ID: 1152532549

View in Genome Browser
Species Human (GRCh38)
Location 17:80927842-80927864
Sequence ATTCTCAGATGTGCAAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 436}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152532549_1152532560 18 Left 1152532549 17:80927842-80927864 CCTCCATTTGCACATCTGAGAAT 0: 1
1: 0
2: 1
3: 35
4: 436
Right 1152532560 17:80927883-80927905 GCTGGAGGGTGTCAGCCTTGTGG 0: 1
1: 0
2: 0
3: 22
4: 260
1152532549_1152532556 3 Left 1152532549 17:80927842-80927864 CCTCCATTTGCACATCTGAGAAT 0: 1
1: 0
2: 1
3: 35
4: 436
Right 1152532556 17:80927868-80927890 CGCCCGCACGGAGGAGCTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 157
1152532549_1152532552 -6 Left 1152532549 17:80927842-80927864 CCTCCATTTGCACATCTGAGAAT 0: 1
1: 0
2: 1
3: 35
4: 436
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532549_1152532557 4 Left 1152532549 17:80927842-80927864 CCTCCATTTGCACATCTGAGAAT 0: 1
1: 0
2: 1
3: 35
4: 436
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1152532549_1152532553 0 Left 1152532549 17:80927842-80927864 CCTCCATTTGCACATCTGAGAAT 0: 1
1: 0
2: 1
3: 35
4: 436
Right 1152532553 17:80927865-80927887 TCCCGCCCGCACGGAGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 358
1152532549_1152532551 -9 Left 1152532549 17:80927842-80927864 CCTCCATTTGCACATCTGAGAAT 0: 1
1: 0
2: 1
3: 35
4: 436
Right 1152532551 17:80927856-80927878 TCTGAGAATTCCCGCCCGCACGG 0: 1
1: 0
2: 0
3: 2
4: 43
1152532549_1152532561 23 Left 1152532549 17:80927842-80927864 CCTCCATTTGCACATCTGAGAAT 0: 1
1: 0
2: 1
3: 35
4: 436
Right 1152532561 17:80927888-80927910 AGGGTGTCAGCCTTGTGGTCTGG 0: 1
1: 0
2: 0
3: 23
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152532549 Original CRISPR ATTCTCAGATGTGCAAATGG AGG (reversed) Intronic
900829543 1:4956083-4956105 ATTTTCAGATGAGAAAATTGGGG + Intergenic
900846848 1:5110819-5110841 ATTTTCTGATCTGCAATTGGTGG - Intergenic
901822600 1:11839838-11839860 CTTCACAGATGTGCAAGCGGTGG - Intronic
902511360 1:16968533-16968555 TTTCACAGATGGACAAATGGAGG + Intronic
902548826 1:17207401-17207423 ATTTTCAGATGTGGAAACTGAGG - Intronic
902563139 1:17290753-17290775 TTTTACAGATGAGCAAATGGAGG - Intergenic
902676703 1:18013696-18013718 ATTCACAGATGTGGAAACTGAGG - Intergenic
903353591 1:22732669-22732691 ATTTTCTGATTTGCAATTGGAGG + Intronic
904574359 1:31493828-31493850 TTTTTCAGATGAGGAAATGGAGG + Intergenic
904805289 1:33127167-33127189 ATGCTCAGATGAGAAAACGGAGG - Intergenic
905527571 1:38650610-38650632 ATTTTCAGATGGGAAAGTGGAGG + Intergenic
905869115 1:41392933-41392955 CTTAACAGATGTGGAAATGGAGG + Intergenic
906746215 1:48223881-48223903 TTTTACAGATGTGAAAATGGAGG - Intronic
907257211 1:53188805-53188827 ATTCCCAGATATGGAAATAGGGG + Intergenic
907372800 1:54014032-54014054 TGTCACAGATGTGCAAATGGAGG + Intronic
907736062 1:57113367-57113389 TTTCTCAGATGGGGAAATTGAGG + Intronic
908335320 1:63116836-63116858 ATTCTAAGATGAGGAAATGGAGG - Intergenic
908377274 1:63556414-63556436 AATCCCAGATCTGCAAATGGAGG - Intronic
908469902 1:64433509-64433531 ATTCACAAATGGGCAAATGAAGG - Intergenic
908871153 1:68614438-68614460 ATTCTCAAATGTGCAAAAAAGGG - Intergenic
909140393 1:71857293-71857315 TTTTTCAGATGAGAAAATGGTGG - Intronic
909592473 1:77366230-77366252 GTTCACAGATGAGCAAATAGAGG - Intronic
910562437 1:88605677-88605699 ATTCTCAGATGTATAAGTGTTGG - Intergenic
912360677 1:109092343-109092365 ACTGTCAGATGTGCAACTGTTGG - Intronic
912566111 1:110588596-110588618 ATTTTCAGATGAGAAAATTGAGG - Intergenic
913984821 1:143555441-143555463 TTTTGCAGATGTGGAAATGGTGG - Intergenic
914203844 1:145509736-145509758 TTTCACAGATGTGGAAATGGTGG - Intergenic
914482967 1:148082890-148082912 TTTCACAGATGTGGAAATGGTGG - Intergenic
914581222 1:149020839-149020861 TTTCGCAGATATGGAAATGGAGG - Intronic
914824347 1:151131024-151131046 TTTTTCAGATGAACAAATGGAGG + Intergenic
915223778 1:154396428-154396450 TTTCTGACATGAGCAAATGGTGG + Intergenic
915380720 1:155437584-155437606 ATTCTCAGAAGTGGAATTGCTGG - Intronic
915675282 1:157524241-157524263 GTTCTCAGATGTGCTGCTGGTGG + Intronic
916149630 1:161774022-161774044 ACTTTCAGATGTGAAAAAGGAGG - Intronic
916513446 1:165493993-165494015 TTTTACAGATGAGCAAATGGAGG + Intergenic
917672772 1:177288829-177288851 TTTCACAGATGTGCAAACTGAGG - Intergenic
918087997 1:181261721-181261743 ATTCACAGATGTGGAAACTGAGG + Intergenic
