ID: 1152548573

View in Genome Browser
Species Human (GRCh38)
Location 17:81017360-81017382
Sequence CCAAAGGATCACGTGTACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152548573_1152548580 13 Left 1152548573 17:81017360-81017382 CCTGGGTACACGTGATCCTTTGG No data
Right 1152548580 17:81017396-81017418 AGTACAGGTATGTGCCACAATGG No data
1152548573_1152548576 -2 Left 1152548573 17:81017360-81017382 CCTGGGTACACGTGATCCTTTGG No data
Right 1152548576 17:81017381-81017403 GGCCTCAGCCTCCTAAGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152548573 Original CRISPR CCAAAGGATCACGTGTACCC AGG (reversed) Intergenic
No off target data available for this crispr