ID: 1152532548

View in Genome Browser
Species Human (GRCh38)
Location 17:80927834-80927856
Sequence ATGTGCAAATGGAGGAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 385}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152532548_1152532560 26 Left 1152532548 17:80927834-80927856 CCTCATCTCCTCCATTTGCACAT 0: 1
1: 0
2: 4
3: 33
4: 385
Right 1152532560 17:80927883-80927905 GCTGGAGGGTGTCAGCCTTGTGG 0: 1
1: 0
2: 0
3: 22
4: 260
1152532548_1152532556 11 Left 1152532548 17:80927834-80927856 CCTCATCTCCTCCATTTGCACAT 0: 1
1: 0
2: 4
3: 33
4: 385
Right 1152532556 17:80927868-80927890 CGCCCGCACGGAGGAGCTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 157
1152532548_1152532551 -1 Left 1152532548 17:80927834-80927856 CCTCATCTCCTCCATTTGCACAT 0: 1
1: 0
2: 4
3: 33
4: 385
Right 1152532551 17:80927856-80927878 TCTGAGAATTCCCGCCCGCACGG 0: 1
1: 0
2: 0
3: 2
4: 43
1152532548_1152532553 8 Left 1152532548 17:80927834-80927856 CCTCATCTCCTCCATTTGCACAT 0: 1
1: 0
2: 4
3: 33
4: 385
Right 1152532553 17:80927865-80927887 TCCCGCCCGCACGGAGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 358
1152532548_1152532557 12 Left 1152532548 17:80927834-80927856 CCTCATCTCCTCCATTTGCACAT 0: 1
1: 0
2: 4
3: 33
4: 385
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1152532548_1152532552 2 Left 1152532548 17:80927834-80927856 CCTCATCTCCTCCATTTGCACAT 0: 1
1: 0
2: 4
3: 33
4: 385
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152532548 Original CRISPR ATGTGCAAATGGAGGAGATG AGG (reversed) Intronic
900980580 1:6043965-6043987 ATGGGAAGATGGAGGACATGGGG - Intronic
902098926 1:13968783-13968805 ATGTTCAAATGGAAGAGGAGAGG - Intergenic
902652475 1:17845520-17845542 ATGTGCAGAGGGAGGAGCTGTGG + Intergenic
902662376 1:17914018-17914040 ATGAGCAGATGAAGGAGAGGCGG - Intergenic
902987970 1:20166995-20167017 ATGTGCTAATGGAGAAACTGAGG + Intronic
903169096 1:21541164-21541186 ATGGGCAAGTGGGGCAGATGAGG - Intronic
903267824 1:22168782-22168804 ATGTGCTCATGGAGGAAATGTGG - Intergenic
903276102 1:22222827-22222849 TTTTGCAAATGGAGAAGATGAGG - Intergenic
905597048 1:39216863-39216885 ATGTGGGATTGGGGGAGATGGGG - Intronic
905730681 1:40297304-40297326 ATGTGCTGATGGATCAGATGTGG + Intergenic
907304583 1:53506627-53506649 CTGTGTAGATGGAGGGGATGTGG + Exonic
910218194 1:84863583-84863605 ATGTGGATATGAAGGAGAGGAGG - Intronic
911034366 1:93524471-93524493 AAGTGTAAATGGAGGATGTGAGG + Intronic
911463528 1:98221649-98221671 ATGTGGAAATCCAGGAGAAGTGG + Intergenic
911717170 1:101146635-101146657 ATGAGCAAATAGAGGCGAAGAGG + Intergenic
912702566 1:111889087-111889109 TTGGGTAAATGGAGGCGATGTGG + Intronic
912947069 1:114094195-114094217 ATAAACAAAGGGAGGAGATGGGG + Intronic
913016172 1:114737864-114737886 TCGTGCAAACTGAGGAGATGGGG + Intronic
913169993 1:116223008-116223030 ATGTGCAGTCGGAGCAGATGTGG - Intergenic
915727251 1:158026430-158026452 ATGAGAACATGCAGGAGATGGGG + Intronic
917539955 1:175902461-175902483 ATGGGCAAGTGCAGGAGCTGGGG - Intergenic
918116693 1:181504070-181504092 ATGTGCACATGAAGAAGAGGTGG + Intronic
918217943 1:182409309-182409331 AAGTGCAAGTGGAGGACAAGGGG + Intergenic
918288283 1:183080384-183080406 ATGTGCAAAACTTGGAGATGTGG + Intronic
920212533 1:204338778-204338800 CTGTGGAAATGAAGGGGATGGGG + Intronic
920245615 1:204585444-204585466 GGGTGCAGATGGAGGGGATGCGG - Intergenic
921089856 1:211831671-211831693 ATTTGTAAATGGAGGGGATGGGG + Intergenic
921110482 1:212032138-212032160 ATTTGCTAATGGATTAGATGAGG - Intronic
921187230 1:212680647-212680669 ATGTGCAAATGGAGGCAAACTGG + Intergenic
922516263 1:226210491-226210513 ATGTGTCAAAGGAGAAGATGGGG - Intergenic
922874668 1:228931047-228931069 TTTTGCAAATGGAGGAACTGAGG - Intergenic
923033349 1:230267082-230267104 ATGTGCACAAGGAAGAGAGGGGG - Intronic
923170815 1:231415461-231415483 ATGTGTAAATGCAGGAAAAGTGG + Intronic
923488711 1:234462729-234462751 ATGTGTTAATGGGGAAGATGGGG - Intronic