918341726 1:183573314-183573336 ATTCCCTTATGTGAAAATGGGGG + Intronic
918857927 1:189782573-189782595 ATTCTCAGAGGAGCAACTGGGGG - Intergenic
919090240 1:192970134-192970156 ATTTACAGATGAGAAAATGGAGG - Intergenic
919810529 1:201406234-201406256 ATTTACAGATGAGGAAATGGAGG - Exonic
921566457 1:216727472-216727494 ATTTTCAGATGAGGAAATGAGGG - Intronic
922325450 1:224524178-224524200 CACCTCAGATGTGGAAATGGAGG + Intronic
922654011 1:227365092-227365114 ATATTCAGCTGTGCAAATGCAGG + Intergenic
922742674 1:228022981-228023003 ATTCTCATCTGTGCACACGGTGG + Intronic
922988122 1:229882564-229882586 ATTTTAAGATGAGGAAATGGAGG + Intergenic
923241866 1:232093295-232093317 ATTCTCAGATATGCCTATAGTGG - Intergenic
923653296 1:235893639-235893661 ATTCACAGATGAGGAAATTGAGG - Intergenic
923692415 1:236207678-236207700 ATTCTAAGATGAGGAAATTGAGG + Intronic
924404057 1:243723421-243723443 ATTCTTAGATCTGGAGATGGAGG - Intronic
924451509 1:244182906-244182928 TTTCTCAGATGAGAAAATTGAGG - Intergenic
924579357 1:245310582-245310604 ACTCTCAGCGGTGAAAATGGGGG + Intronic
1062852213 10:753356-753378 GTTCTCTGACTTGCAAATGGTGG + Intergenic
1063728318 10:8665493-8665515 ATTTACAGATGTGCAAACTGTGG + Intergenic
1063874891 10:10464475-10464497 ATTCTCAAATTTTCAAATTGAGG + Intergenic
1063951631 10:11228753-11228775 ATTCTCAAATGATAAAATGGTGG - Intronic
1067016667 10:42761382-42761404 TTTCACAGATGTGGAAATTGAGG + Intergenic
1067703655 10:48590965-48590987 TTTCTCAGATGTTCGAATTGAGG + Intronic
1067933265 10:50584764-50584786 ATTCAAAGATGTGAAAATGCAGG - Intronic
1068327809 10:55517629-55517651 ATTCTCAAAAGTGCAATTGCTGG - Intronic
1069734646 10:70645838-70645860 GTTTTCAGATGTGGAAACGGAGG - Intergenic
1069897062 10:71686486-71686508 ATTCTCTGATGTCCCAAGGGGGG + Intronic
1070648771 10:78220162-78220184 TTTCCCAGATGGGGAAATGGAGG - Intergenic
1070677493 10:78422240-78422262 ATTTTCAGATGTGGAAACGGAGG + Intergenic
1070779420 10:79128898-79128920 ATTTTCAGATGAGGAAATTGAGG - Intronic
1071728045 10:88219335-88219357 ATTCTCATCTGTGCAAAAAGAGG + Intergenic
1071791435 10:88958424-88958446 ATTTACAGATGAGGAAATGGAGG + Intronic
1072325999 10:94299370-94299392 TTTCTCAGATGAGCAAATCAAGG + Intronic
1074360977 10:112823921-112823943 ATTTTCAGATGGGGAAATGGGGG + Intergenic
1074707540 10:116148459-116148481 CTTCACAGATGAGGAAATGGAGG - Intronic
1074869748 10:117567329-117567351 CTTTGCAGATGAGCAAATGGAGG + Intergenic
1076242072 10:128916075-128916097 TTTCTCAGATAAGGAAATGGAGG + Intergenic
1076614683 10:131747738-131747760 CTTCACAGATGAGCAAATGAGGG - Intergenic
1077432697 11:2523857-2523879 ACTCTCAGATGAGCAAATGGAGG - Intronic
1078263601 11:9735525-9735547 ATTCTCAGAAGTGGGAATGCTGG + Intronic
1078507417 11:11962650-11962672 TTTCACAGATGAACAAATGGAGG - Intergenic
1078553458 11:12297063-12297085 ATTCTTAGAAGTGGAAATGCTGG + Intronic
1079371279 11:19855088-19855110 TTTTTCAGATGGGGAAATGGAGG - Intronic
1079486823 11:20943656-20943678 ATACCCAGATGTGAAAATCGAGG + Intronic
1079514502 11:21251091-21251113 ATTATCAGATATAAAAATGGAGG + Intronic
1079782290 11:24622692-24622714 ATTACCAGATGAGTAAATGGAGG - Intronic
1079788420 11:24705446-24705468 GTTCTAAGATGTGAGAATGGGGG + Intronic
1083417850 11:62536830-62536852 TTTCACAGATGAGGAAATGGAGG - Intronic
1084023861 11:66435718-66435740 CTTCTCAGATGTGCAAACTGAGG - Exonic
1084689072 11:70714470-70714492 CTTATCAGATGTGGAAATCGAGG + Intronic
1084696514 11:70758784-70758806 GTTCTCACATGTGAAGATGGAGG - Intronic
1085232350 11:74983056-74983078 ATTCACAGATGTGAAAGTTGTGG + Intergenic
1085386503 11:76161112-76161134 GTTCTCATATGTGGACATGGAGG - Intergenic
1085424201 11:76388986-76389008 ATTCCCAGAAGTGGAATTGGAGG - Intronic
1085711273 11:78831061-78831083 CTTTTCAGATGAGAAAATGGAGG + Intronic
1086775476 11:90826131-90826153 ATTTACAGATGTGAAAATTGAGG - Intergenic
1087479252 11:98679164-98679186 ATTCTCAGACAAGCAAATGCAGG - Intergenic
1087530696 11:99377646-99377668 AGTCTCATATTTGTAAATGGAGG - Intronic
1089615808 11:119694141-119694163 ATTCACAGAGGGGGAAATGGAGG + Intronic
1089654562 11:119937445-119937467 ATTTTCAGAAGTGGAAATAGAGG - Intergenic
1089796348 11:120984422-120984444 TTTCACAAATGTGGAAATGGAGG - Intronic
1090979637 11:131707505-131707527 ATTCCCAGAAGTGGAATTGGTGG + Intronic
1091078521 11:132643595-132643617 AGCCACAGATGTACAAATGGAGG - Intronic
1091236826 11:134027675-134027697 TTTCACAGATGAGGAAATGGAGG + Intergenic
