Intronic
1015905247 6:138109963-138109985 TGTGTAAATGAAGGAGATGCTGG - Intergenic
1017374144 6:153748010-153748032 CTTGGAAATGGAGGAGATGAAGG - Intergenic
1017647929 6:156556166-156556188 TGAGAAAATGCAGGGGATGAAGG - Intergenic
1018007081 6:159632250-159632272 TGTGGAAATGTAAGAGAGGAAGG - Intergenic
1018560630 6:165098149-165098171 TGTGCTAAGGGAGGAGGGGAGGG - Intergenic
1018973406 6:168545169-168545191 TGTGGAAAGGGAGGAGGAGATGG + Intronic
1019309971 7:355190-355212 TCTGTAAATGGAGGACAGGACGG - Intergenic
1019925260 7:4187267-4187289 TGTGCAAATGTATTGGATGATGG - Intronic
1020435075 7:8152956-8152978 AGTGGTGATGGAGGAGATGATGG - Intronic
1021404726 7:20251906-20251928 TGTCCAACTGAAGGAGAAGAGGG - Intergenic
1021483518 7:21144069-21144091 TGTGACCATGGAGGAGCTGAAGG - Intergenic
1021569312 7:22048400-22048422 TGGACAAATGGAGGATGTGAAGG + Intergenic
1021927251 7:25545517-25545539 ACTGCAACTGGAGGCGATGAGGG - Intergenic
1022221612 7:28319574-28319596 TGTTCATCTGGAGGTGATGAAGG + Intronic
1022923903 7:35041656-35041678 TTTCCAAAGGGAAGAGATGATGG + Intergenic
1022981443 7:35608588-35608610 TGGGGAAATGGGGGAGATTAGGG + Intergenic
1023057133 7:36299525-36299547 TGAGCAGAGGGAGGAGAAGAAGG + Exonic
1024013658 7:45292165-45292187 AGAGCAAATGGAATAGATGAAGG - Intergenic
1025247486 7:57328264-57328286 TGCACAAATGGAGGACATGCAGG + Intergenic
1025918983 7:65892432-65892454 AGTTTAAATGGATGAGATGATGG - Intronic
1029822218 7:103157428-103157450 TTTCCAAAGGGAAGAGATGATGG + Intergenic
1031094308 7:117401149-117401171 TGTGAATATGGAGAAGATAAAGG + Intronic
1031138812 7:117918726-117918748 TGTCCAAAGGCAGGAGAAGATGG + Intergenic
1031237508 7:119196068-119196090 TGAGAAAATGGAGGAAATGGTGG - Intergenic
1031665417 7:124477258-124477280 TGAGCAAATGGAGCTGATAATGG + Intergenic
1032850775 7:135793319-135793341 AGTGGGAAAGGAGGAGATGAAGG - Intergenic
1033509848 7:142049000-142049022 TGTGGAAACTGGGGAGATGATGG - Intronic
1033926249 7:146464601-146464623 TGTGGAATTGGAGGAGGAGAAGG - Intronic
1034013886 7:147560730-147560752 TGTGCAAAGGGAGGAAATGAGGG + Intronic
1035035463 7:155891492-155891514 GGTGGAAGTGGTGGAGATGATGG + Intergenic
1035109061 7:156465075-156465097 TGAGCAAGTTGTGGAGATGATGG + Intergenic
1035698792 8:1621939-1621961 TGTGCCCTTGCAGGAGATGAAGG - Intronic
1035785318 8:2255223-2255245 TGTGGAAACGGAGGAGATGGTGG - Intergenic
1035807490 8:2466493-2466515 TGTGGAAACGGAGGAGATGGTGG + Intergenic
1036726437 8:11224886-11224908 TGTGCAATTGGAGAACATTATGG - Intergenic
1036821989 8:11948266-11948288 TGTGTAAGTGGAGGAGGAGAGGG - Intergenic
1037497911 8:19458338-19458360 AGGGGAAATGAAGGAGATGACGG + Intronic
1038510580 8:28130667-28130689 TGTGCAGATGGAGGGGAAGGGGG + Intronic
1038536476 8:28356745-28356767 AGTGGAAATGGATGAGATGATGG - Exonic
1038712839 8:29963968-29963990 TGTGCATACAGAGGAGAAGAAGG - Intergenic
1038956799 8:32476694-32476716 TATAAAAATGGAGGAAATGAAGG - Intronic
1040593699 8:48818643-48818665 AGGGCAGATGGAGGAGATCAAGG + Intergenic
1041725067 8:61010626-61010648 TTTGTTAATGGTGGAGATGAGGG + Intergenic
1042480609 8:69297989-69298011 TGTGAAACTGGAGGAGAAGAAGG + Intergenic