923893473 1:238241466-238241488 ATGTGGAAATGGAGAGAATGGGG + Intergenic
1062929947 10:1346281-1346303 ATGTGGCAGTGAAGGAGATGGGG + Intronic
1065280635 10:24134213-24134235 ATGGGCTAGTGGAGGAGAGGTGG + Intronic
1065402803 10:25325192-25325214 AGGTGAATATGGAAGAGATGAGG + Intronic
1067196680 10:44125952-44125974 ATGTTCTCCTGGAGGAGATGGGG + Intergenic
1067907989 10:50314284-50314306 TTGTTTAAATGGAGGGGATGGGG + Intronic
1069342554 10:67428777-67428799 ATGTGAAAAGGGGAGAGATGGGG + Intronic
1072285621 10:93911766-93911788 ATGTCATGATGGAGGAGATGGGG - Intronic
1072481231 10:95810593-95810615 ATGTGAATATGGTGGGGATGGGG - Intronic
1075074386 10:119341132-119341154 AAGTGGAAATGGTGGAGATGGGG - Intronic
1075093013 10:119453917-119453939 GTGGGCCAATGGAGGAAATGCGG + Intronic
1076000172 10:126906964-126906986 ATCTGCAAAATGGGGAGATGGGG - Intronic
1076197967 10:128533757-128533779 ATTTGCAAATGAGGAAGATGAGG - Intergenic
1077442899 11:2576980-2577002 ATGTGCAGATGGAGAAACTGAGG - Intronic
1077602334 11:3582161-3582183 GTGGGCAAAGGGAGGAGACGTGG + Intergenic
1077702374 11:4454283-4454305 ATTTGCAAAGGGAGGAGGGGAGG - Intergenic
1079352349 11:19702442-19702464 CTGTGCAAATGTTGGTGATGTGG - Intronic
1079912328 11:26326368-26326390 AAGTCTAGATGGAGGAGATGGGG - Intronic
1080849396 11:36055208-36055230 AGGTGGAAAGGGAGGATATGAGG - Intronic
1081660943 11:44888010-44888032 ATGTGGGAAGGGAGGAGGTGAGG + Intronic
1082204318 11:49413760-49413782 ATTTGCAAAGGGTGGAGGTGTGG - Intergenic
1083657947 11:64238886-64238908 TTGTGCAGATGGAGGAAATGAGG + Intergenic
1084258228 11:67956712-67956734 GTGGGCAAAGGGAGGAGACGTGG + Intergenic
1084814519 11:71638502-71638524 GTGGGCAAAGAGAGGAGATGTGG - Intergenic
1084870837 11:72097679-72097701 ATGTGAAGAAGGAGGAGAAGAGG - Exonic
1085248628 11:75125915-75125937 ATGCCCAAATGGAGGAGCAGAGG + Intronic
1086070672 11:82795686-82795708 GTGAGACAATGGAGGAGATGAGG - Intergenic
1086650767 11:89286775-89286797 ATTTGCAAAGGGTGGAGGTGTGG + Intronic
1087544708 11:99570060-99570082 GTGTGAAAATGGATGACATGAGG - Intronic
1088510082 11:110565187-110565209 ATCTGGAGAGGGAGGAGATGAGG + Intergenic
1088911413 11:114195352-114195374 ATGTGAACATGGGGGAGTTGGGG + Intronic
1088949162 11:114547882-114547904 ATGTTGAAATGGAGGATATTGGG + Intronic
1089344689 11:117783672-117783694 ATGTGCAAATGCCAGAGCTGGGG + Intronic
1089612515 11:119677413-119677435 ACGAGCAAAGGGAGGAGATAGGG + Intronic
1091070819 11:132561356-132561378 AAGAGCCTATGGAGGAGATGAGG - Intronic
1091282385 11:134389556-134389578 AAGTGAAAAGGGAGGAGAAGAGG - Exonic
1091783104 12:3226136-3226158 GAGTGCAGAGGGAGGAGATGGGG + Intronic
1092428476 12:8391513-8391535 GTGGGCAAAGGGAGGAGACGTGG + Intergenic
1092428933 12:8394388-8394410 ATGTGTTTATGGAGGGGATGTGG - Intergenic
1092429560 12:8397665-8397687 GTGGGCAAAGGGAGGAGACGTGG + Intergenic
1093506165 12:19869348-19869370 ATGTGAAACTGAAGGAAATGTGG - Intergenic
1094160325 12:27383291-27383313 GTGTTCAAATGGTGGGGATGGGG + Intronic
1095959674 12:47826395-47826417 ATGAGGAAACGGAGGACATGAGG + Intronic
1096571687 12:52526987-52527009 TCTTGCAAATGGGGGAGATGTGG + Intergenic
1097790591 12:63811443-63811465 ATCTGCAAATGAGGGAGAGGTGG - Intergenic
1098572296 12:72001763-72001785 ACCTTCAAATGGAGGAGATATGG - Intronic
1098972648 12:76872480-76872502 ATATGCAAATGCAGGCCATGTGG + Intronic
1099246180 12:80196135-80196157 CTGTGCAGGTGGATGAGATGGGG + Intergenic
1099651604 12:85435244-85435266 ATGTCCAAAGGTAGGAGAAGAGG + Intergenic
1100478161 12:94953018-94953040 ATGGGCAGATGCAGGAGCTGGGG - Intronic
1101428724 12:104608801-104608823 ACCTCCAAATGGAGTAGATGAGG - Intronic
1101552471 12:105775561-105775583 ATGTCCAGAAGGAGGAGATCTGG + Intergenic
1101664735 12:106801880-106801902 ATGTGTACATGCAGAAGATGAGG - Intronic
1101818969 12:108168401-108168423 GTGACCTAATGGAGGAGATGGGG - Intronic
1101921745 12:108938678-108938700 GCGTGCACATGGAGCAGATGAGG - Intronic
