ID: 1152542194

View in Genome Browser
Species Human (GRCh38)
Location 17:80982021-80982043
Sequence CTGGACACTCCCCCGGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152542181_1152542194 13 Left 1152542181 17:80981985-80982007 CCCTGAAGATCCCACCAGGAGCG No data
Right 1152542194 17:80982021-80982043 CTGGACACTCCCCCGGCCCATGG No data
1152542179_1152542194 29 Left 1152542179 17:80981969-80981991 CCGCTGCTTAGTCTGACCCTGAA No data
Right 1152542194 17:80982021-80982043 CTGGACACTCCCCCGGCCCATGG No data
1152542187_1152542194 -1 Left 1152542187 17:80981999-80982021 CCAGGAGCGTGGGAGCCCCTGCC No data
Right 1152542194 17:80982021-80982043 CTGGACACTCCCCCGGCCCATGG No data
1152542182_1152542194 12 Left 1152542182 17:80981986-80982008 CCTGAAGATCCCACCAGGAGCGT No data
Right 1152542194 17:80982021-80982043 CTGGACACTCCCCCGGCCCATGG No data
1152542186_1152542194 2 Left 1152542186 17:80981996-80982018 CCACCAGGAGCGTGGGAGCCCCT No data
Right 1152542194 17:80982021-80982043 CTGGACACTCCCCCGGCCCATGG No data
1152542185_1152542194 3 Left 1152542185 17:80981995-80982017 CCCACCAGGAGCGTGGGAGCCCC No data
Right 1152542194 17:80982021-80982043 CTGGACACTCCCCCGGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152542194 Original CRISPR CTGGACACTCCCCCGGCCCA TGG Intergenic