ID: 1152542182

View in Genome Browser
Species Human (GRCh38)
Location 17:80981986-80982008
Sequence ACGCTCCTGGTGGGATCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152542182_1152542188 -7 Left 1152542182 17:80981986-80982008 CCTGAAGATCCCACCAGGAGCGT No data
Right 1152542188 17:80982002-80982024 GGAGCGTGGGAGCCCCTGCCTGG No data
1152542182_1152542194 12 Left 1152542182 17:80981986-80982008 CCTGAAGATCCCACCAGGAGCGT No data
Right 1152542194 17:80982021-80982043 CTGGACACTCCCCCGGCCCATGG No data
1152542182_1152542197 21 Left 1152542182 17:80981986-80982008 CCTGAAGATCCCACCAGGAGCGT No data
Right 1152542197 17:80982030-80982052 CCCCCGGCCCATGGAGAAGGTGG No data
1152542182_1152542190 5 Left 1152542182 17:80981986-80982008 CCTGAAGATCCCACCAGGAGCGT No data
Right 1152542190 17:80982014-80982036 CCCCTGCCTGGACACTCCCCCGG No data
1152542182_1152542195 18 Left 1152542182 17:80981986-80982008 CCTGAAGATCCCACCAGGAGCGT No data
Right 1152542195 17:80982027-80982049 ACTCCCCCGGCCCATGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152542182 Original CRISPR ACGCTCCTGGTGGGATCTTC AGG (reversed) Intergenic