1044480685 8:92683942-92683964 TGTGCACGGGGAGGAGATTATGG + Intergenic
1046088239 8:109465460-109465482 TGTGCCAATGCAGGAGAAAAAGG - Intronic
1047036997 8:120950856-120950878 GGAGCAAATGGTGGGGATGATGG - Intergenic
1048513160 8:135080475-135080497 TCTGCAACTGAAGGAGATTAAGG + Intergenic
1048618930 8:136110078-136110100 TGTACAAATGTAAGAGATTAAGG + Intergenic
1049344060 8:142129098-142129120 TCTGCAGATGGAGGAGCTGATGG - Intergenic
1049372937 8:142276316-142276338 TGAGCCAATGGAGGAGGAGAGGG + Intronic
1049632636 8:143666871-143666893 TGTGCACATGGAGGGAAGGAAGG - Intergenic
1050961415 9:11738147-11738169 TGTCCAAGTGCAGGAGAAGATGG + Intergenic
1052813490 9:33082264-33082286 TGTGTAAATAAAGGAGATGCTGG - Intergenic
1053223049 9:36327373-36327395 CGTGGAAAGGCAGGAGATGATGG + Intergenic
1053307659 9:36995549-36995571 TGTGAGAATGGAGGAAAGGAGGG + Intronic
1055317103 9:75044832-75044854 TGTGCATTTGGGGGAGCTGATGG + Intergenic
1056009980 9:82318334-82318356 TGTTCAAAAATAGGAGATGAGGG + Intergenic
1056317142 9:85400980-85401002 GGAGCCAATGGAGGAGAGGATGG - Intergenic
1056741581 9:89260859-89260881 TGTGCAGATGGAGGATATGAAGG + Intergenic
1057693033 9:97303568-97303590 TGTCCAAAGGCAGGAGAAGAAGG + Intergenic
1059031331 9:110700457-110700479 TCTGCAAATGAAGGAGAGGATGG + Intronic
1059321671 9:113475202-113475224 TGTGCAAAAGGTGGTGGTGATGG - Intronic
1060109953 9:120899790-120899812 TGTGGGACTGGAGGAGCTGATGG - Intergenic
1061244856 9:129396302-129396324 TGAGAGAATGGATGAGATGATGG + Intergenic
1061750836 9:132776034-132776056 TGGGCAAATGCAGGAGAGGCCGG - Intronic
1185944189 X:4356176-4356198 TGTCCAAAGGCAGGAGAAGATGG - Intergenic
1186066304 X:5769410-5769432 TATGCAAATGGAATAAATGAGGG + Intergenic
1186380413 X:9052937-9052959 TGTGCACCTGGAAGGGATGAAGG - Intronic
1186380611 X:9054817-9054839 TGTGCACCTGGAAGGGATGAAGG + Intronic
1188832755 X:34920335-34920357 TGTCCAAATGGAGGGGTTCAGGG - Intergenic
1188979164 X:36711462-36711484 TGTGGAAATTGAGGAGATGATGG + Intergenic
1188999046 X:36923238-36923260 TGTGCAAATGGGGAGGAAGAGGG - Intergenic
1190446211 X:50526916-50526938 TGTGGAAATGAAGGGGAAGAAGG + Intergenic
1190626770 X:52344507-52344529 TGTCCAAAGGCAGGAGAAGACGG - Intergenic
1190701237 X:52991322-52991344 TGTCCAAAGGCAGGAGAAGACGG + Intronic
1190708287 X:53048511-53048533 CGTGCAAATCGAGGAGAGGGGGG + Intergenic
1190990939 X:55549534-55549556 AGGCCAAAAGGAGGAGATGAAGG - Intergenic
1193512683 X:82424402-82424424 TATGCATATGGAGGTGCTGAGGG + Intergenic
1193530556 X:82649687-82649709 GGTGGAACTGGAGGAGCTGATGG + Intergenic
1194388610 X:93288509-93288531 GGAGATAATGGAGGAGATGATGG - Intergenic
1194663095 X:96647761-96647783 TGTGCAAGAGGAGGAGCTGAAGG - Intergenic
1195618797 X:106933311-106933333 TGTGCAAGGGAAGGAGATGAGGG - Intronic
1196398524 X:115290531-115290553 GGTGCGAATGGAGGAGGTTAGGG - Intronic
1198002842 X:132457439-132457461 GGTGAAAAAGGAGGAGATGGAGG + Intronic
1200093370 X:153646268-153646290 TGTGCCCATGGAGGAAAGGATGG + Intronic
1200930195 Y:8690038-8690060 TGTGCAAATTGGGGACATGCTGG - Intergenic
1202093683 Y:21221367-21221389 TGTGCAAGAGGAGTAGATCATGG - Intergenic