ID: 1152532550

View in Genome Browser
Species Human (GRCh38)
Location 17:80927845-80927867
Sequence GGAATTCTCAGATGTGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 240}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152532550_1152532552 -9 Left 1152532550 17:80927845-80927867 CCATTTGCACATCTGAGAATTCC 0: 1
1: 0
2: 1
3: 16
4: 240
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532550_1152532553 -3 Left 1152532550 17:80927845-80927867 CCATTTGCACATCTGAGAATTCC 0: 1
1: 0
2: 1
3: 16
4: 240
Right 1152532553 17:80927865-80927887 TCCCGCCCGCACGGAGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 358
1152532550_1152532561 20 Left 1152532550 17:80927845-80927867 CCATTTGCACATCTGAGAATTCC 0: 1
1: 0
2: 1
3: 16
4: 240
Right 1152532561 17:80927888-80927910 AGGGTGTCAGCCTTGTGGTCTGG 0: 1
1: 0
2: 0
3: 23
4: 483
1152532550_1152532557 1 Left 1152532550 17:80927845-80927867 CCATTTGCACATCTGAGAATTCC 0: 1
1: 0
2: 1
3: 16
4: 240
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1152532550_1152532560 15 Left 1152532550 17:80927845-80927867 CCATTTGCACATCTGAGAATTCC 0: 1
1: 0
2: 1
3: 16
4: 240
Right 1152532560 17:80927883-80927905 GCTGGAGGGTGTCAGCCTTGTGG 0: 1
1: 0
2: 0
3: 22
4: 260
1152532550_1152532556 0 Left 1152532550 17:80927845-80927867 CCATTTGCACATCTGAGAATTCC 0: 1
1: 0
2: 1
3: 16
4: 240
Right 1152532556 17:80927868-80927890 CGCCCGCACGGAGGAGCTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152532550 Original CRISPR GGAATTCTCAGATGTGCAAA TGG (reversed) Intronic
900606472 1:3525800-3525822 GGAAAGCACAGATGTGCAGATGG + Intronic
904047269 1:27616134-27616156 GGGATTCTCACAGGTGGAAATGG + Intronic
907911317 1:58829132-58829154 GAAAATCTCAGGTGTGCATATGG + Intergenic
908377275 1:63556417-63556439 GAAAATCCCAGATCTGCAAATGG - Intronic
908974095 1:69877006-69877028 GGAATTTTAAAATGGGCAAAAGG + Intronic
910345760 1:86235273-86235295 GGAATTCTTAGATTTGCACTTGG - Intergenic
912142156 1:106743510-106743532 GGAATCCTCAGATAAGCAAAAGG - Intergenic
918298785 1:183183494-183183516 AGAATTCTCAGATTGGTAAAAGG + Intergenic
919124551 1:193379236-193379258 GGAATGGCCAGATGTGCAAGTGG - Intergenic
919373430 1:196761895-196761917 GACATTCTCAGATAAGCAAAAGG - Intergenic
920547663 1:206832011-206832033 GCTATTCTCACATGTGCAGAGGG + Intronic
920728803 1:208463185-208463207 GCAATTCTGAGATGTGCTCAGGG - Intergenic
921813668 1:219543052-219543074 GGAATTCTAAGATGTGCCCAAGG + Intergenic
923729212 1:236534185-236534207 GGGATTTTCAGATATGGAAAGGG + Intronic
923751250 1:236748107-236748129 GGAAATCAGAGATGTGCAAAGGG + Intronic
924245156 1:242076543-242076565 GCCATTTTCTGATGTGCAAATGG - Intergenic
924397460 1:243637981-243638003 GAAATTATCAGTTGTGTAAAAGG + Intronic
924787697 1:247214489-247214511 GGAATTATCACAGGTGGAAAAGG - Intergenic