1102008719 12:109605264-109605286 AAGGGGAAATGGAGCAGATGTGG - Intergenic
1102837583 12:116079795-116079817 ATATTCAAATGGAGGAAATTTGG - Intronic
1102992471 12:117324934-117324956 ATGGGGGAATGGAAGAGATGTGG + Intronic
1103451297 12:121031253-121031275 AGGTGGAAAAGGAGGAGAGGAGG - Intronic
1103473657 12:121202161-121202183 TTGTTGAAATGGAGGAGATGGGG - Intergenic
1105329573 13:19403058-19403080 ATTTGCCAAGGGAGGAGATTAGG - Intergenic
1105646279 13:22321274-22321296 ATGTGAGAATGGAGGAGCAGAGG + Intergenic
1106354564 13:28967903-28967925 ACGTGAAAATGTTGGAGATGTGG + Intronic
1106676873 13:31969235-31969257 ATGTGAAGATGGAAGAGATATGG + Intergenic
1108918379 13:55644349-55644371 ATGTGCACGTGGGGGAGACGGGG - Intergenic
1109749966 13:66677637-66677659 AGGAGCAAATGGAGGGGAGGCGG - Intronic
1109800325 13:67369123-67369145 TTGTGCAAATCAAGGAGAGGTGG + Intergenic
1110714348 13:78684265-78684287 ATGGGCAGATGCAGGAGCTGAGG - Intergenic
1110822165 13:79928859-79928881 ATCAGTAAATGGAGGAGATGGGG + Intergenic
1111025396 13:82514418-82514440 ATGTGCAAAAGGAAGATATTAGG + Intergenic
1111792845 13:92880510-92880532 ATATGCAAATGCAAGAGACGAGG + Intergenic
1112537829 13:100277657-100277679 ATGTGCAAATGCATGAGATTTGG - Intronic
1113347502 13:109494479-109494501 ACCTGCAAATTGAGGAGATTGGG + Intergenic
1114050928 14:18919412-18919434 ATGGGTAGATGGAGGAGAAGAGG - Intergenic
1114111631 14:19482510-19482532 ATGGGTAGATGGAGGAGAAGAGG + Intergenic
1114717082 14:24838361-24838383 CTGTGGAATTGGAGGAAATGTGG + Intronic
1115488142 14:33932654-33932676 ATGTTCAAAGGCAGGATATGGGG - Intronic
1118118866 14:62813396-62813418 ATGTGCAAATGGGGATAATGAGG + Intronic
1118325853 14:64779890-64779912 ATGTGCGAAAAGAGGAGCTGGGG - Exonic
1119196356 14:72719494-72719516 ATGTGCATATGGAGCACCTGAGG - Intronic
1119562595 14:75603056-75603078 ATGTGGAGATGGAGGGGAGGTGG - Intronic
1121724376 14:96135779-96135801 AACTGGAAATGGGGGAGATGGGG + Intergenic
1122355661 14:101121617-101121639 ATGGGCAAAGGGAGGGGCTGTGG - Intergenic
1123410079 15:20050903-20050925 ATGTGTGAATGGAGGGGACGTGG + Intergenic
1123519412 15:21057610-21057632 ATGTGTGAATGGAGGGGACGTGG + Intergenic
1123823858 15:24061297-24061319 ATGTGAAAATGGAGGTTGTGGGG + Intergenic
1123838499 15:24222151-24222173 ATGTGCAAATAGAGGAGTGGGGG + Intergenic
1123848039 15:24324432-24324454 ATGTGCAAATAGAGGAGTGGGGG + Intergenic
1123867086 15:24531795-24531817 ATGTGCAAATAGAGGAGTGGGGG + Intergenic
1124415625 15:29471189-29471211 ATGTGAAAATGGAGTTGATCTGG - Intronic
1124624741 15:31301348-31301370 ATCTGCCAAGGGAGGAGCTGAGG - Intergenic
1126508426 15:49436649-49436671 ATTTGCAGATGGGGGAGATTTGG + Intronic
1128107145 15:65053545-65053567 TTCTGTAAATGGAGGAGCTGAGG - Exonic
1128186371 15:65646435-65646457 ATATGAAAATGGAGGAGAAAAGG - Intronic
1128721143 15:69949327-69949349 ATGAGGAAAAGGAGGAGGTGCGG - Intergenic
1129797302 15:78387825-78387847 ATGTGCACATGGAGCACCTGGGG + Intergenic
1130206566 15:81880924-81880946 ATATGCAAATGGAGGTAATGGGG - Intergenic
1130691242 15:86083245-86083267 TTGAGCTAATGGAGAAGATGGGG + Intergenic
1130741918 15:86610037-86610059 ATGTTCCATTGGTGGAGATGGGG - Intronic
1132064976 15:98723398-98723420 ATGGGCAAATGAAGGATTTGTGG + Intronic
1132380048 15:101360096-101360118 ATGTGTAGATGGATCAGATGTGG - Intronic
1133891093 16:9879732-9879754 TTTTGCAAATGGAGGGAATGAGG - Intronic
1134079542 16:11315599-11315621 ATGAGTGTATGGAGGAGATGGGG - Intronic
1134436194 16:14259923-14259945 ATGTGCAAATGGCTGAGAGAAGG - Intronic
1134743450 16:16569216-16569238 ATGAGCTAAGGGAGGAGAGGAGG - Intergenic
1134924105 16:18143245-18143267 ATGAGCTAAGGGAGGAGAGGAGG + Intergenic
1135164419 16:20126145-20126167 ATGTGTAAATTCAGGAGCTGTGG + Intergenic
1136016301 16:27403242-27403264 CTGTGCATGTGGAGGAGAGGAGG + Intronic
1136355628 16:29743592-29743614 GTGTGCAGATGGAGGAGAATGGG + Exonic
1138919446 16:61509255-61509277 ATGAGCACATGGAGAAAATGTGG + Intergenic
