ID: 1152542180 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:80981981-80982003 |
| Sequence | CTGACCCTGAAGATCCCACC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1152542178_1152542180 | -2 | Left | 1152542178 | 17:80981960-80981982 | CCTGAGTCACCGCTGCTTAGTCT | No data | ||
| Right | 1152542180 | 17:80981981-80982003 | CTGACCCTGAAGATCCCACCAGG | No data | ||||
| 1152542177_1152542180 | -1 | Left | 1152542177 | 17:80981959-80981981 | CCCTGAGTCACCGCTGCTTAGTC | No data | ||
| Right | 1152542180 | 17:80981981-80982003 | CTGACCCTGAAGATCCCACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1152542180 | Original CRISPR | CTGACCCTGAAGATCCCACC AGG | Intergenic | ||