1064835714 10:19527865-19527887 GAAATTCTCAAGTGTGTAAAAGG + Intronic
1066307928 10:34165181-34165203 CATATTCTCAGAGGTGCAAAGGG - Intronic
1067198562 10:44145527-44145549 GAAGTTCTCTGATGTGAAAAGGG - Intergenic
1069626829 10:69873326-69873348 GGAATGTTCAGACTTGCAAATGG + Intronic
1070214689 10:74364604-74364626 GGAATTGCCAGCTGTGGAAAAGG - Intronic
1070725243 10:78783231-78783253 TGCATTCTCACATGTGGAAAGGG - Intergenic
1070837754 10:79461114-79461136 GGTTTTCTCCGATATGCAAATGG - Intergenic
1073149219 10:101300378-101300400 GGCATTGTCAGATGTGAAGATGG + Intergenic
1074873179 10:117594022-117594044 TGATTTTTCAGATGAGCAAATGG + Intergenic
1075994677 10:126867763-126867785 GGAATTCTTAGCATTGCAAAGGG + Intergenic
1076327271 10:129635254-129635276 GGAATCCTGAGATCTGCAACAGG - Intronic
1077747870 11:4927772-4927794 GGAATTCTCAGACTTGGGAAAGG - Intronic
1078489942 11:11759400-11759422 GGAATTGACAGATTTGCAGAGGG - Intergenic
1078620024 11:12898796-12898818 AGACTTCTCATATGTGCAATGGG - Intronic
1079552674 11:21719647-21719669 GCAATTCACAGATGAGCAAATGG - Intergenic
1079656354 11:22990702-22990724 GGAATCCTCATTTGTGCAAGGGG - Intergenic
1080187902 11:29512684-29512706 TGATTTCTCAGCTGTGTAAATGG - Intergenic
1081014683 11:37861221-37861243 TGAATTCTCACATGAGAAAAAGG + Intergenic
1081522790 11:43899077-43899099 GGAATTTTGACATGTACAAAGGG + Intronic
1081725419 11:45324096-45324118 GGAAATCTGAGAGGTGCAAAGGG + Intergenic
1081818216 11:45965468-45965490 GGAATTCTGGGATGTGGGAAGGG + Exonic
1085991709 11:81855571-81855593 TTGAATCTCAGATGTGCAAAGGG - Intergenic
1086583684 11:88427807-88427829 GACATTGTCAGATGTGCATAAGG + Intergenic
1086787854 11:90994294-90994316 AGGATTCACAGATGTGGAAATGG - Intergenic
1091427266 12:401836-401858 GGAAAGCTCCAATGTGCAAAGGG + Intronic
1094802481 12:34052821-34052843 ACAATTCTCAGATATACAAATGG + Intergenic
1095271036 12:40219817-40219839 GAAATTCTCAAATGTACATAAGG - Intronic
1101144946 12:101831766-101831788 GGAATTAACAGACTTGCAAAAGG + Intergenic
1104575130 12:129959605-129959627 GGAATTCTCTGATGTGCTTTTGG + Intergenic
1105636665 13:22222341-22222363 AGAATTCTCAAATCTGCAGATGG + Intergenic
1105958225 13:25304047-25304069 GGAGTTCTCACATCTGGAAAAGG + Intronic
1106627251 13:31433495-31433517 GGAGTTTTCAGAAGTCCAAAGGG + Intergenic
1107527153 13:41244406-41244428 GGTATTTTCAGATGTGCACATGG + Intronic
1110011042 13:70333804-70333826 TGAATTCTCTGATGTGACAATGG + Intergenic
1110287998 13:73772503-73772525 ACATTTCTCAGATGTGGAAAAGG + Intronic
1110547511 13:76772473-76772495 GGAATTCCCAGCTGTGCAAGGGG - Intergenic
1111043690 13:82786130-82786152 AGAAATCTCAAATGTGAAAAAGG + Intergenic
1112169973 13:96961333-96961355 GGAATTCTCAGTTACACAAAAGG + Intergenic
1113226611 13:108166936-108166958 GGAAATCTGAGATCTGGAAAAGG - Intergenic
