ID: 1152544114

View in Genome Browser
Species Human (GRCh38)
Location 17:80992177-80992199
Sequence CGGCAGCCACGGCGCCGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 335}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152544114_1152544131 26 Left 1152544114 17:80992177-80992199 CCTGCGCGGCGCCGTGGCTGCCG 0: 1
1: 0
2: 1
3: 19
4: 335
Right 1152544131 17:80992226-80992248 TCTGCGAGCCCCGCCGGGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 75
1152544114_1152544125 20 Left 1152544114 17:80992177-80992199 CCTGCGCGGCGCCGTGGCTGCCG 0: 1
1: 0
2: 1
3: 19
4: 335
Right 1152544125 17:80992220-80992242 TCCGCCTCTGCGAGCCCCGCCGG 0: 1
1: 0
2: 1
3: 10
4: 98
1152544114_1152544127 21 Left 1152544114 17:80992177-80992199 CCTGCGCGGCGCCGTGGCTGCCG 0: 1
1: 0
2: 1
3: 19
4: 335
Right 1152544127 17:80992221-80992243 CCGCCTCTGCGAGCCCCGCCGGG 0: 1
1: 0
2: 2
3: 13
4: 265
1152544114_1152544128 22 Left 1152544114 17:80992177-80992199 CCTGCGCGGCGCCGTGGCTGCCG 0: 1
1: 0
2: 1
3: 19
4: 335
Right 1152544128 17:80992222-80992244 CGCCTCTGCGAGCCCCGCCGGGG 0: 1
1: 0
2: 2
3: 12
4: 149
1152544114_1152544130 25 Left 1152544114 17:80992177-80992199 CCTGCGCGGCGCCGTGGCTGCCG 0: 1
1: 0
2: 1
3: 19
4: 335
Right 1152544130 17:80992225-80992247 CTCTGCGAGCCCCGCCGGGGTGG 0: 1
1: 0
2: 1
3: 2
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152544114 Original CRISPR CGGCAGCCACGGCGCCGCGC AGG (reversed) Intronic
900402886 1:2479840-2479862 CGGCAGCCACCGCGAGTCGCTGG + Exonic
900677911 1:3900134-3900156 CGGCAGCAGCTGCGCCGGGCAGG - Intronic
900816950 1:4855162-4855184 CGTGAGCCACGGCGCCTGGCCGG - Intergenic
903652352 1:24929874-24929896 CGGCCGTCAGGGCGCCGGGCAGG + Intronic
903966376 1:27092803-27092825 CGTGAGCCACGGCGCCTGGCCGG + Intergenic
904086720 1:27914515-27914537 CGGCCGCCACTGCGCCGCTCTGG + Exonic
904252951 1:29237747-29237769 CCGCAGCCCCGGCGCCGCCTCGG - Intronic
904724978 1:32539949-32539971 CGGCCGCCGCGGGGGCGCGCGGG + Intronic
904744463 1:32702615-32702637 CGGCGGGGACGGCGCCGCCCAGG - Exonic
904769018 1:32870762-32870784 CGGCAGGCCCGGGGCGGCGCAGG + Exonic
905449324 1:38046756-38046778 CGGCGGCGGCGGCGCGGCGCAGG - Exonic
906319296 1:44806574-44806596 AGGCAGCCTCGGGGCCGCACCGG + Exonic
907513775 1:54980735-54980757 CGGCAGCCTCAGAGCCCCGCGGG + Intergenic
907784470 1:57598261-57598283 CGTGAGCCACGGCGCCCAGCCGG + Intronic
907906119 1:58784586-58784608 CGGCCGCCACCGCGCGGGGCTGG + Intergenic
908714285 1:67053743-67053765 CGGCGGCGGCGGCGCGGCGCCGG - Intronic
908726708 1:67184262-67184284 CGGGAGCCACCGCGCCCAGCCGG - Intronic
908930585 1:69312492-69312514 CGGCAGCCACAGCGTGGTGCTGG + Intergenic
909933806 1:81528363-81528385 CGTGAGCCACCGCGCCGGGCCGG - Intronic
912363479 1:109113894-109113916 CGGCTGCCATGGCGACCCGCAGG + Intronic
912408920 1:109466612-109466634 CGGCCGCCGCGGTGCCCCGCCGG - Exonic
912458085 1:109812300-109812322 TGTGAGCCACGGCGCCGAGCCGG - Intergenic
912514743 1:110210650-110210672 CCCCAGGCTCGGCGCCGCGCAGG + Intergenic
913068646 1:115280338-115280360 CGTTAGCCAAGGCGCCGGGCTGG + Intergenic
914193489 1:145431241-145431263 CGGCTGCCACGGTTCCACGCTGG + Intergenic
914242274 1:145859792-145859814 CGGCGGCCGCGGCTCCGCCCGGG + Intronic
914474818 1:148014131-148014153 CGGCTGCCACGGTTCCACGCTGG + Intergenic