1091352247 11:134906824-134906846 CTTCTCAGATGAGCAAAATGTGG - Intergenic
1092731658 12:11540423-11540445 ATTCTCATGTGTGGACATGGAGG - Intergenic
1093029616 12:14276109-14276131 AGTCTCAGATGTGGCCATGGAGG - Intergenic
1093242105 12:16689521-16689543 ATTTTCAGATAAGCAAATTGAGG - Intergenic
1095592695 12:43921837-43921859 AATGTCAGCTGAGCAAATGGGGG - Intronic
1096315200 12:50558455-50558477 GTTTACAGATGTGGAAATGGAGG + Intronic
1096574192 12:52542532-52542554 ATTCTCAAATGTGAAGGTGGAGG - Intergenic
1096895974 12:54820917-54820939 ATTCACAGATCTGCATATGGAGG - Intergenic
1098087201 12:66859084-66859106 ATTCCCAAATGTGCAAAGTGTGG - Intergenic
1098870323 12:75810258-75810280 ATATTCAGATGAGGAAATGGAGG - Intergenic
1099888535 12:88561398-88561420 ATGATCAGATGTGGAAATAGGGG - Intronic
1100915521 12:99416363-99416385 ATTCCCAGAAGTACAAATGCTGG + Intronic
1103961021 12:124609407-124609429 ATTCCCAGATGAGCAAACCGAGG - Intergenic
1104526651 12:129530461-129530483 ATTCACAGCTGGGCAAAGGGAGG - Intronic
1106505077 13:30364113-30364135 ATTTTCTGATGTGAGAATGGAGG - Intergenic
1107069886 13:36257885-36257907 ATTCACAGATCTGAATATGGAGG - Intronic
1107845698 13:44510427-44510449 ATTCACAGAAGTGCAATTGCAGG - Intronic
1107884572 13:44864639-44864661 GTTCTGAAATGTGCAAATGATGG + Intergenic
1108435002 13:50393269-50393291 CTTCACAGATGAGGAAATGGAGG + Intronic
1110709537 13:78634662-78634684 ATTTTCAGATGAGAAAATGGAGG - Intronic
1111962530 13:94826606-94826628 ATTTTCAGATGTGAAAATTGAGG + Intergenic
1112269526 13:97955683-97955705 ATTTACAGATGAGGAAATGGAGG + Intronic
1113720371 13:112551689-112551711 ATTCTCACATCTGCAAAATGGGG + Intronic
1114138734 14:19886606-19886628 ACTCTCAGAATTCCAAATGGGGG - Intergenic
1115171871 14:30517538-30517560 ATCCTCAGAAGTTCTAATGGTGG - Intergenic
1115322402 14:32097302-32097324 TATATCAGATGTGCAAAGGGTGG + Intronic
1115694117 14:35877962-35877984 ATTTTCAGATGGGGAAATTGAGG - Intronic
1115897347 14:38105065-38105087 ATTCTCAGGAGGGCAAATAGGGG + Intergenic
1116193864 14:41696580-41696602 ATTCTCAGAAGAGCAATTGCTGG + Intronic
1117256473 14:53983283-53983305 TTTCTCAGATGAGGAAATTGAGG + Intergenic
1118407048 14:65435308-65435330 ATTCTCAGATATGGAACTAGTGG + Intronic
1119662992 14:76464822-76464844 ATTCACAGATGGGAAAATTGAGG + Intronic
1120905844 14:89620595-89620617 ATTTTCAGATGAGAAATTGGAGG + Intergenic
1122146651 14:99693009-99693031 TTTCACAGATGAGGAAATGGAGG - Intronic
1123986404 15:25650215-25650237 ATTCTCACATGGGGAAAGGGGGG + Intergenic
1126077092 15:44922025-44922047 ATTCTCAGATGTGGAAATTATGG - Intergenic
1126121299 15:45253898-45253920 ATACTCAGATTTGGGAATGGTGG + Intronic
1126180449 15:45780340-45780362 ATTCTCAGATGAGAACATGGGGG - Intergenic
1127973124 15:63977750-63977772 ATTCTCAGATGAGAAAACTGAGG + Intronic
1128052035 15:64673027-64673049 TTTCTCAGAAATGCAAAGGGAGG - Intronic
1128577335 15:68785117-68785139 TTTCACATATGTGGAAATGGAGG + Intronic
1128978770 15:72171512-72171534 ATTCTCAGAAGTGAAATTAGTGG + Intronic
1129090552 15:73145412-73145434 ATTATCAGATGTGGAACTGCTGG - Intronic
1129448794 15:75637813-75637835 CTTTTCAGATGAGGAAATGGAGG - Intergenic
1131114093 15:89783673-89783695 ACTCTTTGATGTGCAGATGGTGG + Intergenic
1131537054 15:93246180-93246202 TTTTTCAGATGGGGAAATGGAGG + Intergenic
1132024110 15:98390531-98390553 ATTTTCAGAGGGGGAAATGGAGG - Intergenic
1132162340 15:99554587-99554609 ATTCTTAGATGTGGAATTGCTGG + Intergenic
1132725323 16:1335912-1335934 CATCTCAGATGGGCAAACGGAGG - Intronic
1133716199 16:8451651-8451673 TTTCACAGATGAGGAAATGGAGG - Intergenic
1134118930 16:11570135-11570157 CTTCTACGGTGTGCAAATGGGGG + Intronic
1135430739 16:22380742-22380764 ATTCTCAGATTTCAAAATGCTGG - Intronic
1135852651 16:25978631-25978653 ATTTTCAGATGAGAAAATTGAGG - Intronic
1135946144 16:26866694-26866716 TTTGTCAGAGGGGCAAATGGAGG - Intergenic
1136655050 16:31704478-31704500 TTTCGCAGATGAGCATATGGAGG + Intergenic
1137507222 16:49064724-49064746 ATTCTCATCTGTAAAAATGGGGG + Intergenic
1137621913 16:49881828-49881850 TTTCACAGATGTAGAAATGGAGG - Intergenic
1137784365 16:51125796-51125818 CTTCTCAGGTGAGGAAATGGGGG - Intergenic
1138159867 16:54743478-54743500 ATTTTCAGATGGGTAAATTGAGG + Intergenic
1139277469 16:65741294-65741316 CTTCGCAGATGAGGAAATGGAGG + Intergenic
1139420664 16:66847697-66847719 TCTCTCAGATGGGCAAATAGAGG + Intronic
1140220643 16:73041188-73041210 ACTCCCAGATGTGTAACTGGAGG - Intronic
