ID: 1152532549

View in Genome Browser
Species Human (GRCh38)
Location 17:80927842-80927864
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 436}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152532549_1152532552 -6 Left 1152532549 17:80927842-80927864 CCTCCATTTGCACATCTGAGAAT 0: 1
1: 0
2: 1
3: 35
4: 436
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532549_1152532561 23 Left 1152532549 17:80927842-80927864 CCTCCATTTGCACATCTGAGAAT 0: 1
1: 0
2: 1
3: 35
4: 436
Right 1152532561 17:80927888-80927910 AGGGTGTCAGCCTTGTGGTCTGG 0: 1
1: 0
2: 0
3: 23
4: 483
1152532549_1152532557 4 Left 1152532549 17:80927842-80927864 CCTCCATTTGCACATCTGAGAAT 0: 1
1: 0
2: 1
3: 35
4: 436
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1152532549_1152532560 18 Left 1152532549 17:80927842-80927864 CCTCCATTTGCACATCTGAGAAT 0: 1
1: 0
2: 1
3: 35
4: 436
Right 1152532560 17:80927883-80927905 GCTGGAGGGTGTCAGCCTTGTGG 0: 1
1: 0
2: 0
3: 22
4: 260
1152532549_1152532553 0 Left 1152532549 17:80927842-80927864 CCTCCATTTGCACATCTGAGAAT 0: 1
1: 0
2: 1
3: 35
4: 436
Right 1152532553 17:80927865-80927887 TCCCGCCCGCACGGAGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 358
1152532549_1152532551 -9 Left 1152532549 17:80927842-80927864 CCTCCATTTGCACATCTGAGAAT 0: 1
1: 0
2: 1
3: 35
4: 436
Right 1152532551 17:80927856-80927878 TCTGAGAATTCCCGCCCGCACGG 0: 1
1: 0
2: 0
3: 2
4: 43
1152532549_1152532556 3 Left 1152532549 17:80927842-80927864 CCTCCATTTGCACATCTGAGAAT 0: 1
1: 0
2: 1
3: 35
4: 436
Right 1152532556 17:80927868-80927890 CGCCCGCACGGAGGAGCTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152532549 Original CRISPR ATTCTCAGATGTGCAAATGG AGG (reversed) Intronic