914868903 1:151457643-151457665 CGTCAGCCACCGCGCCCGGCCGG - Intronic
915934783 1:160084073-160084095 TGGCGGCCGCGGCGCCGCGGCGG - Exonic
916729527 1:167553638-167553660 CGGCCGCCGCGACCCCGCGCGGG + Exonic
918627959 1:186680296-186680318 CGGCGGGCAGGGCGCGGCGCGGG + Exonic
919945896 1:202318818-202318840 CGGCGGCTTCGGCCCCGCGCAGG + Exonic
921189902 1:212699859-212699881 CCGCACCCACGGCCTCGCGCCGG + Exonic
922250574 1:223845794-223845816 CGGCGGCAGCGGCGGCGCGCGGG + Exonic
922374824 1:224951918-224951940 CGTGAGCCACGGCGCCCGGCTGG + Intronic
923754358 1:236776947-236776969 CGTGAGCCACCGCGCCCCGCCGG + Intergenic
924084579 1:240437581-240437603 CGTGAGCCACCGCGCCGGGCTGG + Intronic
924774477 1:247106241-247106263 CGGCAGTTACTGCGCCGCGGAGG + Intergenic
1064410305 10:15098604-15098626 CGTGAGCCACCGCGCCGGGCCGG - Intronic
1065022036 10:21509136-21509158 CGGCCTCCAAGGCCCCGCGCGGG - Intergenic
1065188871 10:23192964-23192986 CGGCTGCGGCGGCGCGGCGCCGG + Exonic
1066022839 10:31319825-31319847 CGACAGCGACGGCGCCGGCCGGG - Intronic
1066073953 10:31853007-31853029 CGTCAGCCACGGCGCCCGGCCGG + Intronic
1066080709 10:31928527-31928549 CGGCGGCGGCGGCGCCGCGGAGG - Intronic
1066584655 10:36919065-36919087 CGTGAGCCACTGCGCCCCGCTGG + Intergenic
1069486341 10:68826492-68826514 CGTGAGCCACGGCGCCCGGCCGG - Intergenic
1070329597 10:75408060-75408082 TGGCCTCAACGGCGCCGCGCCGG - Intergenic
1071376415 10:85009667-85009689 CGTGAGCCACTGCGCCGGGCTGG + Intergenic
1071618408 10:87095782-87095804 CGTGAGCCACCGCGCCGGGCCGG - Intronic
1071813231 10:89206463-89206485 CCGCAGCCACATCACCGCGCTGG + Exonic
1072241176 10:93496737-93496759 CCGCAGCCCCGGGGCCGGGCCGG + Exonic
1072552816 10:96492340-96492362 CGTGAGCCACGGCGCCTAGCAGG - Intronic
1074182988 10:111079105-111079127 GGGCTGCCAAGGCGTCGCGCTGG + Exonic
1074503123 10:114043999-114044021 GGGCAGCCGCGGCGCGGGGCCGG - Intergenic
1074772424 10:116742609-116742631 CCGCAGCCACGGCTCCTCCCCGG + Intergenic
1074949162 10:118312074-118312096 CTGCAGCCAGAGCGCCGTGCAGG - Intronic
1076722965 10:132400755-132400777 AGGCAGCCTCAGCGCAGCGCAGG - Intronic
1076778909 10:132713409-132713431 CGGCAGGCAAGGAGCCACGCAGG - Intronic
1077250063 11:1557011-1557033 CGGCGGCCCCGGCCCCCCGCCGG - Exonic
1078246051 11:9573958-9573980 CCGCCGCCACCCCGCCGCGCCGG + Exonic
1078635809 11:13048804-13048826 CGTGAGCCACCGCGCCGGGCCGG + Intergenic
1080458890 11:32436869-32436891 CAGCAGCGACGGCGCAGCGTGGG + Intergenic
1081699947 11:45146702-45146724 CGCCAGCCTCGGCGCGGCGGCGG - Intronic
1081899675 11:46617260-46617282 CGGCAGTGAGGGCGCGGCGCGGG - Intronic
1083457300 11:62787485-62787507 CGGCCGCCACGGCCCCGCACAGG - Exonic
1084069952 11:66727824-66727846 CCGCAGCCCCGGCGACGCGAGGG + Intronic
1084154017 11:67303872-67303894 CCGCAGCCCGGGCGGCGCGCAGG - Intronic
1084542649 11:69797179-69797201 CGTGAGCCACGGCGCCAGGCTGG + Intergenic
1084562264 11:69911638-69911660 CTGCAGGCACCGCGCCTCGCAGG + Intergenic
1084973044 11:72781728-72781750 CGGGAGACCCGGGGCCGCGCGGG + Intronic
1085287151 11:75370553-75370575 CGTGAGCCACCGCGCCGGGCGGG + Intergenic
1085555038 11:77411959-77411981 CGGCAGCGAAGGCGCCGCGTCGG + Intronic
1085784941 11:79440555-79440577 AGGGAGGCAAGGCGCCGCGCCGG + Exonic
1086290683 11:85305792-85305814 CGTGAGCCACGGCGCCTGGCTGG + Intronic