1140977637 16:80075402-80075424 ATTCACAGATGTAGAAATTGAGG - Intergenic
1141109427 16:81259870-81259892 ATTGTCAGAGGAGCAAATGCTGG - Intronic
1141317554 16:82976635-82976657 GCTTGCAGATGTGCAAATGGTGG + Intronic
1141635080 16:85310261-85310283 ATTTCCAGATGTGCAAAGTGAGG - Intergenic
1141810484 16:86372366-86372388 TTTCACAGATGTGCAAACCGAGG + Intergenic
1143733233 17:8893280-8893302 ATTTTCAGATGAGGAACTGGAGG - Intronic
1144067979 17:11641479-11641501 ATTTTCAGATGAAGAAATGGAGG + Intronic
1144235053 17:13252240-13252262 AGTCTCAGATCTGCAAATCATGG - Intergenic
1144570533 17:16395493-16395515 ATTCCCAGATGTGGAATTGCTGG - Intergenic
1145901309 17:28492037-28492059 TTTCACAGATGCGCAAATTGAGG + Intronic
1146700958 17:34959785-34959807 ATTCTGTGAGCTGCAAATGGTGG - Intronic
1147439010 17:40436166-40436188 TTTCACAGATGAGGAAATGGAGG + Intergenic
1150475962 17:65475359-65475381 ATCCTCAGATGTGAAGATTGAGG - Intergenic
1150579106 17:66456221-66456243 ATTCTCAGAATTGCTACTGGAGG - Intronic
1150952591 17:69820616-69820638 TTTCTCCGATGAGAAAATGGAGG + Intergenic
1150978434 17:70114995-70115017 ATTTTCAGATGGGCAAACAGAGG + Intronic
1151185188 17:72359056-72359078 ATTTAAAGATGTGGAAATGGAGG + Intergenic
1152408505 17:80110595-80110617 TCTCTCAGATTTGCAAATGTGGG + Intergenic
1152532549 17:80927842-80927864 ATTCTCAGATGTGCAAATGGAGG - Intronic
1153797169 18:8634409-8634431 ATCCACTGATGTGCCAATGGAGG - Intronic
1154361735 18:13668532-13668554 CTTATTAGATATGCAAATGGAGG - Intronic
1155469620 18:26177403-26177425 ATTCTTGGATGTAGAAATGGAGG - Intronic
1157405583 18:47419944-47419966 GTTTTCAGAAGTGGAAATGGAGG + Intergenic
1157714914 18:49877796-49877818 GATCTCAGATGTGGAGATGGAGG + Exonic
1158442105 18:57485221-57485243 AATGTCACATGTGCCAATGGTGG - Exonic
1158690925 18:59659837-59659859 ATTTACAGATGAGCAAACGGGGG - Intronic
1159313705 18:66742934-66742956 ATTTTAAAATGTGCAAATGTGGG - Intergenic
1159730924 18:72026578-72026600 ATTCCCAGAAGTGGAATTGGTGG + Intergenic
1161482090 19:4516401-4516423 TTTCACAGATGTGGAAATAGAGG + Intronic
1161778399 19:6276361-6276383 TTTCACAGATGTGGAAATGCAGG - Intronic
1163120170 19:15212618-15212640 CTTCTCAGATGGGCCAAGGGAGG - Intergenic
1163170760 19:15529543-15529565 TTTTTCAGATGAGGAAATGGAGG + Intronic
1163952396 19:20601896-20601918 ATTCACAAAAGTGCCAATGGTGG - Intronic
1163964004 19:20726499-20726521 ATTCACAGAAGTGCCAATTGTGG + Intronic
1164094943 19:21999861-21999883 ATTCTCATATGTGAAAATAAGGG - Intronic
1164114464 19:22204960-22204982 ATTCTCATATGTGAAAATAAGGG - Intergenic
1164198608 19:22996807-22996829 ATTCTCATATGTGAAAATAAGGG - Intronic
1164775726 19:30852135-30852157 CTTCTGGGATGTGCAAATGTGGG - Intergenic
1166670329 19:44705936-44705958 ATTCTCTGTTGGGCAAATGGTGG - Intronic
1166983378 19:46645173-46645195 GTTCTCAGGTGGGTAAATGGAGG - Intergenic
1168320316 19:55505320-55505342 ATTCTCAGAGAAGCAAAGGGTGG + Intronic
925391965 2:3501311-3501333 TTTTACAGATGTGGAAATGGTGG + Intronic
925582090 2:5421136-5421158 ATTCTCACAACTGCAAATGTTGG + Intergenic
926059223 2:9794707-9794729 CTTCTCAGAGCTGCCAATGGTGG + Intergenic
926286296 2:11491605-11491627 ATTATCAGATGATTAAATGGAGG - Intergenic
926691575 2:15738176-15738198 ATTTACAGATGTGGAAATTGTGG - Intronic
928366974 2:30710293-30710315 ATGCTCAGATGAGGAAATGGAGG - Intergenic
929455291 2:42060859-42060881 ATTTGCAGATGAGGAAATGGAGG - Intergenic
929882118 2:45846200-45846222 ATTCTCACCTGTGCAAATGATGG + Intronic
932615080 2:73226551-73226573 TTCCCCAGATGTCCAAATGGGGG - Exonic
933266263 2:80183266-80183288 GTTTACAGATGTGGAAATGGAGG + Intronic
934654697 2:96111076-96111098 GTTCTCAGATGAGGAACTGGGGG - Intergenic
934784299 2:96993626-96993648 ATTCTCAGGTGGCCAAAAGGAGG + Intronic
935169338 2:100598538-100598560 TTTCACAGATGAGAAAATGGAGG - Intergenic
936488400 2:112947156-112947178 CTTCTCAGATATGCACATGGTGG + Intergenic
937277898 2:120697424-120697446 ATTCTCAGAAGCGCAATTGCTGG - Intergenic
937343290 2:121105527-121105549 TTTCCCAGATGAGAAAATGGAGG + Intergenic
937391226 2:121488392-121488414 ATTTTCTCATGTGCAAATTGGGG - Intronic
938601044 2:132839461-132839483 AGTCAAAAATGTGCAAATGGTGG + Intronic
940035864 2:149311420-149311442 ATTCACAGATCTGAATATGGAGG + Intergenic
941465245 2:165817816-165817838 ATTTTCAGATGTGGAAACTGAGG - Intergenic
941488977 2:166119484-166119506 ATTCTCAAATGTTCAATTTGAGG + Intronic
