ID: 1152532557

View in Genome Browser
Species Human (GRCh38)
Location 17:80927869-80927891
Sequence GCCCGCACGGAGGAGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 147}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152532544_1152532557 23 Left 1152532544 17:80927823-80927845 CCTCCGCCTGCCCTCATCTCCTC 0: 1
1: 0
2: 7
3: 89
4: 1002
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1152532545_1152532557 20 Left 1152532545 17:80927826-80927848 CCGCCTGCCCTCATCTCCTCCAT 0: 1
1: 1
2: 10
3: 108
4: 941
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1152532546_1152532557 17 Left 1152532546 17:80927829-80927851 CCTGCCCTCATCTCCTCCATTTG 0: 1
1: 0
2: 4
3: 51
4: 401
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1152532549_1152532557 4 Left 1152532549 17:80927842-80927864 CCTCCATTTGCACATCTGAGAAT 0: 1
1: 0
2: 1
3: 35
4: 436
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1152532548_1152532557 12 Left 1152532548 17:80927834-80927856 CCTCATCTCCTCCATTTGCACAT 0: 1
1: 0
2: 4
3: 33
4: 385
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1152532542_1152532557 27 Left 1152532542 17:80927819-80927841 CCCTCCTCCGCCTGCCCTCATCT 0: 1
1: 0
2: 6
3: 67
4: 693
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1152532547_1152532557 13 Left 1152532547 17:80927833-80927855 CCCTCATCTCCTCCATTTGCACA 0: 1
1: 0
2: 3
3: 45
4: 372
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1152532543_1152532557 26 Left 1152532543 17:80927820-80927842 CCTCCTCCGCCTGCCCTCATCTC 0: 1
1: 0
2: 3
3: 76
4: 896
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1152532550_1152532557 1 Left 1152532550 17:80927845-80927867 CCATTTGCACATCTGAGAATTCC 0: 1
1: 0
2: 1
3: 16
4: 240
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147
1152532541_1152532557 28 Left 1152532541 17:80927818-80927840 CCCCTCCTCCGCCTGCCCTCATC 0: 1
1: 0
2: 7
3: 85
4: 925
Right 1152532557 17:80927869-80927891 GCCCGCACGGAGGAGCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152532557 Original CRISPR GCCCGCACGGAGGAGCTGGA GGG Intronic