1086498756 11:87430913-87430935 GGGCAGCCACGGTGCTGTGCTGG + Intergenic
1087076170 11:94128919-94128941 CGGCAGCCAGGGCGGCGCGGAGG + Exonic
1088889916 11:114036282-114036304 CCGCAGCCAGAGCGCAGCGCCGG - Intergenic
1089397572 11:118145970-118145992 TGGCAGCCGCGGGGGCGCGCGGG + Intronic
1091526133 12:1303353-1303375 CGTGAGCCACGGCGCCCGGCCGG - Intronic
1093057415 12:14568595-14568617 CGTGAGCCACGGCGCCCGGCTGG - Intergenic
1093460582 12:19403681-19403703 CGTGAGCCACCGCGCCCCGCCGG - Intergenic
1096103142 12:48981310-48981332 CGGCAGCAACCGCGCTTCGCGGG + Exonic
1096144172 12:49266142-49266164 CGTGAGCCACCGCGCCGGGCCGG - Intronic
1096430566 12:51539455-51539477 CGTGAGCCACTGCGCCGGGCCGG + Intergenic
1096749844 12:53751729-53751751 CGGAAGCCGCGGCCCCGGGCGGG - Intergenic
1097251242 12:57633173-57633195 CGGCTGCTTCGGCTCCGCGCGGG + Exonic
1098620577 12:72592992-72593014 CGTGAGCCACCGCGCCCCGCTGG + Intronic
1099304369 12:80936856-80936878 CCGCAGCCTGGGCGCCGCGGTGG + Intronic
1100985622 12:100199707-100199729 CGGTAGCCACGCAGTCGCGCTGG + Intronic
1102588376 12:113939466-113939488 CGTGAGCCACTGCGCCGGGCCGG - Intronic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103501518 12:121406566-121406588 CGTGAGCCACCGCGCCGGGCTGG + Intronic
1103930067 12:124445327-124445349 CGGCTGCCCCGGCCCCGCCCCGG + Intronic
1104591726 12:130089401-130089423 CGTGAGCCACGGCGCCCAGCCGG - Intergenic
1105010296 12:132751520-132751542 TGTCAGCCACGGCGCCCAGCCGG + Intronic
1105446326 13:20460804-20460826 CGTGAGCCACTGCGCCCCGCCGG + Intronic
1106142143 13:27020371-27020393 GGGCAGCCACGGCTCAGTGCAGG + Intergenic
1108313951 13:49220355-49220377 CGGCAGCGACGGCCCCGAGGGGG + Exonic
1116657971 14:47674991-47675013 CGGCGGCGGCGGCGGCGCGCTGG + Intergenic
1116847689 14:49880135-49880157 CGTGAGCCACTGCGCCCCGCTGG - Intergenic
1116905144 14:50396814-50396836 CGGGACTCACGGCGCCGCGGCGG + Intronic
1117722178 14:58638418-58638440 CCGCACCCCCGGCGCCGCGCAGG - Exonic
1118242396 14:64072780-64072802 CGTGAGCCACTGCGCCCCGCTGG + Intronic
1119227752 14:72956929-72956951 CGTGAGCCACCGCGCCGGGCCGG - Intronic
1119602486 14:75985933-75985955 CGGCAGGCCTCGCGCCGCGCCGG + Intronic
1120589274 14:86356004-86356026 CGTCAGCCACCGCGCCCAGCTGG + Intergenic
1122256084 14:100477808-100477830 CGTGAGCCACGGCGCCCGGCTGG - Intronic
1122418402 14:101561074-101561096 CGGCGGCCGCCGAGCCGCGCCGG - Intergenic
1122647964 14:103207462-103207484 CGGCAGCCCTGGCGGGGCGCGGG - Intergenic
1122658558 14:103279196-103279218 CGGCAGCCCTGGCGGGGCGCGGG - Intergenic
1122789029 14:104176654-104176676 TGGCAGCCAGGGCGGCCCGCAGG + Exonic
1124743136 15:32315379-32315401 GGGCGGCCTCGGGGCCGCGCCGG - Intergenic
1125594199 15:40873892-40873914 CCGCAGCCACGCGGCCGCACGGG + Intronic
1126134628 15:45378405-45378427 CGGGAGCCGCGGCGCCGAGGCGG - Exonic
1126697987 15:51341729-51341751 CGGCCGCCAGGGCGCCACGCAGG - Exonic
1129446832 15:75625055-75625077 CGTGAGCCACTGCGCCCCGCCGG + Intronic
1129752790 15:78077592-78077614 CGGCGGCGAGGGCGCGGCGCAGG - Exonic
1130370872 15:83284546-83284568 CGGCAGCCCCGGCACCGCAGCGG - Exonic
1130411838 15:83654229-83654251 GTGCAGCCCCGGGGCCGCGCGGG - Exonic
1130924147 15:88372610-88372632 CGGGAGCCACTGCGCCTGGCTGG + Intergenic