941985081 2:171502511-171502533 ATTCCTAGATGTGGAATTGGTGG + Intergenic
942420702 2:175804560-175804582 AATCTGAGATTTGTAAATGGTGG - Intergenic
942940514 2:181609836-181609858 ATTCACTGATGTGATAATGGTGG + Intronic
943095060 2:183418321-183418343 ATTCTCAAAGGTTGAAATGGAGG + Intergenic
943637408 2:190321154-190321176 ATTTTCAGATGAGAAAATGGAGG - Intronic
946388884 2:219403810-219403832 ATTTACAGATGAGGAAATGGAGG + Intergenic
947866474 2:233401165-233401187 TTTCTCAGATGAGAAAATGGAGG - Intronic
947884073 2:233550103-233550125 ATGTTCAGATGTACATATGGTGG + Intronic
1169218502 20:3807045-3807067 TTTTTCAGATGGGAAAATGGAGG + Intergenic
1169591722 20:7150379-7150401 ATTCTCAGATGTTCCAACTGAGG - Intergenic
1169815878 20:9655681-9655703 ATTGTCAGATGTGGAAATAATGG + Intronic
1171315669 20:24191658-24191680 ATTCACAGATATGCACAGGGTGG + Intergenic
1172577507 20:36020621-36020643 ATCCTCAGATGTGGAAAATGAGG - Intronic
1173877494 20:46383777-46383799 ATTCTCATATGTATAAATGTTGG - Intronic
1174365640 20:50054699-50054721 GTTCACAGATGAGGAAATGGAGG + Intergenic
1174545859 20:51324607-51324629 ATTTCCAGATGGGGAAATGGAGG - Intergenic
1174796168 20:53524220-53524242 ACTCTCACATGTGCACAAGGAGG + Intergenic
1175351100 20:58318884-58318906 ATTCCCAAATGTGCAAATGTAGG - Intronic
1175679245 20:60973490-60973512 TTTCACAGATGGGGAAATGGAGG - Intergenic
1177919308 21:27130629-27130651 ATTCTCAGAAGTACAAATAAAGG - Intergenic
1178272804 21:31208385-31208407 ATTGTCAGATCTGCAGATGAAGG - Intronic
1178433081 21:32533869-32533891 TTTTACAGATGAGCAAATGGAGG - Intergenic
1180846689 22:18986767-18986789 ATTTACAGATGAGGAAATGGAGG - Intergenic
1181299039 22:21866774-21866796 ATCCTCAGCGGTGCTAATGGTGG - Intronic
1182011464 22:27004208-27004230 TTTCACAGATGAGGAAATGGAGG - Intergenic
1182014547 22:27028670-27028692 GTTTCCAGATGTGCAATTGGTGG + Intergenic
1182033690 22:27181102-27181124 TTTCACAGATGAGGAAATGGAGG + Intergenic
1182600769 22:31461906-31461928 TTTCATAGATGAGCAAATGGAGG - Intronic
1183110042 22:35642253-35642275 TTTTGCAGATGTGAAAATGGAGG + Intergenic
1183348784 22:37322878-37322900 CTTCTCAGAGGTGCCATTGGTGG + Intergenic
1183363494 22:37395164-37395186 TTTCTCAGATGAGAAAACGGAGG + Intronic
1183529572 22:38346003-38346025 GTTTGCAGATGTGGAAATGGAGG + Intronic
1183712141 22:39511280-39511302 ATTCTCAGATGAGCAATGGCAGG + Exonic
1184558805 22:45249050-45249072 ATTCTGAGATGACCAAATGGAGG - Intergenic
1184959024 22:47915389-47915411 ATTCTCAGATTAGAAAACGGAGG + Intergenic
1185239260 22:49733859-49733881 ATCATCAGATGATCAAATGGTGG - Intergenic
949588551 3:5468163-5468185 TTTCTCAGATGAGGAAATGGAGG - Intergenic
950117944 3:10463532-10463554 TTTCACAGATGAGCAAATGGAGG + Intronic
950186516 3:10948855-10948877 ATTTGCAGATGAGCAAAGGGAGG - Intergenic
951735977 3:25864697-25864719 ATTCTTAGAAGTGCAAATGTTGG + Intronic
952153983 3:30623191-30623213 TTTTACAGATGTGGAAATGGAGG + Exonic
952649199 3:35703725-35703747 ATTCTCAAAACTGCAAAAGGTGG - Intronic
953221244 3:40973746-40973768 ATTCTCACCTGAGCAACTGGTGG - Intergenic
953387857 3:42516822-42516844 TTTCACAGATGAGGAAATGGAGG - Intronic
953432940 3:42854547-42854569 AGCCTCAGATTAGCAAATGGGGG - Intronic
953666421 3:44929265-44929287 ATCCCCAGGTGTGGAAATGGTGG + Intronic
954331726 3:49894698-49894720 TTTTACAGATGAGCAAATGGAGG + Intronic
954688641 3:52384173-52384195 ATTTACAGATGAGGAAATGGAGG - Intronic
955349142 3:58181111-58181133 TTTTTCAGATGTGAAAATTGAGG - Intergenic
955517191 3:59737875-59737897 GTTTTCAGATGTGAAAATTGAGG - Intergenic
955571263 3:60309331-60309353 AGTGTCAGAAGTGGAAATGGGGG - Intronic
955779183 3:62465025-62465047 ATTTACAGATGAGGAAATGGTGG + Intronic
955839217 3:63094342-63094364 TTTCCCAGGTGTGCAAATTGTGG + Intergenic
955942074 3:64156109-64156131 ATTTTCAGATGTGGAAACTGAGG + Intronic
956729770 3:72185949-72185971 ATTCTGAGATGTGGCATTGGAGG + Intergenic
959134221 3:102396819-102396841 ATTGCCAGATGTGGAAATTGAGG - Intronic
959356922 3:105343667-105343689 ATTTTCACATGAACAAATGGAGG - Intergenic
959393318 3:105804109-105804131 AATCTCAAATGCCCAAATGGTGG + Intronic
959528124 3:107400148-107400170 ATTTTCAGATGAGAAAATTGAGG - Intergenic
960667681 3:120126125-120126147 AGGCTCAGATGTGCACATGTTGG + Intergenic
961100766 3:124196915-124196937 ATTTACAGATGAGGAAATGGAGG + Intronic
961638917 3:128352598-128352620 CTTCTCAGATCTGCAGGTGGCGG + Intronic
962109563 3:132429936-132429958 ATTATCAGGTGTGCAAATATTGG + Intronic
