ID: 1152548580

View in Genome Browser
Species Human (GRCh38)
Location 17:81017396-81017418
Sequence AGTACAGGTATGTGCCACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152548573_1152548580 13 Left 1152548573 17:81017360-81017382 CCTGGGTACACGTGATCCTTTGG No data
Right 1152548580 17:81017396-81017418 AGTACAGGTATGTGCCACAATGG No data
1152548572_1152548580 22 Left 1152548572 17:81017351-81017373 CCTCAAACTCCTGGGTACACGTG No data
Right 1152548580 17:81017396-81017418 AGTACAGGTATGTGCCACAATGG No data
1152548577_1152548580 -10 Left 1152548577 17:81017383-81017405 CCTCAGCCTCCTAAGTACAGGTA No data
Right 1152548580 17:81017396-81017418 AGTACAGGTATGTGCCACAATGG No data
1152548575_1152548580 -3 Left 1152548575 17:81017376-81017398 CCTTTGGCCTCAGCCTCCTAAGT No data
Right 1152548580 17:81017396-81017418 AGTACAGGTATGTGCCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152548580 Original CRISPR AGTACAGGTATGTGCCACAA TGG Intergenic
No off target data available for this crispr