ID: 1152542179

View in Genome Browser
Species Human (GRCh38)
Location 17:80981969-80981991
Sequence TTCAGGGTCAGACTAAGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152542179_1152542183 -4 Left 1152542179 17:80981969-80981991 CCGCTGCTTAGTCTGACCCTGAA No data
Right 1152542183 17:80981988-80982010 TGAAGATCCCACCAGGAGCGTGG No data
1152542179_1152542184 -3 Left 1152542179 17:80981969-80981991 CCGCTGCTTAGTCTGACCCTGAA No data
Right 1152542184 17:80981989-80982011 GAAGATCCCACCAGGAGCGTGGG No data
1152542179_1152542188 10 Left 1152542179 17:80981969-80981991 CCGCTGCTTAGTCTGACCCTGAA No data
Right 1152542188 17:80982002-80982024 GGAGCGTGGGAGCCCCTGCCTGG No data
1152542179_1152542190 22 Left 1152542179 17:80981969-80981991 CCGCTGCTTAGTCTGACCCTGAA No data
Right 1152542190 17:80982014-80982036 CCCCTGCCTGGACACTCCCCCGG No data
1152542179_1152542194 29 Left 1152542179 17:80981969-80981991 CCGCTGCTTAGTCTGACCCTGAA No data
Right 1152542194 17:80982021-80982043 CTGGACACTCCCCCGGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152542179 Original CRISPR TTCAGGGTCAGACTAAGCAG CGG (reversed) Intergenic