1139924182 16:70476768-70476790 ATTAGCAAAAGGAGCAGATGGGG + Intronic
1140069379 16:71635756-71635778 TTCTGCAAATGGAGGGGGTGGGG + Intronic
1140723539 16:77791397-77791419 TTATGAAAATGGAAGAGATGAGG + Intronic
1142432442 16:90037230-90037252 AGGAGCAGATGGAGGACATGCGG + Exonic
1142706395 17:1697688-1697710 CTGGGGAGATGGAGGAGATGGGG - Intergenic
1143292407 17:5841903-5841925 ATTTCCAAGTGGAGGAGAGGGGG - Intronic
1143966640 17:10760206-10760228 ATGTGCACATGGATAAGATCAGG - Intergenic
1144588542 17:16504121-16504143 ATGTGGAAACAGAGGAAATGTGG - Intergenic
1144729952 17:17520484-17520506 CTGTGCAGATGGAGGAAGTGAGG - Intronic
1146605584 17:34255055-34255077 ATGAGCAAATGGGGAGGATGGGG - Intergenic
1146934318 17:36802369-36802391 ATGTGGTAATGGATGAGAGGTGG - Intergenic
1147773877 17:42886815-42886837 ATGAGCAAATGGATATGATGTGG - Intergenic
1148629020 17:49092425-49092447 ATGTTCACATGCAGGACATGTGG - Intergenic
1149143672 17:53464238-53464260 ATGTGGAAATGAACCAGATGTGG - Intergenic
1150362206 17:64546337-64546359 ACCTGCAAATGAAGGAAATGTGG + Exonic
1150619211 17:66796772-66796794 CTGTGCAGATGGTGGCGATGCGG + Intronic
1151716839 17:75835403-75835425 CTGTGCAGATGGATGAGGTGGGG - Exonic
1152532548 17:80927834-80927856 ATGTGCAAATGGAGGAGATGAGG - Intronic
1153289992 18:3491765-3491787 TTGTACAAATGGGGGAAATGAGG + Intergenic
1154155881 18:11943801-11943823 ATGAGCAAGTACAGGAGATGGGG + Intergenic
1154395928 18:13988604-13988626 GTGTTCACATAGAGGAGATGGGG - Intergenic
1155605002 18:27595110-27595132 ATATGCAAATGGACCAGAAGTGG + Intergenic
1156943534 18:42798694-42798716 AGGTGCCAATGGTGGAGAGGAGG - Intronic
1159192064 18:65059334-65059356 ATGTGCAAAGAGAGGGGATAGGG + Intergenic
1160383538 18:78479198-78479220 GTGTGGACATGGAGGAGGTGAGG - Intergenic
1160674339 19:381293-381315 ATGAGCAGATGTAGGAGGTGGGG + Intergenic
1160674371 19:381521-381543 ATGAGCAGATGTAGGAGGTGGGG + Intergenic
1160674428 19:381937-381959 ATGAGCAGATGTAGGAGGTGGGG + Intergenic
1160674440 19:382009-382031 ATGAGCAGATGTAGGAGGTGGGG + Intergenic
1160674533 19:382637-382659 ATGAGCAGATGTAGGAGGTGGGG + Intergenic
1161872407 19:6880350-6880372 AGGAGCATATGGAGAAGATGTGG + Intergenic
1162364255 19:10238312-10238334 CTGAGCCCATGGAGGAGATGAGG - Intergenic
1162455896 19:10784564-10784586 ATGAGCAAATGGAGAGGAAGGGG - Intronic
1163070346 19:14835293-14835315 ATGTGCCTATTGAGCAGATGTGG - Intronic
1163132604 19:15284991-15285013 GTGTGCACAGTGAGGAGATGAGG - Intronic
1163799199 19:19354833-19354855 ATCTGGAAATGGGGGAGCTGCGG - Intronic
1165773191 19:38389943-38389965 ATGTGCTGAGGGAGGAGAAGGGG + Intronic
1166929797 19:46295687-46295709 CTGGGCAGATGGAGCAGATGGGG - Intergenic
925671174 2:6311372-6311394 CTGTGTAAATGGAAGAGATGAGG + Intergenic
926383263 2:12312311-12312333 ATGAGGAAATGGCGGAGCTGGGG + Intergenic
929859095 2:45660479-45660501 CTCTGCAAATGGAGGACAAGTGG - Intronic
930246604 2:48990020-48990042 AGATCCAAAAGGAGGAGATGGGG - Intronic
930881713 2:56277998-56278020 GTGTGAACATGGGGGAGATGAGG + Intronic
932684226 2:73854314-73854336 ATTAGAAACTGGAGGAGATGGGG + Intronic
932742573 2:74303195-74303217 ATGTGCCTTTGTAGGAGATGGGG - Intronic
932745459 2:74330249-74330271 ATGTCTAGATGGAGGTGATGAGG + Intronic
932745620 2:74331117-74331139 AGGTGTAGATGGAGGAGGTGAGG + Intronic
933282545 2:80347795-80347817 ATGTGCAAATGAATCAGCTGGGG - Intronic
933792938 2:85897561-85897583 TTTAGCAAATGGAGAAGATGAGG + Intergenic
933904198 2:86873213-86873235 AAGTGAAATTGGAGAAGATGTGG + Intergenic
935204310 2:100884267-100884289 ATGGTCAACGGGAGGAGATGAGG - Intronic
935776307 2:106475769-106475791 AAGTGAAATTGGAGAAGATGTGG - Intergenic
936051108 2:109224176-109224198 ATGTGCAAATGGAGGGGGTGTGG + Intronic
936368041 2:111878923-111878945 AAGTGAAATTGGAGAAGATGTGG - Exonic
936888972 2:117347050-117347072 ATGTACAAAAGGAGGAAATATGG + Intergenic
937444031 2:121941330-121941352 ATGTGGAAAAAGAGGAGGTGGGG + Intergenic