1131802328 15:96084147-96084169 CGTGAGCCACAGCGCCGGGCGGG - Intergenic
1132585951 16:705816-705838 CGGCGGCCACGGAGGAGCGCGGG - Exonic
1132733548 16:1374807-1374829 CGGCAGCCAAGGGGCCGCAGAGG + Intronic
1132956396 16:2596473-2596495 CGTGAGCCACGGCGCCCGGCCGG + Intronic
1133040962 16:3059490-3059512 CGGCAGCCCCGGTCGCGCGCTGG + Exonic
1133156503 16:3880250-3880272 TGGCAGCGACGGCGCCCGGCCGG + Exonic
1135047397 16:19167234-19167256 CGTGAGCCACTGCGCCGGGCCGG - Intronic
1141683296 16:85556391-85556413 CGGGCGCGCCGGCGCCGCGCGGG - Intergenic
1141838472 16:86558897-86558919 CGGCAGGGACGGCACCGCGGTGG + Intergenic
1141959180 16:87392788-87392810 CGGCAGGCACCCCGCCGCGGAGG - Intronic
1142271791 16:89093787-89093809 CCGCCGCCACGGCGCCGCGCCGG + Exonic
1142347092 16:89560952-89560974 AGGCAGCCATGGCGCCCAGCCGG + Exonic
1142378849 16:89720852-89720874 CAGCGGCCATGGCGCCGAGCGGG + Exonic
1142522745 17:516641-516663 CGTGAGCCACGGCGCCCGGCCGG + Exonic
1142823153 17:2488273-2488295 CGTGAGCCACTGCGCCGGGCTGG - Intronic
1143390519 17:6556688-6556710 CGGCGGCCACGGCCCGGGGCGGG - Intergenic
1144108720 17:12010695-12010717 CGTGAGCCACTGCGCCCCGCCGG + Intergenic
1144463019 17:15473389-15473411 CGTCAGCCACCGCGCCTGGCCGG - Intronic
1144586744 17:16491930-16491952 AGCCAGCCCCGGCGCCGCGCCGG - Exonic
1144756476 17:17682828-17682850 CGCCAGCCCGGGCTCCGCGCAGG - Intronic
1145243661 17:21253591-21253613 GGGCCGCCGCCGCGCCGCGCCGG + Intergenic
1145884720 17:28373983-28374005 CGTGAGCCACGGCGCCTGGCGGG - Intronic
1146173604 17:30650846-30650868 CGTGAGCCACCGCGCCCCGCTGG + Intergenic
1146225037 17:31058440-31058462 CGTGAGCCACGGCGCCCGGCTGG - Intergenic
1146347058 17:32066867-32066889 CGTGAGCCACCGCGCCCCGCTGG + Intergenic
1146492383 17:33292272-33292294 CGGCAGCGGCGGCGCCGGGCGGG - Exonic
1146722581 17:35133464-35133486 CGGCAGCCACGTGGCCGCGTAGG + Exonic
1147617783 17:41840346-41840368 CGTGAGCCACTGCGCCCCGCTGG - Intronic
1147724943 17:42561293-42561315 CGTCAGCCACCGCGCCCGGCCGG + Intergenic
1148340836 17:46872564-46872586 CGGCAGCCCCGGCACAGGGCGGG + Exonic
1151802312 17:76385484-76385506 CTGCAGCCACGGCTCCGGGCGGG + Exonic
1151960095 17:77401231-77401253 CGGTAGGCCCGGCGCCTCGCCGG + Intronic
1152544114 17:80992177-80992199 CGGCAGCCACGGCGCCGCGCAGG - Intronic
1152571262 17:81122219-81122241 CGGCAGCACCGCCGCCTCGCTGG - Exonic
1152638876 17:81441379-81441401 CGTGAGCCACAGCGCCGGGCTGG - Intronic
1152673437 17:81623515-81623537 CGTCAGCCACCGCGCCCGGCCGG - Intronic
1152689553 17:81711962-81711984 CGGTGGCCACCCCGCCGCGCAGG - Intergenic
1152710702 17:81869464-81869486 GTGCAGCCAGGGGGCCGCGCAGG - Intronic
1152751808 17:82065744-82065766 CGGCGGCCCCGGCGCGGTGCGGG - Intronic
1152756796 17:82090378-82090400 CGGCTGCCATGGCGCCCGGCGGG + Exonic
1154270324 18:12912544-12912566 GAGCAGCCACTGGGCCGCGCGGG - Intronic
1156171764 18:34494069-34494091 CTGCTGCCGCGGCGCCGCTCGGG + Intronic
1156679731 18:39573829-39573851 CGTGAGCCACCGCGCCCCGCAGG - Intergenic
1156779266 18:40831463-40831485 CGTGAGCCACGGCGCCCGGCTGG - Intergenic
1160169344 18:76540002-76540024 CGTCAGCCACCGCGCCCAGCTGG - Intergenic
1160807887 19:1000616-1000638 CGGCAGCCGCGGCGCCAGGGCGG - Exonic
1160887009 19:1354848-1354870 CGGCGTCCACGGCCGCGCGCCGG - Intronic