1114845562 14:26316337-26316359 AATATTCTCAGCTGTGCAAAAGG + Intergenic
1115190808 14:30745404-30745426 GGAATTCTGAGCAGTGGAAAGGG - Intergenic
1117527243 14:56621135-56621157 GGAACTTTCAGAAATGCAAAAGG - Intronic
1118316535 14:64729421-64729443 GAAATTAACAGATGTGCAAATGG - Intronic
1119933541 14:78569990-78570012 GAAATTTTCACATGTGGAAATGG - Intronic
1120428922 14:84389164-84389186 AGAATTCTCTGATGTTGAAATGG - Intergenic
1120812472 14:88818333-88818355 TGAATTCTCAGAAGTGAACATGG + Intergenic
1121810768 14:96887533-96887555 ATAATTCTCAGATGTGAGAAAGG + Intronic
1123474217 15:20577600-20577622 GAAATTATTAAATGTGCAAAAGG - Intergenic
1123643794 15:22422753-22422775 GAAATTATTAAATGTGCAAAAGG + Intergenic
1123697170 15:22887202-22887224 TGAATTATCAGATGTGTAGAGGG + Intronic
1123734518 15:23172612-23172634 GAAATTATTAAATGTGCAAAAGG - Intergenic
1124285025 15:28393920-28393942 GAAATTATTAAATGTGCAAAAGG - Intergenic
1124297672 15:28517694-28517716 GAAATTATTAAATGTGCAAAAGG + Intergenic
1126121298 15:45253895-45253917 GGAATACTCAGATTTGGGAATGG + Intronic
1126180452 15:45780343-45780365 TGAATTCTCAGATGAGAACATGG - Intergenic
1126422577 15:48490308-48490330 AGAATTATCAGATGTTGAAAGGG - Intronic
1126621928 15:50648806-50648828 GAAATACTCAGATGTGAAATTGG - Exonic
1129849919 15:78787941-78787963 AGAATTCACACATGTGCAGAAGG - Intronic
1130252341 15:82307726-82307748 AGAATTCACACATGTGCAGAAGG + Intergenic
1130288498 15:82575176-82575198 GGATTACACAGATGTGCAGATGG - Intronic
1131649978 15:94387881-94387903 GGATTTCTCAGATATCCACATGG - Intronic
1135506943 16:23046994-23047016 GGTATTATCAGAGATGCAAAAGG - Intergenic
1136031188 16:27504282-27504304 GGAATGCACAGAGGTGCAAAGGG + Intronic
1138498233 16:57421829-57421851 GAAATACTCAGACGAGCAAAGGG + Intergenic
1139025935 16:62817906-62817928 GAAGTTCTCTGATGTGAAAAGGG - Intergenic
1139936603 16:70576230-70576252 GGAAGTTTCAGATTTGGAAAAGG + Exonic
1141451347 16:84105589-84105611 GGAAGACACAGATGTGCACAAGG + Intronic
1142683578 17:1563826-1563848 GAGATTCTCAGATCTGCAGAGGG + Intergenic
1143071434 17:4297817-4297839 AGAAGAATCAGATGTGCAAATGG - Intronic
1144512956 17:15893222-15893244 GGAAGTCTCAGATATAAAAAAGG - Intergenic
1144793098 17:17872724-17872746 GAAAATCTCTGATGAGCAAAAGG + Intronic
1147918698 17:43903342-43903364 GGAAATCTCAGGTCTTCAAAAGG + Intronic
1149238946 17:54625956-54625978 GGAATTTTTAGATGTGCTTATGG - Intergenic
1150226469 17:63527247-63527269 GGCATTCACAGATGTGCATATGG - Intronic
1151527571 17:74681413-74681435 GCACTTCTCAGAAGTGCAACAGG - Intronic
1152532550 17:80927845-80927867 GGAATTCTCAGATGTGCAAATGG - Intronic
1154075629 18:11198231-11198253 GGAGTACTCAGATGTCCACATGG - Intergenic
1155157918 18:23173035-23173057 GGAAGTCTCAGAGCTCCAAACGG + Intronic
1156233715 18:35180560-35180582 GTAAGTCTCAGATGGGGAAAGGG - Intergenic
