ID: 1152541944

View in Genome Browser
Species Human (GRCh38)
Location 17:80981198-80981220
Sequence CAGGAGCCTGCACAGGGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152541929_1152541944 19 Left 1152541929 17:80981156-80981178 CCCCGCGGGTTTCCGGGACCCCA No data
Right 1152541944 17:80981198-80981220 CAGGAGCCTGCACAGGGTAGGGG No data
1152541933_1152541944 1 Left 1152541933 17:80981174-80981196 CCCCAGTCTCTGCTGCCCTCCGC No data
Right 1152541944 17:80981198-80981220 CAGGAGCCTGCACAGGGTAGGGG No data
1152541934_1152541944 0 Left 1152541934 17:80981175-80981197 CCCAGTCTCTGCTGCCCTCCGCG No data
Right 1152541944 17:80981198-80981220 CAGGAGCCTGCACAGGGTAGGGG No data
1152541923_1152541944 27 Left 1152541923 17:80981148-80981170 CCCCGCGCCCCCGCGGGTTTCCG No data
Right 1152541944 17:80981198-80981220 CAGGAGCCTGCACAGGGTAGGGG No data
1152541928_1152541944 20 Left 1152541928 17:80981155-80981177 CCCCCGCGGGTTTCCGGGACCCC No data
Right 1152541944 17:80981198-80981220 CAGGAGCCTGCACAGGGTAGGGG No data
1152541931_1152541944 17 Left 1152541931 17:80981158-80981180 CCGCGGGTTTCCGGGACCCCAGT No data
Right 1152541944 17:80981198-80981220 CAGGAGCCTGCACAGGGTAGGGG No data
1152541930_1152541944 18 Left 1152541930 17:80981157-80981179 CCCGCGGGTTTCCGGGACCCCAG No data
Right 1152541944 17:80981198-80981220 CAGGAGCCTGCACAGGGTAGGGG No data
1152541932_1152541944 7 Left 1152541932 17:80981168-80981190 CCGGGACCCCAGTCTCTGCTGCC No data
Right 1152541944 17:80981198-80981220 CAGGAGCCTGCACAGGGTAGGGG No data
1152541935_1152541944 -1 Left 1152541935 17:80981176-80981198 CCAGTCTCTGCTGCCCTCCGCGC No data
Right 1152541944 17:80981198-80981220 CAGGAGCCTGCACAGGGTAGGGG No data
1152541922_1152541944 28 Left 1152541922 17:80981147-80981169 CCCCCGCGCCCCCGCGGGTTTCC No data
Right 1152541944 17:80981198-80981220 CAGGAGCCTGCACAGGGTAGGGG No data
1152541926_1152541944 25 Left 1152541926 17:80981150-80981172 CCGCGCCCCCGCGGGTTTCCGGG No data
Right 1152541944 17:80981198-80981220 CAGGAGCCTGCACAGGGTAGGGG No data
1152541924_1152541944 26 Left 1152541924 17:80981149-80981171 CCCGCGCCCCCGCGGGTTTCCGG No data
Right 1152541944 17:80981198-80981220 CAGGAGCCTGCACAGGGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152541944 Original CRISPR CAGGAGCCTGCACAGGGTAG GGG Intergenic
No off target data available for this crispr