1161159059 19:2751653-2751675 CGTGAGCCACCGCGCCGGGCCGG - Intergenic
1161522293 19:4731308-4731330 CGTGAGCCACTGCGCCGCCCTGG - Intergenic
1161973332 19:7595984-7596006 CCGCAGCCCCGGCGCCGCCATGG + Exonic
1162006816 19:7786451-7786473 CGTCAGCCACCGCGCCCGGCTGG + Intergenic
1162031491 19:7919313-7919335 CGGGAGCCACCGCGCCCGGCCGG - Intergenic
1162506698 19:11090130-11090152 CGTCAGCCACCGCGCCCGGCCGG + Intronic
1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG + Exonic
1163079665 19:14928435-14928457 CGTGAGCCACTGCGCCGGGCTGG + Intergenic
1163777086 19:19225038-19225060 CCGCCGCCAGGGTGCCGCGCTGG + Exonic
1166546941 19:43639641-43639663 CGGCAGCCTCGGGGCCGCAGAGG - Intronic
1166556142 19:43700927-43700949 CGGGAGCCACTGCGCCTGGCGGG - Intergenic
1167337426 19:48895596-48895618 CGTGAGCCACGGCGCCTGGCGGG - Intronic
1167338094 19:48898833-48898855 CGTGAGCCACCGCGCCGGGCCGG - Intergenic
1168122316 19:54258559-54258581 CGTGAGCCACCGCGCCGGGCCGG - Intronic
1168423072 19:56217765-56217787 AGGCAGCCACGGCGCCCAGCCGG - Intergenic
1168445020 19:56404269-56404291 CAGCATCCTCTGCGCCGCGCCGG + Intronic
1168470531 19:56637339-56637361 CGTAAGCCACGGCGCCCAGCCGG - Intergenic
1168654701 19:58118486-58118508 CTGCGGCCACGGCCCCGCCCCGG - Intergenic
925682539 2:6438011-6438033 CGTAAGCCACGGCGCCCGGCTGG - Intergenic
927708931 2:25313449-25313471 CGGCAGACACGAGGCCGCGGGGG - Intronic
929471673 2:42200026-42200048 CGTCAGCCACCGCGCCTGGCCGG - Intronic
930684188 2:54290212-54290234 AGGCAGCCACGGCCTCGCCCGGG - Intronic
931682904 2:64767957-64767979 CGGGAGCCACTGCGCGGCACCGG + Intergenic
933907870 2:86913604-86913626 CGTGAGCCACGGCGCCCGGCGGG + Intronic
933911054 2:86941991-86942013 CGTGAGCCACGGCGCCCGGCGGG + Intronic
934011696 2:87825953-87825975 CGTGAGCCACGGCGCCCGGCGGG - Intergenic
934021675 2:87961417-87961439 CGTGAGCCACGGCGCCCGGCGGG - Intergenic
934079094 2:88452422-88452444 CGGCAGCCAGGGCGCCTTACGGG - Exonic
934966830 2:98731013-98731035 CGGCGGCAGCGGCGGCGCGCGGG - Intronic
935775637 2:106468522-106468544 CGTGAGCCACGGCGCCCGGCGGG - Intergenic
935904249 2:107826761-107826783 CGTGAGCCACGGCGCCCGGCGGG + Intergenic
936278726 2:111120775-111120797 CGGCGGCCGCGGCGCCGAGGGGG + Intronic
937042638 2:118834071-118834093 CCGCTGCCAGGGCGCCGCCCGGG + Intergenic
937456425 2:122045402-122045424 CGTAAGCCACCGCGCCCCGCCGG + Intergenic
938406328 2:131035112-131035134 CGGGCGCCGCGGGGCCGCGCCGG - Intronic
940830319 2:158457966-158457988 CGGCAGCCTCGGCAGCGGGCGGG - Intronic
941580696 2:167293121-167293143 CGGCAGCGCCGGCGGCGCGGCGG - Intergenic
942882163 2:180873443-180873465 CGGCAGTGGCTGCGCCGCGCTGG + Intergenic
943185167 2:184598315-184598337 CTGCGGCAGCGGCGCCGCGCGGG + Intergenic
946308779 2:218871528-218871550 CGCCAGCCACGCCGTCACGCAGG + Exonic
947909989 2:233794517-233794539 AGGCAGCCACGGCTCTGGGCAGG + Intronic
948874594 2:240819985-240820007 CGGCAACAAGGGCGCCGGGCCGG + Intronic
1168814512 20:727911-727933 CGGGAGCCACCGCGCCCGGCGGG + Intergenic
1170808070 20:19651576-19651598 CGTGAGCCACGGCGCCTGGCCGG - Intronic
1171782344 20:29430683-29430705 CCACAGCCACGGGGGCGCGCGGG - Intergenic
1172640283 20:36436533-36436555 CGTGAGCCACCGCGCCGGGCGGG - Intronic
1173821146 20:46021627-46021649 CGCGAGACGCGGCGCCGCGCAGG - Intergenic
