ID: 1152542180

View in Genome Browser
Species Human (GRCh38)
Location 17:80981981-80982003
Sequence CTGACCCTGAAGATCCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152542178_1152542180 -2 Left 1152542178 17:80981960-80981982 CCTGAGTCACCGCTGCTTAGTCT No data
Right 1152542180 17:80981981-80982003 CTGACCCTGAAGATCCCACCAGG No data
1152542177_1152542180 -1 Left 1152542177 17:80981959-80981981 CCCTGAGTCACCGCTGCTTAGTC No data
Right 1152542180 17:80981981-80982003 CTGACCCTGAAGATCCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152542180 Original CRISPR CTGACCCTGAAGATCCCACC AGG Intergenic