ID: 1152542188

View in Genome Browser
Species Human (GRCh38)
Location 17:80982002-80982024
Sequence GGAGCGTGGGAGCCCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152542182_1152542188 -7 Left 1152542182 17:80981986-80982008 CCTGAAGATCCCACCAGGAGCGT No data
Right 1152542188 17:80982002-80982024 GGAGCGTGGGAGCCCCTGCCTGG No data
1152542177_1152542188 20 Left 1152542177 17:80981959-80981981 CCCTGAGTCACCGCTGCTTAGTC No data
Right 1152542188 17:80982002-80982024 GGAGCGTGGGAGCCCCTGCCTGG No data
1152542178_1152542188 19 Left 1152542178 17:80981960-80981982 CCTGAGTCACCGCTGCTTAGTCT No data
Right 1152542188 17:80982002-80982024 GGAGCGTGGGAGCCCCTGCCTGG No data
1152542179_1152542188 10 Left 1152542179 17:80981969-80981991 CCGCTGCTTAGTCTGACCCTGAA No data
Right 1152542188 17:80982002-80982024 GGAGCGTGGGAGCCCCTGCCTGG No data
1152542181_1152542188 -6 Left 1152542181 17:80981985-80982007 CCCTGAAGATCCCACCAGGAGCG No data
Right 1152542188 17:80982002-80982024 GGAGCGTGGGAGCCCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152542188 Original CRISPR GGAGCGTGGGAGCCCCTGCC TGG Intergenic
No off target data available for this crispr