1173827698 20:46058003-46058025 CGGGAGCCAGGGAGCAGCGCCGG - Intronic
1176178672 20:63739884-63739906 CTGCAGCCTCGGCGCCCGGCCGG + Exonic
1176217583 20:63955671-63955693 CGGCCCCAAAGGCGCCGCGCAGG + Intronic
1176232297 20:64038646-64038668 CGGCCGCCGCGACGCCGGGCAGG - Intronic
1177163998 21:17579563-17579585 CGTGAGCCACTGCGCCCCGCCGG + Intronic
1179833417 21:44012432-44012454 GGGCAGCCCCGAGGCCGCGCCGG - Exonic
1180645274 22:17333525-17333547 CGTGAGCCACCGCGCCGGGCCGG - Intergenic
1180681733 22:17631999-17632021 CGTGAGCCACGGCGCCTGGCCGG + Intronic
1183626781 22:39008791-39008813 CGTGAGCCACTGCGCCGGGCTGG - Intergenic
1184231165 22:43159231-43159253 CAGCAGCCATGGCCCCGCCCTGG + Exonic
1184273181 22:43396378-43396400 CGTGAGCCACGGCGCCCAGCTGG + Intergenic
1184465331 22:44665677-44665699 CGTGAGCCACGGCGCCCGGCTGG - Intergenic
1184472103 22:44702037-44702059 CAGCTGCCACGACGCCTCGCTGG - Intronic
1184537069 22:45094493-45094515 CCGCGGCCACAGCGCCACGCAGG + Intergenic
1184718756 22:46296975-46296997 CGGCGGGCACCGCGCCGCACCGG - Intronic
949178872 3:1102447-1102469 CGGGAGCCACCGCGCCCGGCAGG - Intronic
949251301 3:1987399-1987421 CGGGAGCCACCGCGCCCGGCCGG - Intergenic
949969961 3:9396603-9396625 CGGCGGCCGCGGCTCCGCCCCGG - Intergenic
950729770 3:14947544-14947566 CGCCAGCCTCGCCGCCGCGGCGG - Intergenic
951716806 3:25657778-25657800 CGTCAGCCACCGCGCCCAGCCGG - Intronic
954395182 3:50289723-50289745 CGGCAGCCACGTAGCAGCCCAGG + Exonic
955161712 3:56469802-56469824 CGTGAGCCACCGCGCCCCGCCGG + Intergenic
955322902 3:57986923-57986945 CGTGAGCCACGGCGCCTGGCTGG + Intergenic
955351839 3:58199386-58199408 CGTGAGCCACGGCGCCTGGCTGG - Intronic
955769595 3:62374073-62374095 CGGGGGCCTCGGCGCCGCGCAGG + Intronic
957083148 3:75655699-75655721 CCACAGCCACGGGGGCGCGCGGG + Intergenic
960582747 3:119294689-119294711 CGGCGGCCCCGGAGCGGCGCGGG + Exonic
961013428 3:123449879-123449901 CCCCAGCCTCGGCGCCCCGCGGG + Intergenic
961536683 3:127575147-127575169 CGGCAGCCACGCGGGGGCGCCGG + Intronic
961780030 3:129315934-129315956 CGGAAGCCGGGGGGCCGCGCCGG + Exonic
961798465 3:129426643-129426665 CGTGAGCCACGGCGCCCGGCCGG + Intronic
962855801 3:139343740-139343762 CGTGAGCCACGGCGCCTGGCCGG + Intronic
963342816 3:144057632-144057654 CGTGAGCCACTGCGCCGGGCTGG + Intergenic
967947961 3:194818993-194819015 CGTGAGCCACGGCGCCTGGCCGG - Intergenic
968372751 4:11005-11027 CCACCGCCACGGCGCCGCGGCGG - Intergenic
968372779 4:11126-11148 CCCCCGCCCCGGCGCCGCGCCGG - Intergenic
968372794 4:11175-11197 CCCCCGCCCCGGCGCCGCGCCGG - Intergenic
968372829 4:11298-11320 CTCCCGCCCCGGCGCCGCGCCGG - Intergenic
968651644 4:1762480-1762502 CGGCAGGCTCGGCACTGCGCAGG + Intergenic
968682693 4:1932463-1932485 CGGGAGCCACTGCGCCGGGCTGG - Intronic
968786814 4:2628163-2628185 CGTGAGCCACCGCGCCCCGCCGG + Intronic
969681365 4:8645162-8645184 AGTGAGCCACGGCGCCACGCTGG - Intergenic
969716791 4:8871752-8871774 CGGCGGCCTCCGCGCCGGGCTGG + Exonic
975986184 4:80202923-80202945 CGGGGGCCAGGGCGCCGCGTCGG + Exonic
976053092 4:81031253-81031275 CGGGAGCCGACGCGCCGCGCGGG + Exonic
977401082 4:96533203-96533225 CGTGAGCCACCGCGCCGGGCCGG + Intergenic
978812380 4:112864589-112864611 CGTCAGCCCCGGCGCCCGGCCGG + Intronic
981036366 4:140173657-140173679 CGTGAGCCACGGCGCCCGGCTGG - Intergenic