937662144 2:124443558-124443580 ATGAGCAGATGGAGGAAGTGAGG + Intronic
939286239 2:140134092-140134114 ATGTGCAAAAGGAGGCAAAGTGG + Intergenic
939889638 2:147721367-147721389 ATGTGCAAATGGAGCAAATGGGG - Intergenic
940493918 2:154400971-154400993 GAGGGCAAATGAAGGAGATGAGG + Intronic
941229625 2:162895408-162895430 AAATGCACAAGGAGGAGATGGGG - Intergenic
942980301 2:182072628-182072650 ATGGGCAAATGGAAAAAATGAGG - Intronic
943774880 2:191754446-191754468 ATCTGCTGATGGAGGAGCTGAGG - Intergenic
944458741 2:199921978-199922000 ATGGGCAACTGGAGGGAATGGGG - Intronic
945000409 2:205344294-205344316 ATGTGGATATGGAGTGGATGAGG + Intronic
945443544 2:209909453-209909475 CTGTGCAGATGGAGATGATGCGG - Intronic
946378604 2:219329450-219329472 ATCTGCAAAGGGAGGGGAGGTGG - Intronic
946862968 2:224017676-224017698 ATTTTCAGATGGAGGAGCTGAGG - Intronic
947084073 2:226431207-226431229 ATGTACAATTGGAAGAGTTGTGG - Intergenic
947413756 2:229871359-229871381 ATGTTGAAATGTTGGAGATGGGG + Intronic
947450158 2:230200378-230200400 ATGTACAACTGGTGGAGTTGTGG - Intronic
947834065 2:233162878-233162900 ATGTCCAGAGGGAGGAGATCAGG - Intronic
1169555901 20:6749441-6749463 ATGTGCACTTGGAGGGTATGAGG + Intergenic
1170565465 20:17599771-17599793 ATGTGTGATTGCAGGAGATGTGG - Intronic
1172102920 20:32496366-32496388 ATATGCAAAAGGAGGAAATTTGG - Intronic
1172451398 20:35026540-35026562 ATGTGGAAATGCAGGAGACTTGG - Intronic
1172894787 20:38292764-38292786 GGGTGCAATGGGAGGAGATGAGG + Intronic
1172992278 20:39045454-39045476 GTGTTCATCTGGAGGAGATGTGG + Intergenic
1173494140 20:43507083-43507105 ATGTCGAAATGGAGGACCTGGGG + Intergenic
1173527433 20:43743944-43743966 AAGAGCAGATGGAGGAGGTGTGG + Intergenic
1173556148 20:43967261-43967283 ATGGGCAAATGGGGGAGATAGGG + Intronic
1173806852 20:45931702-45931724 GTGAGCAAACGGAGAAGATGAGG + Intergenic
1173908393 20:46645460-46645482 ATGAGGAAATTGAGGAGCTGGGG + Intronic
1174116322 20:48228977-48228999 AGGTGGAAATGCAGGAGGTGAGG + Intergenic
1175168021 20:57059869-57059891 ATGAGGAGAGGGAGGAGATGGGG + Intergenic
1175270770 20:57732292-57732314 ATTTGCCAATGGATGAGATGTGG - Intergenic
1177221723 21:18202441-18202463 ATGTGCCAAGGGTGGAGAAGGGG - Intronic
1178362690 21:31962719-31962741 ATTTTAAAAAGGAGGAGATGGGG - Intronic
1180244305 21:46536496-46536518 GTGTGAGAATTGAGGAGATGTGG + Intronic
1180469405 22:15641787-15641809 ATGGGTAGATGGAGGAGAAGAGG - Intergenic
1180565344 22:16659000-16659022 ATTTGCCAAGGGAGGAGATTAGG + Intergenic
1181579966 22:23822649-23822671 AGGGGAAAAGGGAGGAGATGAGG - Intronic
1182223689 22:28778735-28778757 ATTTACAAATGGAGAAGTTGAGG + Intronic
1182327615 22:29525577-29525599 ATTTGCAAATTGAGTAGGTGGGG - Intronic
1183109846 22:35641025-35641047 ATCTGACAATGGAGGAGGTGTGG - Intergenic
1183251208 22:36731752-36731774 ATTTCCAAATGGATGAGATGTGG - Intergenic
1183609796 22:38891981-38892003 ATCTGCAAAGGGAGGACATTTGG + Intergenic
1183665994 22:39245944-39245966 CAGTGCAAGCGGAGGAGATGAGG - Intergenic
1184280261 22:43433458-43433480 ATGAGTGAATGGAGGAGAAGAGG + Intronic
1184844907 22:47076480-47076502 ATGTCCAAATGCAGGGGATTTGG - Intronic
950419909 3:12892625-12892647 ATGTGTAGCTGGAGGAGGTGAGG - Intergenic
951761566 3:26153044-26153066 TTGTGCACATGCAGGAGATAGGG + Intergenic
952181912 3:30925666-30925688 GTGTGCACATGGAGGTGTTGAGG + Intergenic
953241289 3:41151618-41151640 ATGCGAAAATTGAGGAAATGTGG + Intergenic
953838002 3:46364047-46364069 AAGTGCAAAGGGAGAAGCTGTGG + Intergenic
954462414 3:50634875-50634897 ATGTGGATATGGAGGCCATGGGG + Intronic
955102868 3:55869214-55869236 ATGTGAAAATGGAGGAAAAAGGG + Intronic
955500951 3:59582319-59582341 AGGAGCAGATGGAGGAGAAGGGG - Intergenic
956745950 3:72311135-72311157 ATCTGCAAACTGTGGAGATGGGG - Intergenic
957073178 3:75581228-75581250 GTGGGCAAAGGGAGGAGATGTGG + Intergenic
957439396 3:80224394-80224416 ATGTCCAAAGGGAGGAGAAAAGG - Intergenic
958952996 3:100436496-100436518 AGATGCAGAGGGAGGAGATGAGG - Intronic
