ID: 1152542190

View in Genome Browser
Species Human (GRCh38)
Location 17:80982014-80982036
Sequence CCCCTGCCTGGACACTCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152542185_1152542190 -4 Left 1152542185 17:80981995-80982017 CCCACCAGGAGCGTGGGAGCCCC No data
Right 1152542190 17:80982014-80982036 CCCCTGCCTGGACACTCCCCCGG No data
1152542181_1152542190 6 Left 1152542181 17:80981985-80982007 CCCTGAAGATCCCACCAGGAGCG No data
Right 1152542190 17:80982014-80982036 CCCCTGCCTGGACACTCCCCCGG No data
1152542187_1152542190 -8 Left 1152542187 17:80981999-80982021 CCAGGAGCGTGGGAGCCCCTGCC No data
Right 1152542190 17:80982014-80982036 CCCCTGCCTGGACACTCCCCCGG No data
1152542186_1152542190 -5 Left 1152542186 17:80981996-80982018 CCACCAGGAGCGTGGGAGCCCCT No data
Right 1152542190 17:80982014-80982036 CCCCTGCCTGGACACTCCCCCGG No data
1152542182_1152542190 5 Left 1152542182 17:80981986-80982008 CCTGAAGATCCCACCAGGAGCGT No data
Right 1152542190 17:80982014-80982036 CCCCTGCCTGGACACTCCCCCGG No data
1152542179_1152542190 22 Left 1152542179 17:80981969-80981991 CCGCTGCTTAGTCTGACCCTGAA No data
Right 1152542190 17:80982014-80982036 CCCCTGCCTGGACACTCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152542190 Original CRISPR CCCCTGCCTGGACACTCCCC CGG Intergenic