1158925601 18:62255275-62255297 GGGATTCCCAGAAGTGGAAAAGG + Intronic
1161630953 19:5355149-5355171 GGAATGCACAGCTATGCAAAAGG - Intergenic
1168320315 19:55505317-55505339 TGAATTCTCAGAGAAGCAAAGGG + Intronic
925699243 2:6616953-6616975 GGATTTCACAGCTGTGAAAATGG - Intergenic
926675275 2:15613516-15613538 GAAATTCTCAAATGTTCAGAGGG - Intronic
926930447 2:18033414-18033436 TTAATACTCAGATGTGAAAATGG - Intronic
927827782 2:26321379-26321401 GGCAGTCTCAGATGGGCCAAGGG + Intronic
928034671 2:27810954-27810976 TGAATTCTCAGAAGTGGCAAAGG + Intronic
928366975 2:30710296-30710318 AGAATGCTCAGATGAGGAAATGG - Intergenic
930370629 2:50496701-50496723 AGAAATCTGAGATGTGCATACGG + Intronic
931920257 2:67007659-67007681 GGAATTCACAGATGAACAATAGG - Intergenic
932126030 2:69146284-69146306 GGAGTTCTCAGATGAGCAACTGG - Intronic
934784298 2:96993623-96993645 GGAATTCTCAGGTGGCCAAAAGG + Intronic
934888209 2:98043117-98043139 GGAATTCCCATGTGGGCAAATGG - Intergenic
936747841 2:115601429-115601451 GGCATTATCTGATGTGAAAAAGG - Intronic
938982997 2:136544413-136544435 GGGACTCTCAGGTGTGCAAGAGG + Intergenic
940347382 2:152641836-152641858 GGGATTCTTAGATGTGATAATGG - Intronic
941424391 2:165323567-165323589 CAAATTCTTAGATGTGGAAATGG - Intronic
942419698 2:175795314-175795336 TGAATTCTAGCATGTGCAAAGGG - Intergenic
947921464 2:233878645-233878667 GGAATTTACAGATCAGCAAAGGG - Intergenic
1169333635 20:4736949-4736971 GGAAACATCAGAGGTGCAAAAGG + Intronic
1169684087 20:8251120-8251142 GCACTTGTCAGAAGTGCAAAGGG + Intronic
1169774299 20:9235637-9235659 AGAATTCTCAGATGTAGAAGTGG + Intronic
1169950254 20:11035582-11035604 GAAATTCTCAGACCTGCCAAGGG - Intergenic
1170435361 20:16321687-16321709 GTAAGGCTCAGATGTGCAGAAGG + Intronic
1171087274 20:22249171-22249193 GAAACTCTCAGATGGGGAAAAGG + Intergenic
1172705940 20:36881918-36881940 CAAATTCTCAGATGTGAACATGG + Intronic
1173549489 20:43922808-43922830 GGGTTTCTCAGATGTTCAACAGG + Intronic
1174214107 20:48903121-48903143 GGAATTCTGAGATGTGTAAAAGG + Intergenic
1178382878 21:32125889-32125911 GGAATCCTAAGATGAGTAAAGGG + Intergenic
1179325403 21:40338185-40338207 TAAACTTTCAGATGTGCAAAAGG - Exonic
1179535377 21:42048152-42048174 TAAATTCTCAGATGCGCAATGGG - Intergenic
1182394112 22:30022896-30022918 TAAATTCTGAAATGTGCAAATGG + Intronic
1183039988 22:35170794-35170816 GGACTTCTCAGATGTGATTAAGG + Intergenic
1185052528 22:48561337-48561359 GGAATTCACAAACCTGCAAAGGG - Intronic
1185207714 22:49549585-49549607 GGAGTTCTGAGATTTGAAAAAGG - Intronic
949430810 3:3973523-3973545 GGAATTGCCAGAAGGGCAAATGG + Intronic
952833046 3:37581315-37581337 TGAAGTCTTAGATGTGAAAAAGG + Intronic
953184549 3:40625943-40625965 GGAGTTCTCAGAAGAGGAAAAGG + Intergenic
954520482 3:51221180-51221202 GGAATACTCAGAGGTGCTTATGG - Intronic
955962626 3:64356507-64356529 AGTATTCTCATATTTGCAAAAGG - Intronic