960204217 3:114875507-114875529 ATGTTAAAATGGAGAAAATGGGG + Intronic
960525350 3:118703768-118703790 AGGTGGAAAAGGAAGAGATGGGG - Intergenic
961105873 3:124240742-124240764 AGGTGCAAATGGAAGATATTTGG + Intronic
961167292 3:124772262-124772284 GTGTTTAATTGGAGGAGATGGGG - Intronic
961280903 3:125765552-125765574 GTGGGCAAAGGGAGGAGACGTGG - Intergenic
961844300 3:129748265-129748287 ATGGGTAAATGGATGAGATTTGG + Intronic
962364923 3:134772512-134772534 AAGAGAAAATGGAGGAGAAGAGG - Intronic
962747960 3:138411550-138411572 ATATAAAAATGGAAGAGATGTGG - Intergenic
964485600 3:157182417-157182439 ATATGCCAATGAAGGAGATGGGG - Intergenic
965300300 3:166999204-166999226 TTGTGCTAAGGGAGGAGAGGGGG + Intergenic
965491917 3:169348210-169348232 ATGTGCATAAGGACCAGATGAGG + Intronic
965540861 3:169870263-169870285 ATGTGCAAAGGAAGGAGGTGGGG - Intergenic
966388434 3:179426716-179426738 ATTTGCAAATGGATTCGATGGGG - Intronic
967264237 3:187676087-187676109 ATGTGCAAATGGAGGTGGGAGGG - Intergenic
967292162 3:187931782-187931804 ATGTGGAAATGGAAAAGAGGAGG - Intergenic
968985037 4:3870329-3870351 TTGGGGAAAGGGAGGAGATGGGG + Intergenic
969282674 4:6181628-6181650 ATATGCAGATGGAGGAGCAGGGG + Intronic
969796375 4:9531381-9531403 GTGGGCAAAGGGAGGAGACGTGG - Intergenic
969945012 4:10774749-10774771 ATGTACAGATGGAGGAACTGAGG + Intergenic
970275421 4:14394486-14394508 ATGCCCAAGGGGAGGAGATGGGG - Intergenic
972953314 4:44357150-44357172 ATGTGCTAGAGGAAGAGATGTGG - Intronic
975089818 4:70388760-70388782 ATGAGCTAATGTAGGAGCTGTGG - Intronic
979102248 4:116633255-116633277 TTGAGGAAAAGGAGGAGATGTGG + Intergenic
979813096 4:125064557-125064579 ATGTGGAGATGGAGGAGCTTTGG - Intergenic
980764263 4:137279070-137279092 ATGAATAAATGGAGGAGAAGAGG + Intergenic
981393868 4:144222992-144223014 ATGTACATTTGGAGGATATGTGG + Intergenic
982076375 4:151741433-151741455 ATATGCACATGGATGAGATATGG - Intronic
982887913 4:160806785-160806807 ATGTGGAATTGGAAAAGATGAGG + Intergenic
983499669 4:168484359-168484381 ATGATCAAAAGGAGGAGATGAGG - Intronic
984640860 4:182162986-182163008 ATGTACAAATACAGGAGAAGGGG - Intronic
986003901 5:3651565-3651587 ATGAGCAGATGGAGGAGAATGGG + Intergenic
986229876 5:5853298-5853320 ATGTGCAAATGTACAAAATGAGG - Intergenic
986416579 5:7534959-7534981 ATGTGCAACAGAAGGAGAGGTGG - Intronic
986434071 5:7710647-7710669 ATGAGCAAAGGGAGGTCATGGGG + Intronic
986593497 5:9395908-9395930 AGATGAAACTGGAGGAGATGGGG + Intronic
987082490 5:14438180-14438202 ATGTGAAAATGGAGCGAATGGGG - Intronic
987853192 5:23383366-23383388 GTTTGCAAATGGAAGAGAAGAGG - Intergenic
988156293 5:27454448-27454470 GTGTACAAATGGAAGAAATGAGG + Intergenic
988776565 5:34482582-34482604 ATGGGCAGGTGGAGGAGCTGGGG - Intergenic
989146264 5:38253060-38253082 ATCTCCACAGGGAGGAGATGTGG - Intergenic
990583617 5:57188883-57188905 ATTTGCTAATGGATTAGATGGGG - Intronic
990795773 5:59538837-59538859 ATGTGCATATGGTGGAGTTTAGG - Intronic
991698831 5:69298485-69298507 ATGTACAAATGGTGGATCTGTGG + Intronic
992781929 5:80135729-80135751 AAGTGTGAATGGAAGAGATGGGG + Intronic
993151339 5:84166204-84166226 ATCTCCAAAAGGAGGAGATGAGG + Intronic
994006772 5:94846497-94846519 ATGTGAAAATGGAGAATAGGAGG + Intronic
994042562 5:95274944-95274966 ATGTGGAAATTGTGGAGGTGGGG - Intronic
994533162 5:100992567-100992589 ATGGGCAGATGCAGGAGCTGGGG + Intergenic
994876808 5:105433906-105433928 ATGTGCATATGTAGGAACTGTGG + Intergenic
995933014 5:117473599-117473621 ATGTGGAACAGCAGGAGATGGGG - Intergenic
996656411 5:125942283-125942305 ATGTGCAATGGTTGGAGATGGGG + Intergenic
997578027 5:134997701-134997723 ATGTGCAGAGGGAGCAGAGGAGG - Intronic
999117061 5:149173516-149173538 ATGGGAAAGTGGATGAGATGGGG + Intronic
999747358 5:154602686-154602708 CTGGGCAGATGGAGGAGATGGGG - Intergenic
1000349702 5:160343818-160343840 GTGTGCAAGGGGAGAAGATGAGG - Intronic
1001079748 5:168658927-168658949 AAGTGGAGCTGGAGGAGATGAGG + Intergenic