962499605 3:135976941-135976963 ATTCTCATATGTGCATAAGTTGG + Intronic
962507899 3:136066810-136066832 ATCCTCAGTGTTGCAAATGGGGG - Intronic
963241968 3:143013931-143013953 ATCCTCAAATAAGCAAATGGAGG - Intronic
963378428 3:144498817-144498839 CTTCTCAGATACGCAAATGATGG + Intergenic
963611857 3:147478750-147478772 ATTCTCAGATGAGGAAATTGAGG - Intronic
964101932 3:152997304-152997326 ACTCTCACATGTGTAAATGTTGG + Intergenic
965117491 3:164511135-164511157 ATTTTCAGAAGTGGAAATGATGG - Intergenic
965342669 3:167509725-167509747 ATTCTAATATGTGCACATGAAGG + Intronic
966636462 3:182139735-182139757 ATAATCAGATGTTCAAATTGTGG + Intergenic
966956765 3:184888643-184888665 ATTTTCAGATGAGGAAGTGGAGG + Intronic
967165453 3:186775785-186775807 ATACTCAGAAGTGGAATTGGTGG + Intergenic
967258396 3:187617230-187617252 TTTCACAGATGGGGAAATGGAGG - Intergenic
967824963 3:193870327-193870349 TTTCACAGATGGGGAAATGGAGG + Intergenic
968184962 3:196626219-196626241 TTTTACAGATGTGGAAATGGAGG + Intergenic
968391625 4:197577-197599 GAGCTCAGATGTGCAAATGTAGG - Intergenic
968403477 4:318273-318295 GAGCTCAGATGTGCAAATGTAGG + Intergenic
969489088 4:7488641-7488663 ATTGACAGATGTGGAAATGGGGG + Intronic
969652551 4:8476357-8476379 CTTCACAGATGTGGACATGGTGG - Exonic
969859706 4:10026046-10026068 TTTCTCAGATGTGCAAGTCAGGG + Intronic
970169731 4:13277731-13277753 GTTCACAGATGTGGATATGGAGG + Intergenic
970500197 4:16669168-16669190 ATTCTTAGATGTGGAACTGAAGG + Intronic
970613906 4:17750104-17750126 ATTCTCAGAAGTGAAATTTGAGG + Intronic
971253562 4:24993332-24993354 TTTTACAGATGTGGAAATGGAGG - Intergenic
974344985 4:60668135-60668157 ACTCTCAGATTTGAAAAAGGAGG + Intergenic
975169539 4:71216970-71216992 TTTTTCAGATGAGAAAATGGAGG + Intronic
975884662 4:78950635-78950657 ATTCTGGGCTCTGCAAATGGTGG - Intergenic
976232503 4:82859047-82859069 ATTCTTAGATGTGTAAAAGTAGG - Intronic
976450408 4:85183267-85183289 ATTCTCAGATGTGGAACTACAGG + Intergenic
976855602 4:89601601-89601623 ATTCTCAGATGTGCAACCCATGG - Intergenic
977265435 4:94848312-94848334 ATTTACAGAACTGCAAATGGGGG + Intronic
977447534 4:97149754-97149776 ATTCTCAGTTGTGCTAGAGGGGG - Intergenic
978128433 4:105163430-105163452 ATTTACAGATGAGAAAATGGAGG + Intronic
978380031 4:108117421-108117443 CTTTTGGGATGTGCAAATGGTGG - Intronic
978564485 4:110067269-110067291 ATTTTCAGATTTTCTAATGGAGG - Intronic
978672537 4:111267718-111267740 CTTCACAGATGAGCAAATAGAGG - Intergenic
979469366 4:121075717-121075739 ATTCTTAAATATGCAATTGGAGG + Intergenic
979909052 4:126336874-126336896 ATACCCAGAAGTGGAAATGGTGG - Intergenic
980428365 4:132657056-132657078 TTTCCCAGATGAGCAAATGCTGG - Intergenic
981089747 4:140720505-140720527 TTTCACAGATGAGGAAATGGAGG + Intronic
981509085 4:145535316-145535338 ATTCCTAGATGTGGAAATGCTGG - Intronic
981858898 4:149330521-149330543 ATACTCAGAAGTGGAATTGGTGG + Intergenic
982145448 4:152384161-152384183 ATACTCAGAAGTGGAAATGCTGG - Intronic
982856424 4:160387182-160387204 ATTGTCAGATATGCAAAAGAAGG + Intergenic
983662428 4:170143292-170143314 ATTCTTAGATGTGTAAATTCTGG + Intergenic
984296216 4:177857926-177857948 ATTTGCAGATGTGGAACTGGAGG + Intronic
984929664 4:184835471-184835493 ATTTTCAGATGTAGAAATTGAGG - Intergenic
986821895 5:11476421-11476443 ATTTTTAGATGAGGAAATGGAGG + Intronic
987140413 5:14940168-14940190 ATTTTTAGATGTGCAAAAGACGG + Intergenic
987456926 5:18158608-18158630 ATGCTAAAATGTGAAAATGGAGG + Intergenic
989306774 5:39966990-39967012 AATCTCAAATGTGCAGATGTTGG + Intergenic
989752934 5:44917507-44917529 ATGCTCAGAAGTGCAATTGTTGG + Intergenic
991217110 5:64167831-64167853 TTTTTCAGATGGCCAAATGGAGG - Intronic
992663141 5:78981642-78981664 TTTCACAGATGTGGAAATGATGG + Intronic
993322557 5:86490523-86490545 ATTCTCAAGTGTTCACATGGTGG - Intergenic
993878368 5:93335786-93335808 ATTCTTAAAAGTGCAAGTGGGGG - Intergenic
994141174 5:96342760-96342782 TTTCAGAGATGTGCAAATGTGGG - Intergenic
994468332 5:100168552-100168574 ATTTTTACATGTGCAAATTGTGG - Intergenic
994947186 5:106410117-106410139 ATTCTTAAAGGTGCAAATAGGGG - Intergenic
995470274 5:112494502-112494524 AATCTCAGATGTCCAAGTAGTGG - Intergenic
995903648 5:117097756-117097778 ATTCTTAGATATGCAAATATTGG + Intergenic
996673505 5:126148307-126148329 ATTGTGAAATGTCCAAATGGGGG + Intergenic
997255419 5:132424555-132424577 ATTCTCAGATGAGGAAACTGTGG - Intronic
998556949 5:143134782-143134804 TTTTACAGATGAGCAAATGGAGG - Intronic
