ID: 1152532552

View in Genome Browser
Species Human (GRCh38)
Location 17:80927859-80927881
Sequence GAGAATTCCCGCCCGCACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 26}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152532542_1152532552 17 Left 1152532542 17:80927819-80927841 CCCTCCTCCGCCTGCCCTCATCT 0: 1
1: 0
2: 6
3: 67
4: 693
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532550_1152532552 -9 Left 1152532550 17:80927845-80927867 CCATTTGCACATCTGAGAATTCC 0: 1
1: 0
2: 1
3: 16
4: 240
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532546_1152532552 7 Left 1152532546 17:80927829-80927851 CCTGCCCTCATCTCCTCCATTTG 0: 1
1: 0
2: 4
3: 51
4: 401
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532544_1152532552 13 Left 1152532544 17:80927823-80927845 CCTCCGCCTGCCCTCATCTCCTC 0: 1
1: 0
2: 7
3: 89
4: 1002
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532547_1152532552 3 Left 1152532547 17:80927833-80927855 CCCTCATCTCCTCCATTTGCACA 0: 1
1: 0
2: 3
3: 45
4: 372
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532541_1152532552 18 Left 1152532541 17:80927818-80927840 CCCCTCCTCCGCCTGCCCTCATC 0: 1
1: 0
2: 7
3: 85
4: 925
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532548_1152532552 2 Left 1152532548 17:80927834-80927856 CCTCATCTCCTCCATTTGCACAT 0: 1
1: 0
2: 4
3: 33
4: 385
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532545_1152532552 10 Left 1152532545 17:80927826-80927848 CCGCCTGCCCTCATCTCCTCCAT 0: 1
1: 1
2: 10
3: 108
4: 941
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532543_1152532552 16 Left 1152532543 17:80927820-80927842 CCTCCTCCGCCTGCCCTCATCTC 0: 1
1: 0
2: 3
3: 76
4: 896
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1152532549_1152532552 -6 Left 1152532549 17:80927842-80927864 CCTCCATTTGCACATCTGAGAAT 0: 1
1: 0
2: 1
3: 35
4: 436
Right 1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152532552 Original CRISPR GAGAATTCCCGCCCGCACGG AGG Intronic
900968758 1:5977664-5977686 GAGCATGCCGGCCCGCAGGGTGG + Intronic
903935155 1:26890326-26890348 AGGAAGTCCCGCCCTCACGGCGG + Intergenic
922461416 1:225816917-225816939 GGGAATTCCCTCCCACACAGAGG + Intronic
922748322 1:228059562-228059584 GAGGAGTCCCGCCCCCAGGGAGG - Exonic
1065989586 10:30994547-30994569 GAGAATTCCCACCAGCAAGAAGG + Intronic
1088575557 11:111267736-111267758 GAGAATTCCAGACACCACGGGGG - Intronic
1105408617 13:20151468-20151490 GTGACTTCCCGCCAGCATGGGGG - Intronic
1124232743 15:27959634-27959656 GAGACTTCCAGCCCGCACCCAGG - Intronic
1127960222 15:63885083-63885105 GAGAATTCCCACCAGGACCGGGG + Intergenic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1132675877 16:1121055-1121077 GAGAATTCCAGCCCACAAGCCGG - Intergenic
1137248592 16:46726850-46726872 GAGAAGTCCCTTCCGCACGGAGG + Intronic
1138305225 16:55968528-55968550 GAGAATTCCAGCCTGCAATGGGG - Intergenic
1143411743 17:6713436-6713458 GACAACTCCGCCCCGCACGGGGG + Exonic
1144440378 17:15275997-15276019 GAGAACTCCAGCCAGCACTGGGG - Intergenic
1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG + Intronic
1152663174 17:81552354-81552376 GAGAAGCCCCGGCCGCGCGGCGG + Exonic
1157327394 18:46678953-46678975 GAGAAGTCCCGCCTTCACAGCGG + Intronic
1181967940 22:26669687-26669709 CAGAATTCCCGCCCCCACCCAGG + Intergenic
983827387 4:172280871-172280893 GCAAATTCTGGCCCGCACGGTGG + Intronic
1003023404 6:2531315-2531337 GAGAATGCCCACCCACACTGGGG + Intergenic
1016941362 6:149485172-149485194 GAGACTTGCTGCCCTCACGGAGG - Intergenic
1019328869 7:452974-452996 GGGAATTCCCATCCGCAGGGAGG + Intergenic
1019540328 7:1548330-1548352 GAGAGGTCCCGCCAGCACGGGGG - Intronic
1039449800 8:37663297-37663319 GAGAATTCCCGCCAGCAAGAAGG - Intergenic
1055856803 9:80698169-80698191 GAGAATTCCAGCCAGCACTAAGG - Intergenic
1056824647 9:89868493-89868515 GTGCATCCCCGCCCGCACAGTGG + Intergenic
1060914975 9:127382912-127382934 GAGAATGCCCTCCTGCAAGGTGG - Intronic
1062639447 9:137510803-137510825 GTGACTTTCCGCCCACACGGGGG - Intronic
1194802161 X:98287399-98287421 CAGAATTCCTGCCCTCAAGGAGG + Intergenic