956619547 3:71207458-71207480 GCATTTCTCCGTTGTGCAAAAGG + Intronic
957422080 3:79983570-79983592 GGATATCTCAGCTGTGAAAATGG + Intergenic
958958227 3:100484820-100484842 GGAATTCTCTGATGGCAAAAGGG + Intergenic
960140660 3:114149083-114149105 GGTATTCAGAGGTGTGCAAAAGG + Intronic
964269320 3:154938787-154938809 TGTATTCTCAAATGTGCCAAAGG + Intergenic
964729461 3:159849774-159849796 GGAACTCACATATGTTCAAAAGG - Intronic
965604067 3:170482457-170482479 GGAGCTCTCAGGTGTGCAGAGGG - Intronic
966249141 3:177842774-177842796 GGAAATCTGTGATTTGCAAAGGG + Intergenic
968500779 4:948901-948923 GGCTTTCTCAGCTGTGCGAAGGG + Intronic
970349981 4:15192672-15192694 GAAATTCTAAGATGTGTGAATGG - Intergenic
971294981 4:25379921-25379943 GGAATTTACTGATGTGGAAATGG + Intronic
972445530 4:39139865-39139887 GGAACTTTCAAATGTGCTAAGGG + Intergenic
974285309 4:59857656-59857678 GGCATTTTCACATGTGAAAATGG + Intergenic
974890641 4:67878358-67878380 GGAAATCTCAGTAGAGCAAAAGG - Intronic
976102378 4:81579721-81579743 GCAATTTCCAGATTTGCAAAGGG - Intronic
976262458 4:83158704-83158726 TGAATTCACAGATGTGCCCATGG - Intergenic
978288858 4:107112970-107112992 GGAGTTCACAGATGTGCACGGGG + Intronic
979072296 4:116223236-116223258 GGAATTGTCAGATGTCCATAAGG - Intergenic
979186315 4:117798984-117799006 GGAACTCAGAGATCTGCAAAGGG + Intergenic
979779498 4:124632633-124632655 GGATTTCTGTCATGTGCAAACGG + Intergenic
979890390 4:126084854-126084876 GGTATTCTCAAAAGTGCTAATGG - Intergenic
979897858 4:126182952-126182974 GGAAGTATCAGCTGTGCAATGGG - Intergenic
981993306 4:150950637-150950659 AGATTTATCAGATGTGAAAATGG + Intronic
982323014 4:154099802-154099824 AGAATACATAGATGTGCAAATGG - Intergenic
982670908 4:158319379-158319401 GGATTTTTCAGATCTCCAAAGGG + Intronic
983239087 4:165210708-165210730 GGTAAACTGAGATGTGCAAAAGG + Intronic
983326166 4:166259630-166259652 GGAAATCTAAAATCTGCAAATGG - Intergenic
983771538 4:171555749-171555771 GGAATCTTCAAATGTGGAAAAGG + Intergenic
986377410 5:7146632-7146654 GGAATTCTCAAATGTAAAATAGG - Intergenic
986389469 5:7270545-7270567 GGAATTCTCCCATTTACAAATGG - Intergenic
989474091 5:41854811-41854833 AGAACTCTCATATGTGCCAAGGG + Intronic
990807859 5:59686866-59686888 GGAATTGTCAAATCTTCAAATGG + Intronic
992933117 5:81671715-81671737 GTAATTTTCAGATTTGCTAATGG + Intronic
994324492 5:98434211-98434233 GGAATACTCATTTGAGCAAATGG - Intergenic
994878979 5:105461624-105461646 GGAGTTCTCAGATGGACATAAGG - Intergenic
997577800 5:134996295-134996317 GGACAACTCAGATGTGCAGATGG - Exonic
999257022 5:150215385-150215407 GGTGTTCTCAGATGTGAAAGGGG + Intronic
1000267249 5:159649315-159649337 GGAGTTGTCAGATGCTCAAAAGG - Intergenic
1001113305 5:168916984-168917006 GGAATTCCCAGCTGTTCAGAAGG - Intronic
1002663816 5:180808705-180808727 GGGATTCTCAGTTTTGAAAATGG - Exonic
