ID: 1152542183

View in Genome Browser
Species Human (GRCh38)
Location 17:80981988-80982010
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152542178_1152542183 5 Left 1152542178 17:80981960-80981982 CCTGAGTCACCGCTGCTTAGTCT No data
Right 1152542183 17:80981988-80982010 TGAAGATCCCACCAGGAGCGTGG No data
1152542177_1152542183 6 Left 1152542177 17:80981959-80981981 CCCTGAGTCACCGCTGCTTAGTC No data
Right 1152542183 17:80981988-80982010 TGAAGATCCCACCAGGAGCGTGG No data
1152542179_1152542183 -4 Left 1152542179 17:80981969-80981991 CCGCTGCTTAGTCTGACCCTGAA No data
Right 1152542183 17:80981988-80982010 TGAAGATCCCACCAGGAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152542183 Original CRISPR TGAAGATCCCACCAGGAGCG TGG Intergenic