ID: 1152532560

View in Genome Browser
Species Human (GRCh38)
Location 17:80927883-80927905
Sequence GCTGGAGGGTGTCAGCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 260}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152532554_1152532560 -6 Left 1152532554 17:80927866-80927888 CCCGCCCGCACGGAGGAGCTGGA 0: 1
1: 0
2: 1
3: 15
4: 152
Right 1152532560 17:80927883-80927905 GCTGGAGGGTGTCAGCCTTGTGG 0: 1
1: 0
2: 0
3: 22
4: 260
1152532547_1152532560 27 Left 1152532547 17:80927833-80927855 CCCTCATCTCCTCCATTTGCACA 0: 1
1: 0
2: 3
3: 45
4: 372
Right 1152532560 17:80927883-80927905 GCTGGAGGGTGTCAGCCTTGTGG 0: 1
1: 0
2: 0
3: 22
4: 260
1152532555_1152532560 -7 Left 1152532555 17:80927867-80927889 CCGCCCGCACGGAGGAGCTGGAG 0: 1
1: 0
2: 1
3: 10
4: 166
Right 1152532560 17:80927883-80927905 GCTGGAGGGTGTCAGCCTTGTGG 0: 1
1: 0
2: 0
3: 22
4: 260
1152532548_1152532560 26 Left 1152532548 17:80927834-80927856 CCTCATCTCCTCCATTTGCACAT 0: 1
1: 0
2: 4
3: 33
4: 385
Right 1152532560 17:80927883-80927905 GCTGGAGGGTGTCAGCCTTGTGG 0: 1
1: 0
2: 0
3: 22
4: 260
1152532558_1152532560 -10 Left 1152532558 17:80927870-80927892 CCCGCACGGAGGAGCTGGAGGGT 0: 1
1: 0
2: 2
3: 17
4: 228
Right 1152532560 17:80927883-80927905 GCTGGAGGGTGTCAGCCTTGTGG 0: 1
1: 0
2: 0
3: 22
4: 260
1152532550_1152532560 15 Left 1152532550 17:80927845-80927867 CCATTTGCACATCTGAGAATTCC 0: 1
1: 0
2: 1
3: 16
4: 240
Right 1152532560 17:80927883-80927905 GCTGGAGGGTGTCAGCCTTGTGG 0: 1
1: 0
2: 0
3: 22
4: 260
1152532549_1152532560 18 Left 1152532549 17:80927842-80927864 CCTCCATTTGCACATCTGAGAAT 0: 1
1: 0
2: 1
3: 35
4: 436
Right 1152532560 17:80927883-80927905 GCTGGAGGGTGTCAGCCTTGTGG 0: 1
1: 0
2: 0
3: 22
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152532560 Original CRISPR GCTGGAGGGTGTCAGCCTTG TGG Intronic