ID: 1152540417

View in Genome Browser
Species Human (GRCh38)
Location 17:80971804-80971826
Sequence TCCACCGCAGGCGAGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152540407_1152540417 5 Left 1152540407 17:80971776-80971798 CCCGGCTGCCCTCCAGGGTCATC No data
Right 1152540417 17:80971804-80971826 TCCACCGCAGGCGAGCTGGAGGG No data
1152540409_1152540417 -3 Left 1152540409 17:80971784-80971806 CCCTCCAGGGTCATCCACCATCC No data
Right 1152540417 17:80971804-80971826 TCCACCGCAGGCGAGCTGGAGGG No data
1152540411_1152540417 -7 Left 1152540411 17:80971788-80971810 CCAGGGTCATCCACCATCCACCG No data
Right 1152540417 17:80971804-80971826 TCCACCGCAGGCGAGCTGGAGGG No data
1152540402_1152540417 20 Left 1152540402 17:80971761-80971783 CCCCTTGGAGGCTCTCCCGGCTG No data
Right 1152540417 17:80971804-80971826 TCCACCGCAGGCGAGCTGGAGGG No data
1152540404_1152540417 18 Left 1152540404 17:80971763-80971785 CCTTGGAGGCTCTCCCGGCTGCC No data
Right 1152540417 17:80971804-80971826 TCCACCGCAGGCGAGCTGGAGGG No data
1152540403_1152540417 19 Left 1152540403 17:80971762-80971784 CCCTTGGAGGCTCTCCCGGCTGC No data
Right 1152540417 17:80971804-80971826 TCCACCGCAGGCGAGCTGGAGGG No data
1152540400_1152540417 23 Left 1152540400 17:80971758-80971780 CCTCCCCTTGGAGGCTCTCCCGG No data
Right 1152540417 17:80971804-80971826 TCCACCGCAGGCGAGCTGGAGGG No data
1152540410_1152540417 -4 Left 1152540410 17:80971785-80971807 CCTCCAGGGTCATCCACCATCCA No data
Right 1152540417 17:80971804-80971826 TCCACCGCAGGCGAGCTGGAGGG No data
1152540408_1152540417 4 Left 1152540408 17:80971777-80971799 CCGGCTGCCCTCCAGGGTCATCC No data
Right 1152540417 17:80971804-80971826 TCCACCGCAGGCGAGCTGGAGGG No data
1152540399_1152540417 30 Left 1152540399 17:80971751-80971773 CCTCTGGCCTCCCCTTGGAGGCT No data
Right 1152540417 17:80971804-80971826 TCCACCGCAGGCGAGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152540417 Original CRISPR TCCACCGCAGGCGAGCTGGA GGG Intergenic