ID: 1152543511

View in Genome Browser
Species Human (GRCh38)
Location 17:80989250-80989272
Sequence TTCGTGACCTGCGGGCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152543511_1152543517 1 Left 1152543511 17:80989250-80989272 CCCAGAGGCCCGCAGGTCACGAA No data
Right 1152543517 17:80989274-80989296 CCAAGACCCCAGACCCTCCATGG No data
1152543511_1152543527 28 Left 1152543511 17:80989250-80989272 CCCAGAGGCCCGCAGGTCACGAA No data
Right 1152543527 17:80989301-80989323 CTGTGGAGGAGAGAATCCGAAGG No data
1152543511_1152543523 14 Left 1152543511 17:80989250-80989272 CCCAGAGGCCCGCAGGTCACGAA No data
Right 1152543523 17:80989287-80989309 CCCTCCATGGCCTGCTGTGGAGG No data
1152543511_1152543521 11 Left 1152543511 17:80989250-80989272 CCCAGAGGCCCGCAGGTCACGAA No data
Right 1152543521 17:80989284-80989306 AGACCCTCCATGGCCTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152543511 Original CRISPR TTCGTGACCTGCGGGCCTCT GGG (reversed) Intergenic
No off target data available for this crispr