999074867 5:148785037-148785059 ATTCACAGAAGTGCAATTGCTGG - Intergenic
999229164 5:150051551-150051573 GTTCTCACATGAGGAAATGGAGG + Intronic
999300864 5:150489533-150489555 ATTTTCAGATGAGGAAATAGAGG + Intronic
1001194144 5:169656259-169656281 ATTTGCAGATGAGGAAATGGAGG + Intronic
1001689318 5:173620976-173620998 CTTTACAGATGAGCAAATGGAGG - Intergenic
1001712276 5:173788603-173788625 ATTCTCCACTGTGCACATGGAGG + Intergenic
1001832561 5:174801799-174801821 TTTCACAGATGAGGAAATGGAGG + Intergenic
1001949229 5:175804498-175804520 ATTCACAGATGGGGAAATTGAGG - Intronic
1001962356 5:175887224-175887246 ATGATCAGATGTGCAGATTGAGG + Intergenic
1002096845 5:176836408-176836430 TTTCACAGATGTGCAAATTGAGG - Intronic
1002416957 5:179125752-179125774 ATGCCCAGATGGGGAAATGGGGG - Intronic
1002777052 6:337273-337295 ATTTTCAGATGGGAGAATGGAGG - Intronic
1003381198 6:5625883-5625905 AATCTCAGATGCGCAGGTGGTGG + Intronic
1003417445 6:5924506-5924528 ATGCTCAGATGTGCAATTACTGG - Intergenic
1003472264 6:6448238-6448260 ATTCTAAGATGAGCAACTGGTGG + Intergenic
1004165457 6:13252900-13252922 AATCTCAGATGCTCAAGTGGAGG - Intronic
1004462306 6:15849014-15849036 TTTTTCAGATGAGGAAATGGAGG + Intergenic
1005622976 6:27637038-27637060 ATCCTAAGAGGTGAAAATGGGGG - Intergenic
1005913379 6:30329875-30329897 ATTCTCAGAGCTGCATATGCAGG + Intronic
1006444813 6:34074268-34074290 TTTCACAGATGGGGAAATGGAGG - Intronic
1006450754 6:34104489-34104511 TTTTTCAGATGAGGAAATGGAGG + Intronic
1007248561 6:40480161-40480183 TTTCTCAGATGAGGAAATGGAGG + Intronic
1007811466 6:44489166-44489188 TTTCACAGATGAGCAAATTGAGG + Intergenic
1008223600 6:48883726-48883748 ATTCTCACATGTGTGAATGTTGG - Intergenic
1009813191 6:68695934-68695956 AATCCTAGATATGCAAATGGGGG - Intronic
1010128268 6:72460774-72460796 ATTTTCAGATAAGGAAATGGAGG + Intergenic
1010331477 6:74628024-74628046 ATTCTCCAATGTTCAAATGAAGG + Intergenic
1010564543 6:77393559-77393581 ATTTGCAGATGTGCACAGGGTGG - Intergenic
1010745217 6:79552802-79552824 GTTCTCAGATGTCAAAATAGGGG + Intergenic
1011366467 6:86587613-86587635 TTTCTCAGAGGTGCACCTGGAGG + Intergenic
1011423524 6:87201085-87201107 ATACTCAGAAGTAAAAATGGTGG + Intronic
1011515848 6:88151913-88151935 TTTCACAGATGAGGAAATGGAGG + Intronic
1011771355 6:90676837-90676859 ATTCTCAGGGATGCAAATGGTGG + Intergenic
1012562845 6:100606635-100606657 ATTCTCAGAAGTTTAATTGGTGG + Intronic
1012812662 6:103980862-103980884 CTTTACAGATGAGCAAATGGAGG - Intergenic
1012960111 6:105613664-105613686 ATTCTGAGGTGGGAAAATGGAGG + Intergenic
1013096651 6:106951611-106951633 ATACTCAGATGTGGAATTGCTGG - Intergenic
1014867350 6:126548703-126548725 ACTATCAGATGTGAAAATGCTGG - Intergenic
1016216791 6:141613819-141613841 ATTCTCACATTTCAAAATGGGGG + Intergenic
1016254434 6:142087495-142087517 TTTTTCAGATGTGCATATTGAGG - Intronic
1017020337 6:150134933-150134955 ATTCTCAGATCTGCAAAAGTTGG - Intergenic
1018924732 6:168198280-168198302 TTTTTCAGATGGGGAAATGGAGG + Intergenic
1020224120 7:6266332-6266354 ATTTTCAGATTGGAAAATGGAGG - Intronic
1020399728 7:7761792-7761814 ATTCTCAGATGTCACAAGGGGGG - Intronic
1020466844 7:8489600-8489622 ATTTTCAGATGGGCCAATGTTGG - Intronic
1021227513 7:18045652-18045674 CTTCTCAAATGTGAACATGGAGG + Intergenic
1021508811 7:21413370-21413392 TTTCACAGATGTGAAAATAGAGG - Intergenic
1024340359 7:48251419-48251441 ATTTTCAGATGAGAAAATTGAGG + Intronic
1026484197 7:70803933-70803955 ATTTTAAGATGGGCAAAAGGGGG + Intergenic
1028138599 7:87247463-87247485 ATTCCCAGAAGTGCAAAGGAAGG - Intergenic
1028213658 7:88105988-88106010 ATTGACAGATGAGAAAATGGAGG + Intronic
1028416700 7:90588109-90588131 TTTCTCAGATGTGGAGGTGGTGG + Intronic
1030170590 7:106598977-106598999 ATGCAAAGCTGTGCAAATGGCGG - Intergenic
1030429978 7:109432935-109432957 ATTCTCAGACAAGCAAATGATGG + Intergenic
1030601664 7:111600079-111600101 AGGCTAAGATGTGCAAATAGAGG + Intergenic
1030672718 7:112354674-112354696 ATTCTTAGTTGTGCAATTGCTGG + Intergenic
1031152119 7:118066221-118066243 ATTTTCAAATGAGGAAATGGAGG + Intergenic
1031593912 7:123625929-123625951 ATTCACAGATGTGGAGATGGAGG + Intronic
1031824968 7:126552926-126552948 TTTCTCAGATGGGGAAATTGAGG - Intronic
1032393013 7:131568746-131568768 ATTCTGATTTGTGCAGATGGAGG - Intergenic
1032441086 7:131943612-131943634 ATTCTCAGAGCTGCAGGTGGAGG + Intergenic
1033124802 7:138698235-138698257 ATTCCCAGATGAGGAAATGCAGG - Intronic
