ID: 1152542399

View in Genome Browser
Species Human (GRCh38)
Location 17:80982798-80982820
Sequence CCTCGTGAGACAGGGGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152542386_1152542399 5 Left 1152542386 17:80982770-80982792 CCGGGTGAGTGTCCCCAGCAGGA No data
Right 1152542399 17:80982798-80982820 CCTCGTGAGACAGGGGCGGCGGG No data
1152542384_1152542399 6 Left 1152542384 17:80982769-80982791 CCCGGGTGAGTGTCCCCAGCAGG No data
Right 1152542399 17:80982798-80982820 CCTCGTGAGACAGGGGCGGCGGG No data
1152542389_1152542399 -7 Left 1152542389 17:80982782-80982804 CCCCAGCAGGAAGGGCCCTCGTG No data
Right 1152542399 17:80982798-80982820 CCTCGTGAGACAGGGGCGGCGGG No data
1152542391_1152542399 -9 Left 1152542391 17:80982784-80982806 CCAGCAGGAAGGGCCCTCGTGAG No data
Right 1152542399 17:80982798-80982820 CCTCGTGAGACAGGGGCGGCGGG No data
1152542380_1152542399 28 Left 1152542380 17:80982747-80982769 CCAATGCTGCCTGCTGAGGGATC No data
Right 1152542399 17:80982798-80982820 CCTCGTGAGACAGGGGCGGCGGG No data
1152542383_1152542399 19 Left 1152542383 17:80982756-80982778 CCTGCTGAGGGATCCCGGGTGAG No data
Right 1152542399 17:80982798-80982820 CCTCGTGAGACAGGGGCGGCGGG No data
1152542390_1152542399 -8 Left 1152542390 17:80982783-80982805 CCCAGCAGGAAGGGCCCTCGTGA No data
Right 1152542399 17:80982798-80982820 CCTCGTGAGACAGGGGCGGCGGG No data
1152542379_1152542399 29 Left 1152542379 17:80982746-80982768 CCCAATGCTGCCTGCTGAGGGAT No data
Right 1152542399 17:80982798-80982820 CCTCGTGAGACAGGGGCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152542399 Original CRISPR CCTCGTGAGACAGGGGCGGC GGG Intergenic