981504108 4:145481723-145481745 CGGCAGCGGCGGCGGCGCGCGGG + Intronic
982110087 4:152045875-152045897 CGGCTGCAGCGGCTCCGCGCGGG - Intergenic
983409042 4:167373090-167373112 CGTGAGCCACTGCGCCCCGCCGG - Intergenic
983409647 4:167380318-167380340 CGTGAGCCACGGCGCCCCGCTGG + Intergenic
983977869 4:173957097-173957119 AGTGAGCCACGGCGCCCCGCTGG + Intergenic
984198733 4:176692111-176692133 CGTGAGCCACCGCGCCGGGCCGG - Intronic
985462615 4:190121440-190121462 CCCCCGCCCCGGCGCCGCGCCGG + Intergenic
985462643 4:190121561-190121583 CCCCCGCCACGGCGCCGCGGCGG + Intergenic
985508749 5:299828-299850 CGCCAGCCACCGCGCCCAGCTGG + Intronic
990041563 5:51383435-51383457 CGGCAGACTCGGCGCGGCTCGGG - Exonic
992105871 5:73448495-73448517 CGGCAGCCCCGGCGCAGCTCCGG - Intergenic
993726944 5:91380209-91380231 CGGCGGCGGCGGCGGCGCGCGGG - Intronic
993901786 5:93588706-93588728 CGGCAGCCGCGGCCCCACGTAGG - Intronic
996379038 5:122845509-122845531 CCGCAGCCTCGGGGCCCCGCGGG + Exonic
997332411 5:133074557-133074579 CGTGAGCCACGGCGCCCAGCAGG + Intronic
1000014692 5:157266441-157266463 CGGCTCCCCCGCCGCCGCGCCGG - Intronic
1000357266 5:160411145-160411167 CGTCAGCCACCGCGCCCGGCCGG + Intronic
1001992366 5:176128526-176128548 CGTCAGCCACTGCGCCCGGCTGG - Intronic
1002012468 5:176294679-176294701 TGTGAGCCACGGCGCCGAGCCGG - Intronic
1002026251 5:176397800-176397822 AGGCAGCCACAGGGCCGCACCGG + Intronic
1002224507 5:177709640-177709662 CGTCAGCCACTGCGCCCGGCTGG + Intronic
1002419603 5:179138765-179138787 CCGCAGTCACGGCTCCGCGGAGG - Intronic
1002621974 5:180494464-180494486 CGGCGGCGACGGCGGCGCGGAGG + Exonic
1003087780 6:3074959-3074981 CGTGAGCCACGGCGCCCAGCCGG + Intronic
1003139057 6:3456443-3456465 CGGCGGCCTCGGCGCCCCTCGGG - Exonic
1003185016 6:3822852-3822874 TGGGAGCCACCGCGCCGAGCTGG + Intergenic
1004924073 6:20402454-20402476 CGGCGGCTACGGCGCCGCTTTGG - Exonic
1005383579 6:25263010-25263032 CGTGAGCCACGGCGCCCGGCCGG - Intergenic
1005748386 6:28861408-28861430 AGGCAGCCATGGCGCCCAGCAGG + Intergenic
1006103795 6:31703707-31703729 CGTGAGCCACTGCGCCGGGCCGG - Intronic
1006470961 6:34228320-34228342 CGTGAGCCACGGCGCCTGGCAGG - Intergenic
1006547493 6:34792049-34792071 GGGCGGCCGCGGCGCCGCGCTGG + Intronic
1007600140 6:43076280-43076302 CGGCGGCGGCGGCGGCGCGCGGG + Intronic
1011044372 6:83065812-83065834 CGGCAGCCCCGCTGCGGCGCAGG + Exonic
1013619307 6:111872967-111872989 CCGGAGCCTCAGCGCCGCGCAGG - Exonic
1014015658 6:116527234-116527256 CGTGAGCCACCGCGCCGGGCCGG - Intronic
1014272492 6:119349660-119349682 CCGCAGCCCCGGCGCGGCTCAGG + Exonic
1017589745 6:155965979-155966001 CTGCAGCCACAGCACCACGCAGG + Intergenic
1017672399 6:156779257-156779279 CGGCGGCGGCGGCGGCGCGCTGG - Exonic
1017695664 6:157013158-157013180 CGTGAGCCACGGCGCCCTGCCGG + Intronic
1019719290 7:2558872-2558894 CGCGAGCCACTGCGCCGGGCCGG + Intergenic
1021231060 7:18086744-18086766 CGGGAGCCCCAGCGCCGCGGAGG - Intergenic
1021710717 7:23413197-23413219 CGGGAGCCACTGCGCCCGGCAGG - Intronic
1022285113 7:28949333-28949355 CGTGAGCCACTGCGCCCCGCCGG - Intergenic
1023935804 7:44739035-44739057 CGTGAGCCACCGCGCCGAGCCGG + Intergenic
1024575739 7:50762834-50762856 CGTGAGCCACTGCGCCCCGCCGG - Intronic
1025606105 7:63041170-63041192 CGGAAGCCAAGGAGCTGCGCTGG + Intergenic