1034989032 7:155535996-155536018 TTTCTGAGATTTGCAACTGGAGG + Intergenic
1036090051 8:5655939-5655961 AGTCTCAGCTGTGCTATTGGGGG + Intergenic
1036275033 8:7343352-7343374 TTTCTCAGCAGTGAAAATGGTGG + Intergenic
1036346321 8:7966996-7967018 TTTCTCAGCAGTGAAAATGGTGG - Intergenic
1036841643 8:12127754-12127776 TTTCTCAGCAGTGAAAATGGTGG - Intergenic
1037329604 8:17731337-17731359 TTTCTCATATGTGAGAATGGGGG + Intronic
1037447065 8:18975992-18976014 TTTCTTAGAAGTGTAAATGGTGG - Intronic
1038570007 8:28653192-28653214 ATTTTAAAATGTGCAAAGGGAGG - Intronic
1038675777 8:29621706-29621728 ATTCCCAGAAGTGGAAATGCTGG + Intergenic
1039759426 8:40558498-40558520 ATGGACAGATGTGGAAATGGAGG + Intronic
1039789110 8:40860093-40860115 ATTTTCAGATGTGGAAACTGAGG - Intronic
1041101935 8:54404861-54404883 ATTCTCAGAAGTGGAATTGCTGG - Intergenic
1041350686 8:56945321-56945343 ATTCTCAGATGAGGGAATGTAGG - Intergenic
1042173864 8:66019873-66019895 ATTCACAGATGTGGAATTGTTGG + Intergenic
1042334479 8:67615679-67615701 ATTCTCTGAATTGCATATGGTGG - Intronic
1044629823 8:94267458-94267480 ATTTGCAGATGAGAAAATGGAGG - Intergenic
1045712845 8:105005755-105005777 TTTCTCAGAAGTGCAAACTGAGG - Intronic
1046678645 8:117141947-117141969 ATTTTCAGATGGGGAAATTGAGG + Intronic
1047103717 8:121709631-121709653 TTTCTCAAATATTCAAATGGAGG - Intergenic
1047952828 8:129949373-129949395 GTTTTCAGATGAGAAAATGGAGG + Intronic
1048256824 8:132911211-132911233 TTCCTCAGATGTGGAAAAGGGGG + Intronic
1048296343 8:133217428-133217450 AATCTCAGATCTGCAAGTGCAGG - Intronic
1048604368 8:135952232-135952254 TTTTTCAGATGGGAAAATGGGGG + Intergenic
1049792541 8:144478578-144478600 ATTTTCAGATGAGGAAATCGAGG + Intronic
1051856448 9:21572722-21572744 ATTTTCAGATGAGGAAATTGAGG + Intergenic
1052187232 9:25613326-25613348 TTTCTTACATGTGCATATGGGGG + Intergenic
1052244407 9:26316808-26316830 TTGCTCAGTGGTGCAAATGGTGG - Intergenic
1053180735 9:35966828-35966850 ATTCTCAAATGACCAAATTGTGG - Intergenic
1054769095 9:69067868-69067890 ATTCACAGATGTGAATATGCAGG + Intronic
1055709700 9:79047032-79047054 GTTGTCAGAGTTGCAAATGGTGG + Intergenic
1055806363 9:80098266-80098288 ATTTTCAGAGGCGCAGATGGTGG - Intergenic
1056048236 9:82741295-82741317 ATTCTGAGATGTGGAAATTAGGG - Intergenic
1056514514 9:87337366-87337388 ACTCGCAATTGTGCAAATGGGGG + Intergenic
1056622417 9:88225295-88225317 ATTCACAGAGGTGAACATGGGGG - Intergenic
1057294269 9:93826418-93826440 CTTCACAGATGAGCAAACGGAGG + Intergenic
1057705661 9:97393233-97393255 CTTCTCAGAGGAGCAAATTGAGG + Intergenic
1059434869 9:114270082-114270104 CTTCTCAGATGAGGAAAGGGAGG - Intronic
1059629480 9:116105306-116105328 CTTCTGAGATGTGCCAAGGGTGG + Intergenic
1060017357 9:120098279-120098301 ATTCAGAGAGCTGCAAATGGTGG - Intergenic
1060187743 9:121574310-121574332 TTTCACAGATGGGGAAATGGAGG - Intronic
1060289350 9:122286139-122286161 ATTAGCAGATGAGGAAATGGAGG - Intronic
1061053296 9:128208523-128208545 TTTCTCAGATTTGGAGATGGAGG + Intronic
1061505913 9:131031789-131031811 ATTCACAGATGGGAAAATGGAGG + Intronic
1061596009 9:131629459-131629481 ATTTTCAGATGAGGAAATTGAGG - Intronic
1061839859 9:133352329-133352351 GTTCTCACATGTGTATATGGCGG - Intronic
1187679501 X:21752883-21752905 TTTTACAGATGTGGAAATGGAGG + Intronic
1189870573 X:45378704-45378726 ATTCTCAGAAGTGGAATTGCTGG - Intergenic
1190534310 X:51410170-51410192 TTTCACAGATGTGGAAATTGAGG + Intergenic
1191210754 X:57882612-57882634 ATTCCCCTATGTTCAAATGGAGG + Intergenic
1192192169 X:68997627-68997649 ATTCCCAGAAGTGCAATTGCTGG - Intergenic
1194363210 X:92980662-92980684 ATTCTGAGATGTGACAAGGGTGG + Intergenic
1194644797 X:96446648-96446670 ATTGCCAGAAGTGCAAATTGAGG + Intergenic
1196118204 X:112019748-112019770 TTTTTCAGATGAGGAAATGGAGG + Intronic
1196586805 X:117439544-117439566 CTTTTCTGAAGTGCAAATGGAGG - Intergenic
1198439501 X:136648652-136648674 TTTCTCAGATGTGGAAACTGAGG - Intronic
1198904435 X:141545440-141545462 ATTCACACATGAGGAAATGGAGG - Intergenic
1199208124 X:145173553-145173575 ATTTTGAGATGAGAAAATGGAGG - Intergenic
1199693892 X:150329837-150329859 TTTCACAGATGAGCAAATGGAGG - Intergenic
1199741428 X:150739799-150739821 ATTCACAGATGGGGAAATTGAGG + Intronic
1200144174 X:153917790-153917812 ATTTTCAGATGTGCAAAGTCAGG + Intronic
1200671450 Y:6096905-6096927 ATTCTGAGATGTGACAAGGGTGG + Intergenic
1202188263 Y:22212532-22212554 AGTCTGAGATCTGCAAAAGGAGG + Intergenic