ID: 1152542178

View in Genome Browser
Species Human (GRCh38)
Location 17:80981960-80981982
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152542178_1152542184 6 Left 1152542178 17:80981960-80981982 CCTGAGTCACCGCTGCTTAGTCT No data
Right 1152542184 17:80981989-80982011 GAAGATCCCACCAGGAGCGTGGG No data
1152542178_1152542180 -2 Left 1152542178 17:80981960-80981982 CCTGAGTCACCGCTGCTTAGTCT No data
Right 1152542180 17:80981981-80982003 CTGACCCTGAAGATCCCACCAGG No data
1152542178_1152542183 5 Left 1152542178 17:80981960-80981982 CCTGAGTCACCGCTGCTTAGTCT No data
Right 1152542183 17:80981988-80982010 TGAAGATCCCACCAGGAGCGTGG No data
1152542178_1152542188 19 Left 1152542178 17:80981960-80981982 CCTGAGTCACCGCTGCTTAGTCT No data
Right 1152542188 17:80982002-80982024 GGAGCGTGGGAGCCCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152542178 Original CRISPR AGACTAAGCAGCGGTGACTC AGG (reversed) Intergenic
No off target data available for this crispr