1004354793 6:14921557-14921579 ATGTACAAATGAGGGAGAAGGGG + Intergenic
1005308257 6:24534199-24534221 ATGTGCATCTGGAGGTGTTGCGG + Exonic
1006573084 6:35021439-35021461 AGGTGGAGATGGAGGAGCTGGGG - Intronic
1006896145 6:37472332-37472354 ATATGCAGGTGGAGGAGATAGGG - Intronic
1007688751 6:43683998-43684020 GAATGCAAAAGGAGGAGATGGGG + Intronic
1008036812 6:46753719-46753741 AAGGGCAAATGGAGGTGATACGG + Exonic
1008057875 6:46963912-46963934 TTGGGGAAATGGAGGACATGGGG - Intergenic
1008101665 6:47398470-47398492 ATGTGAAAATGGAAGGGTTGGGG - Intergenic
1009195822 6:60683326-60683348 AGGTGAAAGTGGAAGAGATGAGG + Intergenic
1009818613 6:68770322-68770344 ATGTGCAAAGTGACGAGAAGAGG - Intronic
1010453974 6:76033498-76033520 TTGTGCAAGTTGAGGAGAAGAGG + Intronic
1011559821 6:88602985-88603007 AGGAGGAAATGGAGGTGATGGGG - Intergenic
1011919336 6:92552065-92552087 ATGTGAAAATGGACAAGATATGG + Intergenic
1012818150 6:104050740-104050762 ATGTGCAGAGAGAGGAGAGGGGG + Intergenic
1013681559 6:112529794-112529816 ATGTGCAAATCTTAGAGATGAGG + Intergenic
1014909970 6:127080011-127080033 CTCTGAAAATGGAAGAGATGTGG - Intergenic
1016696635 6:147003849-147003871 ATGTGGAGATGGTGGAGATATGG - Intergenic
1018040194 6:159915132-159915154 GTGTGCCAATGTAGGAGAAGGGG - Exonic
1019042899 6:169120995-169121017 TTGTGCTAATGGAGGAGAGGGGG - Intergenic
1021240625 7:18196404-18196426 CTGGGCAAATGGATGAGATTGGG + Intronic
1021404727 7:20251907-20251929 ATGTCCAACTGAAGGAGAAGAGG - Intergenic
1021835482 7:24668707-24668729 ATGGGCATATGGAGGAAAGGGGG + Intronic
1024743476 7:52380619-52380641 ATGTGCAAGGGCAGGAGAGGGGG + Intergenic
1025201645 7:56965815-56965837 ATATGCATATGGGGGAGATTGGG + Intergenic
1025670301 7:63611115-63611137 ATATGCATATGGGGGAGATTGGG - Intergenic
1026853451 7:73738559-73738581 AGGCCCAAAGGGAGGAGATGGGG + Intronic
1026904745 7:74056536-74056558 ATGTGCTCAGGGAGGAGTTGGGG + Intronic
1027253069 7:76411173-76411195 ATGTGCAGATGGAGGGAAAGAGG - Intronic
1028181327 7:87728864-87728886 ATCTCCAGATGGAGGTGATGTGG + Intronic
1028365901 7:90031542-90031564 ATGTGGATATGGGGGAGGTGGGG + Intergenic
1028385615 7:90249712-90249734 ATGTGCATATGGAGCACATGGGG + Intronic
1029075253 7:97929322-97929344 GTGGGCAAAGGGAGGAGACGTGG + Intergenic
1030020695 7:105272732-105272754 AGGTGAAAATGGAGGATATGTGG - Intronic
1031203611 7:118724512-118724534 ATAGGCAAATGGAAGATATGAGG - Intergenic
1031259915 7:119505914-119505936 ATCTCCAGATGGAGGTGATGTGG + Intergenic
1031379897 7:121072575-121072597 ATGTGCTGATGGTTGAGATGTGG + Intronic
1031532674 7:122895278-122895300 AGGTGCTAATGCAGGAGATGGGG + Intergenic
1032092349 7:128917300-128917322 CTGTGGACATGCAGGAGATGGGG - Intergenic
1032234929 7:130112523-130112545 ATTTGCAGATGGAGAAGTTGGGG + Intronic
1032654516 7:133913017-133913039 ATGTACCAAGGGAGGAGCTGGGG + Intronic
1033023154 7:137747483-137747505 TTGTGTAAATGGAGAGGATGAGG - Intronic
1033335530 7:140448971-140448993 ACGTGCAAATGAATGAGAGGAGG - Intergenic
1034013885 7:147560729-147560751 ATGTGCAAAGGGAGGAAATGAGG + Intronic
1036242271 8:7091056-7091078 GTGGGCAAAGGGAGGAGACGTGG - Intergenic
1036258521 8:7222956-7222978 GTGGGCAAAGGGAGGAGACGTGG + Intergenic
1036307047 8:7610424-7610446 GTGGGCAAAGGGAGGAGACGTGG - Intergenic
1036308100 8:7616552-7616574 GTGGGCAAAGGGAGGAGACGTGG - Intergenic
1036310576 8:7681552-7681574 GTGGGCAAAGGGAGGAGACGTGG + Intergenic
1036357894 8:8058411-8058433 GTGGGCAAAGGGAGGAGACGTGG - Intergenic
1036358956 8:8064553-8064575 GTGGGCAAAGGGAGGAGACGTGG - Intergenic
1036570845 8:9978614-9978636 ATGAGTATAGGGAGGAGATGGGG - Intergenic
1036629495 8:10500764-10500786 GTGAGAAAAAGGAGGAGATGGGG + Intergenic
1036830465 8:12016074-12016096 GTGGGCAAAGGGAGGAGACGTGG + Intergenic
1036892002 8:12602399-12602421 GTGGGCAAAGGGAGGAGACGTGG + Intergenic
1036893055 8:12608535-12608557 GTGGGCAAAGGGAGGAGACGTGG + Intergenic
