ID: 1152542177

View in Genome Browser
Species Human (GRCh38)
Location 17:80981959-80981981
Sequence GACTAAGCAGCGGTGACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152542177_1152542183 6 Left 1152542177 17:80981959-80981981 CCCTGAGTCACCGCTGCTTAGTC No data
Right 1152542183 17:80981988-80982010 TGAAGATCCCACCAGGAGCGTGG No data
1152542177_1152542188 20 Left 1152542177 17:80981959-80981981 CCCTGAGTCACCGCTGCTTAGTC No data
Right 1152542188 17:80982002-80982024 GGAGCGTGGGAGCCCCTGCCTGG No data
1152542177_1152542184 7 Left 1152542177 17:80981959-80981981 CCCTGAGTCACCGCTGCTTAGTC No data
Right 1152542184 17:80981989-80982011 GAAGATCCCACCAGGAGCGTGGG No data
1152542177_1152542180 -1 Left 1152542177 17:80981959-80981981 CCCTGAGTCACCGCTGCTTAGTC No data
Right 1152542180 17:80981981-80982003 CTGACCCTGAAGATCCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152542177 Original CRISPR GACTAAGCAGCGGTGACTCA GGG (reversed) Intergenic
No off target data available for this crispr