1002854683 6:1026472-1026494 AGCTTTCTCAGCTGTGCAAAGGG - Intergenic
1003617605 6:7669761-7669783 GGGATTCTCAAATGTGGACATGG + Intergenic
1004521957 6:16369616-16369638 GGCATTTAAAGATGTGCAAAGGG + Intronic
1007107111 6:39291212-39291234 GGAAATATCAGATGCTCAAAGGG - Intergenic
1011771354 6:90676834-90676856 AGAATTCTCAGGGATGCAAATGG + Intergenic
1011983066 6:93409529-93409551 GGAATTCTTAGTTGAGCTAAAGG - Intronic
1012469479 6:99554993-99555015 GGAATTTACAGATAAGCAAAGGG - Intronic
1013759624 6:113501595-113501617 GGAATACTGAGATGTGTCAAGGG - Intergenic
1013874711 6:114810979-114811001 TGAAATGTCAGATGTACAAAGGG - Intergenic
1014257615 6:119178825-119178847 AGATTTCTCAGATTTGAAAAAGG - Exonic
1014318780 6:119899335-119899357 GGCAGTCACAGAGGTGCAAAAGG - Intergenic
1018110643 6:160534209-160534231 GGACTGCACAGATGTGTAAAGGG + Intronic
1019378986 7:711806-711828 GGAATCCTCAGAACTGCAGAAGG - Intronic
1019902540 7:4033663-4033685 AGAGTTCACAGAAGTGCAAATGG + Intronic
1022800818 7:33775662-33775684 CAAAATCTCAGTTGTGCAAAAGG + Intergenic
1024060253 7:45692204-45692226 TGCACTCTCAGATGGGCAAAGGG - Intronic
1024148297 7:46539876-46539898 TGAATTCTCAGGTGGGCTAAAGG - Intergenic
1026080238 7:67211665-67211687 GGAATTTACAGATGAGCAAGGGG - Intronic
1026696850 7:72602338-72602360 GGAATTTACAGATGAGCAAGGGG + Intronic
1026809451 7:73450436-73450458 TGCAGTCTCATATGTGCAAAAGG - Intronic
1032835071 7:135664986-135665008 TGCATTTTCAGATGTGGAAATGG - Intronic
1033153632 7:138937679-138937701 GAGATTCACAGATGTGGAAATGG + Intronic
1040644097 8:49378440-49378462 GTAATTCTAATATGTGTAAAGGG + Intergenic
1041022218 8:53649214-53649236 CATATTTTCAGATGTGCAAATGG + Intergenic
1043021074 8:75000522-75000544 GGCATTCTCACATCTGCAAAGGG - Intronic
1043749503 8:83917759-83917781 AGAATTCTCAGATGTACATTTGG - Intergenic
1043778986 8:84307717-84307739 GGTTTTCTCAGATGTGTAACTGG - Intronic
1043843386 8:85135966-85135988 AAAATTCTCAGATTTTCAAAGGG + Intronic
1044328855 8:90893002-90893024 GGAACTCAGAGAAGTGCAAATGG - Intronic
1047460124 8:125055506-125055528 GTAATTATCATGTGTGCAAAAGG - Intronic
1048080302 8:131119517-131119539 GGAATTATGAGATGGCCAAAAGG + Intergenic
1048115878 8:131521326-131521348 AGAGTTCTAATATGTGCAAAAGG - Intergenic
1050667131 9:7952145-7952167 GAAATCCTCAGGTGTGCAGATGG - Intergenic
1052515597 9:29475281-29475303 AGAATTCCTAGATGTGCTAATGG - Intergenic
1053545119 9:39014772-39014794 GAAATTCTCTGATTTGAAAAGGG + Intergenic
1053809518 9:41837965-41837987 GAAATTCTCTGATTTGAAAAGGG + Intergenic
1054621074 9:67349463-67349485 GAAATTCTCTGATTTGAAAAGGG - Intergenic
1054776921 9:69131736-69131758 GGAATGTTCATCTGTGCAAAGGG - Intronic
1056270930 9:84947486-84947508 GGAATGTGCACATGTGCAAAGGG + Intronic
1058078502 9:100675640-100675662 GGAATTCACAGATGTCAAATGGG - Intergenic