1029708354 7:102286905-102286927 CGGCTGCCAGAGAGCCGCGCGGG + Intronic
1030227587 7:107169519-107169541 GGGCAGCCCCGGCGCTGCGTCGG - Intronic
1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG + Intronic
1034147253 7:148884206-148884228 CGGCGGCGGCGGCGGCGCGCGGG - Exonic
1034157492 7:148967491-148967513 CGTGAGCCACTGCGCCCCGCCGG + Intergenic
1034174620 7:149090811-149090833 CGGCAGCCGCGGCCGGGCGCCGG - Intergenic
1034400084 7:150856479-150856501 TGGCAGCCACGGCCCAGCCCAGG - Exonic
1034434764 7:151058155-151058177 TGGGAACCACGGCGCCGCGGCGG - Exonic
1035581040 8:738986-739008 CGGCGGCGGCGGCGTCGCGCAGG - Intergenic
1035752000 8:2002716-2002738 CGGCAGCCGCGGCGAGGCGCAGG + Exonic
1038789811 8:30658239-30658261 CGGCAGCCACCGCGGCGCCAGGG + Exonic
1038883599 8:31640055-31640077 CGGCAGCGGCGGCGACGAGCGGG - Intronic
1039211097 8:35215445-35215467 CGTGAGCCACTGCGCCGGGCCGG - Intergenic
1039212711 8:35235387-35235409 CGGCAGCCAATGAGCCGGGCTGG - Intergenic
1039949007 8:42153262-42153284 CCGCAGCCGCGGCGCCGGGAAGG - Intronic
1040941954 8:52843387-52843409 CGTGAGCCACGGCGCCCGGCCGG + Intergenic
1045874060 8:106958430-106958452 CGTGAGCCACCGCGCCCCGCCGG + Intergenic
1049178061 8:141206187-141206209 CGTCAGCCAGGGCGCCAGGCAGG + Intergenic
1049239803 8:141531434-141531456 CGTCAGCCACTGCGCCCGGCCGG + Intergenic
1049463289 8:142739848-142739870 CGGAAGCCACGCCGCCGGCCCGG + Intergenic
1049635201 8:143684495-143684517 CTGCATCCACTACGCCGCGCCGG - Exonic
1049752319 8:144291204-144291226 CGGCGGGCACGTGGCCGCGCTGG - Intronic
1051656310 9:19385302-19385324 CGTGAGCCACCGCGCCGGGCCGG + Intergenic
1056992359 9:91423753-91423775 CGGCGGCGAGGGCGCGGCGCGGG + Exonic
1057773274 9:97984823-97984845 CGGCCGCCCCCGCCCCGCGCCGG + Intronic
1059414801 9:114155988-114156010 CGGCGGCGGCGGCGGCGCGCGGG + Exonic
1060004981 9:119991959-119991981 CGGCAGCCACGGTGCACCGGGGG + Intergenic
1060623007 9:125084449-125084471 CGCCAGCCACCGCGCCCGGCCGG + Intronic
1060944694 9:127563081-127563103 GGGCAGCCATGGCCCCGCGTGGG + Intronic
1061089459 9:128418877-128418899 CGCGAGCCACCGCGCCGTGCCGG + Intronic
1062230608 9:135479821-135479843 CGGCGGCAGCGGCGGCGCGCGGG + Exonic
1062656305 9:137605872-137605894 CGGGAGCCCTGGCCCCGCGCAGG - Intronic
1203774720 EBV:66343-66365 CGGCACCGACAGAGCCGCGCTGG - Intergenic
1185719853 X:2372891-2372913 CGTCAGCCACCGCGCCTGGCTGG + Intronic
1189310042 X:40012496-40012518 CGGCCGGCGCGGCGCGGCGCGGG + Intergenic
1189810119 X:44773905-44773927 CGTCAGCCACCGCGCCCGGCTGG + Intergenic
1190285231 X:48957219-48957241 CGGCGGTCCCGGCGACGCGCTGG - Exonic
1191253115 X:58268615-58268637 CAGCAGCCCCTGCGCCGCACCGG - Intergenic
1194108183 X:89798091-89798113 CGTGAGCCACAGCGCCGGGCCGG - Intergenic
1195668349 X:107449915-107449937 CGGCAGCGGCGGCGCAGCGGCGG - Intergenic
1196388981 X:115190021-115190043 TTGCAGCCACGGCGCTGGGCCGG + Exonic
1199230982 X:145436428-145436450 CGGCAGCCACCGCGTCGGGGAGG + Intergenic
1199772596 X:150984039-150984061 CGGCGGCGGCGGCGCCGGGCGGG - Intronic
1200159036 X:153995236-153995258 CGTGAGCCACTGCGCCTCGCTGG - Intergenic
1200460840 Y:3452820-3452842 CGTGAGCCACAGCGCCGGGCCGG - Intergenic
1200496770 Y:3895115-3895137 CGTCAGCCACCGCGCCTGGCTGG - Intergenic
1202044767 Y:20727109-20727131 CAGCAGCCAGGGGGCCGCGGCGG - Intergenic