ID: 1152548576

View in Genome Browser
Species Human (GRCh38)
Location 17:81017381-81017403
Sequence GGCCTCAGCCTCCTAAGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152548573_1152548576 -2 Left 1152548573 17:81017360-81017382 CCTGGGTACACGTGATCCTTTGG No data
Right 1152548576 17:81017381-81017403 GGCCTCAGCCTCCTAAGTACAGG No data
1152548572_1152548576 7 Left 1152548572 17:81017351-81017373 CCTCAAACTCCTGGGTACACGTG No data
Right 1152548576 17:81017381-81017403 GGCCTCAGCCTCCTAAGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152548576 Original CRISPR GGCCTCAGCCTCCTAAGTAC AGG Intergenic
No off target data available for this crispr