1058610082 9:106766239-106766261 GGAATTTTCTGATGTGCACCAGG + Intergenic
1058611981 9:106787652-106787674 GTAATTGTCAGATTTACAAAGGG - Intergenic
1060030650 9:120212162-120212184 GGAATTCTCAGAAGTCCTCAGGG + Intergenic
1185706055 X:2267011-2267033 GGATTCCCCAGATGCGCAAATGG + Intronic
1188646579 X:32576062-32576084 GAAATTCTGAGATGTACTAATGG + Intronic
1190192331 X:48287739-48287761 GGAAATCTCAGGTGTGCAGGGGG + Intergenic
1190228520 X:48563584-48563606 GGGATTGTCAGGTGTCCAAAGGG + Intergenic
1190663220 X:52674098-52674120 AGAATTCACAGGTCTGCAAAAGG - Intronic
1190676203 X:52784384-52784406 AGAATTCACAGGTCTGCAAAAGG + Intronic
1190932291 X:54959367-54959389 GAGATTCTCAAATATGCAAATGG - Intronic
1194358388 X:92917519-92917541 GGCATTTTCAGATGTTTAAAAGG + Intergenic
1195724236 X:107897603-107897625 GGAAGTTTCAAATGTACAAAAGG - Intronic
1196177849 X:112659957-112659979 GGTATTCTCAATTGTACAAAAGG - Intronic
1197333342 X:125180885-125180907 GGTATTGTCAGATGAACAAATGG - Intergenic
1198434123 X:136598707-136598729 GAAATACTCAGATGTGGAAAAGG - Intergenic
1200018327 X:153181739-153181761 GGATTTCTCAGACCAGCAAAAGG + Intronic
1200666566 Y:6033210-6033232 GGGATTTTCAGATGTTTAAAAGG + Intergenic
1200712204 Y:6496635-6496657 GGAAGTCTAAGATCTGCAAGAGG - Intergenic
1200886210 Y:8273424-8273446 GGAAGTCTGAGATCTGCAAGAGG - Intergenic
1200952252 Y:8909988-8910010 GGAAGTCTGAGATCTGCAAGAGG + Intergenic
1200987504 Y:9319042-9319064 GGAAGTCTGAGATCTGCAAGAGG - Intergenic
1201021724 Y:9665329-9665351 GGAAGTCTGAGATCTGCAAGAGG + Intergenic
1201059284 Y:10030439-10030461 GGAAGTCTGAGATCTGCAAGAGG - Intergenic
1201473203 Y:14355505-14355527 GGAATTCTGAGAAGGGCAAGCGG + Intergenic
1202101418 Y:21311928-21311950 GGAAGTCTGAGATCTGCAAGAGG + Intergenic
1202118086 Y:21493624-21493646 GGAAGTCTGAGATCTGCAAGAGG + Intergenic
1202120532 Y:21517162-21517184 GGAAGTCTGAGATCTGCAAGAGG + Exonic
1202122983 Y:21540703-21540725 GGAAGTCTGAGATCTGCAAGAGG + Exonic
1202156022 Y:21888678-21888700 GGAAGTCTGAGATCTGCAAGAGG - Exonic
1202158470 Y:21912219-21912241 GGAAGTCTGAGATCTGCAAGAGG - Exonic
1202160757 Y:21933651-21933673 GGAAGTCTGAGATCTGCAAGAGG - Intergenic
1202184924 Y:22177144-22177166 GGAAGTCTGAGATCTGCAAGAGG - Exonic
1202188262 Y:22212529-22212551 GGAAGTCTGAGATCTGCAAAAGG + Intergenic
1202206436 Y:22409257-22409279 GGAAGTCTGAGATCTGCAAGAGG + Exonic
1202230599 Y:22652724-22652746 GGAAGTCTGAGATCTGCAAGAGG + Intergenic
1202240801 Y:22766647-22766669 GGAAGTCTGAGATCTGCAAGAGG - Intergenic
1202312558 Y:23543441-23543463 GGAAGTCTGAGATCTGCAAGAGG - Intergenic
1202393787 Y:24400390-24400412 GGAAGTCTGAGATCTGCAAGAGG - Intergenic
1202476998 Y:25269702-25269724 GGAAGTCTGAGATCTGCAAGAGG + Intergenic
1202558244 Y:26127153-26127175 GGAAGTCTGAGATCTGCAAGAGG + Intergenic