1036899550 8:12660374-12660396 GTGGGCAAAGGGAGGAGACGTGG + Intergenic
1036900615 8:12666521-12666543 GTGGGCAAAGGGAGGAGACGTGG + Intergenic
1037690251 8:21175915-21175937 TTCTGCAAATGGGGGAAATGTGG - Intergenic
1037773022 8:21813989-21814011 ATGTGCACATGGATAATATGAGG + Intergenic
1037938852 8:22934512-22934534 AGGTAGAAATGGAGGAAATGAGG + Intronic
1038510579 8:28130666-28130688 TTGTGCAGATGGAGGGGAAGGGG + Intronic
1041725066 8:61010625-61010647 ATTTGTTAATGGTGGAGATGAGG + Intergenic
1042100631 8:65271930-65271952 ATGTGTAAATAAAGGAGATTGGG - Intergenic
1042135504 8:65629403-65629425 ATAGGCAAAATGAGGAGATGAGG + Intronic
1044823075 8:96171085-96171107 AGGTGCAGATGGTGGAGAGGAGG - Intergenic
1045299664 8:100900227-100900249 ATTTGAAAAAGGAGGAAATGAGG - Intergenic
1045472807 8:102527433-102527455 ATTTCAAAATGTAGGAGATGGGG - Intergenic
1046596317 8:116265350-116265372 ATGTGCACATGGTGGAGATGAGG - Intergenic
1047638440 8:126792544-126792566 ATGGGGAAAGGGAGGAGCTGGGG + Intergenic
1048000374 8:130375032-130375054 ATGTGCAAGTGGACGAGGTGAGG - Intronic
1048298217 8:133231673-133231695 ATGTGCAGATGGTGGAAACGAGG + Intergenic
1048744589 8:137599770-137599792 ATCTGGAAATGGAGTAGGTGAGG + Intergenic
1052694657 9:31861294-31861316 ATATGGACATGTAGGAGATGGGG - Intergenic
1053565535 9:39246469-39246491 ATGTGCAAACGGGGCATATGAGG + Intronic
1053831301 9:42084322-42084344 ATGTGCAAATGGGGCATATGCGG + Intronic
1054131613 9:61372570-61372592 ATGTGCAAACGGGGCATATGAGG - Intergenic
1054599246 9:67103116-67103138 ATGTGCAAATGGGGCATATGAGG - Intergenic
1055031139 9:71772161-71772183 ATGGGCAAAGGGAGTAGCTGGGG + Intronic
1055465131 9:76558014-76558036 ATGTGCAAATGGAATAGATTGGG - Intergenic
1055979465 9:81987960-81987982 ATGTGCACATGGAATACATGAGG + Intergenic
1056009979 9:82318333-82318355 ATGTTCAAAAATAGGAGATGAGG + Intergenic
1056113075 9:83415310-83415332 AGGAGCAAATGGAAGAGATCTGG + Intronic
1056575661 9:87854389-87854411 AAATGTTAATGGAGGAGATGAGG + Intergenic
1057043735 9:91867387-91867409 TTCTGCAATTGGAGGAGCTGGGG + Intronic
1057302557 9:93895286-93895308 ATGTGCAGATGGAGAAACTGAGG + Intergenic
1061070166 9:128304972-128304994 ATGAGCACAGGGAGGAGATCTGG - Intergenic
1061739324 9:132688860-132688882 ATCTGCAAAAGGAGGACAAGTGG - Exonic
1185798763 X:2989959-2989981 GTCTGCAAATGCAGGAGCTGGGG + Intergenic
1186066303 X:5769409-5769431 ATATGCAAATGGAATAAATGAGG + Intergenic
1186569737 X:10701558-10701580 AGGTGGAATTAGAGGAGATGCGG + Intronic
1186804989 X:13131893-13131915 AAATGTAAATGGAGGAGCTGTGG - Intergenic
1187126546 X:16459647-16459669 AGGTGCAGATGGATGACATGTGG + Intergenic
1187619981 X:21041502-21041524 ATTTGCTAATGGATTAGATGTGG - Intergenic
1187953549 X:24493795-24493817 ACCTGCAAATGGAGGAGTTGGGG + Intronic
1188811135 X:34656045-34656067 AGCTGCAAATGGATAAGATGGGG - Intronic
1189388959 X:40559963-40559985 ATGAGCAATTAGAGTAGATGTGG - Intergenic
1190708286 X:53048510-53048532 CCGTGCAAATCGAGGAGAGGGGG + Intergenic
1192331015 X:70175330-70175352 ATGGGTGAATGGAGGAGATCTGG - Intergenic
1193010433 X:76669510-76669532 ATGTGCACATGAAGGACACGAGG + Intergenic
1193511981 X:82413588-82413610 ATGAGCTAAGGGAGGAGAAGAGG - Intergenic
1193576608 X:83206345-83206367 ATGTGTTCATGGATGAGATGGGG - Intergenic
1193862573 X:86688317-86688339 AGGGCCAATTGGAGGAGATGAGG + Intronic
1195618798 X:106933312-106933334 TTGTGCAAGGGAAGGAGATGAGG - Intronic
1195768019 X:108317361-108317383 ATATTCAAATGGAGGAGTTGAGG + Intronic
1195961603 X:110393049-110393071 ATGTGCAAATTGTGCAAATGTGG - Intronic
1197177541 X:123501409-123501431 ATGGGCAAATGAATGAAATGTGG + Intergenic
1198041614 X:132858712-132858734 ATGTGGAGATGGTGGAGAAGAGG + Intronic
1201052271 Y:9949454-9949476 ATCTGCGAATAGAGGAAATGTGG + Intergenic
1201501432 Y:14647192-14647214 ATGTGAGAATGGATTAGATGTGG + Intronic
1202130869 Y:21607869-21607891 CTTTGAAAAAGGAGGAGATGAGG + Intergenic
1202601717 Y:26600392-26600414 ATTTGCCAAGGGAGGAGATTAGG + Intergenic