ID: 1152532561

View in Genome Browser
Species Human (GRCh38)
Location 17:80927888-80927910
Sequence AGGGTGTCAGCCTTGTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 483}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152532558_1152532561 -5 Left 1152532558 17:80927870-80927892 CCCGCACGGAGGAGCTGGAGGGT 0: 1
1: 0
2: 2
3: 17
4: 228
Right 1152532561 17:80927888-80927910 AGGGTGTCAGCCTTGTGGTCTGG 0: 1
1: 0
2: 0
3: 23
4: 483
1152532555_1152532561 -2 Left 1152532555 17:80927867-80927889 CCGCCCGCACGGAGGAGCTGGAG 0: 1
1: 0
2: 1
3: 10
4: 166
Right 1152532561 17:80927888-80927910 AGGGTGTCAGCCTTGTGGTCTGG 0: 1
1: 0
2: 0
3: 23
4: 483
1152532550_1152532561 20 Left 1152532550 17:80927845-80927867 CCATTTGCACATCTGAGAATTCC 0: 1
1: 0
2: 1
3: 16
4: 240
Right 1152532561 17:80927888-80927910 AGGGTGTCAGCCTTGTGGTCTGG 0: 1
1: 0
2: 0
3: 23
4: 483
1152532549_1152532561 23 Left 1152532549 17:80927842-80927864 CCTCCATTTGCACATCTGAGAAT 0: 1
1: 0
2: 1
3: 35
4: 436
Right 1152532561 17:80927888-80927910 AGGGTGTCAGCCTTGTGGTCTGG 0: 1
1: 0
2: 0
3: 23
4: 483
1152532554_1152532561 -1 Left 1152532554 17:80927866-80927888 CCCGCCCGCACGGAGGAGCTGGA 0: 1
1: 0
2: 1
3: 15
4: 152
Right 1152532561 17:80927888-80927910 AGGGTGTCAGCCTTGTGGTCTGG 0: 1
1: 0
2: 0
3: 23
4: 483
1152532559_1152532561 -6 Left 1152532559 17:80927871-80927893 CCGCACGGAGGAGCTGGAGGGTG 0: 1
1: 0
2: 6
3: 19
4: 293
Right 1152532561 17:80927888-80927910 AGGGTGTCAGCCTTGTGGTCTGG 0: 1
1: 0
2: 0
3: 23
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152532561 Original CRISPR AGGGTGTCAGCCTTGTGGTC TGG Intronic