ID: 1152548929

View in Genome Browser
Species Human (GRCh38)
Location 17:81019666-81019688
Sequence GCTCCCGCCTCCCCGGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 164}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152548929_1152548938 21 Left 1152548929 17:81019666-81019688 CCCCACTCCGGGGAGGCGGGAGC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1152548938 17:81019710-81019732 TGCCCAGCGGGGCCAGTGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 288
1152548929_1152548937 17 Left 1152548929 17:81019666-81019688 CCCCACTCCGGGGAGGCGGGAGC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1152548937 17:81019706-81019728 CTTCTGCCCAGCGGGGCCAGTGG 0: 1
1: 0
2: 2
3: 30
4: 235
1152548929_1152548935 9 Left 1152548929 17:81019666-81019688 CCCCACTCCGGGGAGGCGGGAGC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1152548935 17:81019698-81019720 CATGGTCACTTCTGCCCAGCGGG 0: 1
1: 0
2: 2
3: 19
4: 225
1152548929_1152548936 10 Left 1152548929 17:81019666-81019688 CCCCACTCCGGGGAGGCGGGAGC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1152548936 17:81019699-81019721 ATGGTCACTTCTGCCCAGCGGGG 0: 1
1: 0
2: 1
3: 12
4: 143
1152548929_1152548934 8 Left 1152548929 17:81019666-81019688 CCCCACTCCGGGGAGGCGGGAGC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1152548934 17:81019697-81019719 ACATGGTCACTTCTGCCCAGCGG 0: 1
1: 0
2: 2
3: 14
4: 196
1152548929_1152548933 -9 Left 1152548929 17:81019666-81019688 CCCCACTCCGGGGAGGCGGGAGC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1152548933 17:81019680-81019702 GGCGGGAGCTCTGTATCACATGG 0: 1
1: 0
2: 1
3: 4
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152548929 Original CRISPR GCTCCCGCCTCCCCGGAGTG GGG (reversed) Intergenic
900120158 1:1045422-1045444 GCTCCTGCCGCCCAGGTGTGGGG + Exonic
900137651 1:1125187-1125209 GCTCCCGGCTCCCGGGGCTGTGG + Intergenic
900376809 1:2358708-2358730 GCTCTCGCCTTCCAGGAGAGAGG + Exonic
901007595 1:6179517-6179539 GGTCCCGCCTGCCCGCAGCGAGG + Intronic
903830623 1:26171952-26171974 GGACCCGCCTCCTCGGAGAGTGG - Exonic
904618913 1:31764019-31764041 GCACCCGCCGCCCGGGAGAGCGG - Exonic
905656324 1:39688336-39688358 TCTCCCTCATCCCCGGGGTGTGG + Intronic
908131482 1:61080016-61080038 GCTCCCTCCCCCGCGGAGGGAGG - Intronic
915485413 1:156216782-156216804 GCCGCCCCTTCCCCGGAGTGGGG + Intronic
917869664 1:179229816-179229838 GCCCCCGCCTCCTCGCAGGGTGG + Intergenic
921131768 1:212225785-212225807 GCACCAGCCTCCCCGGAATTCGG - Intergenic
924557157 1:245128357-245128379 CCTACCACCTCCCAGGAGTGTGG - Intergenic
1065483825 10:26217762-26217784 GCTCCCGCCTACCCGCAGCCAGG - Intronic
1065887821 10:30094364-30094386 CCTCCCGCCTCCCGGGATCGTGG - Intronic
1066220784 10:33335249-33335271 GATCCCGCCGCCGCGCAGTGCGG + Intronic
1066370376 10:34814717-34814739 GCGCCCCCCGCCCCGGACTGCGG - Intronic
1066370635 10:34815521-34815543 GGTCCCGCGCCCCCGGAGGGAGG - Intergenic
1069638816 10:69942007-69942029 GGTCTCGCCTCCCCTGAGGGTGG - Intronic
1071335465 10:84596934-84596956 GCTCCCTCCTCCCCGAAATGGGG + Intergenic
1075885498 10:125896229-125896251 GCTCCCGATTCCCGGGAGGGCGG + Intronic
1076818485 10:132926263-132926285 GCTGCCCCCTCCCCGCCGTGTGG - Intronic
1077126490 11:941003-941025 GCTCCGAGCTCCACGGAGTGTGG - Intronic
1080158531 11:29143216-29143238 CCTCCCCCCTCCCCCGAGTCAGG + Intergenic
1080847633 11:36039979-36040001 TCTGCCGCCTTCCCGGAGGGAGG + Intronic
1083430766 11:62612685-62612707 GCTCTCGGCTCCCGGGGGTGGGG + Exonic
1083620920 11:64049012-64049034 GCTGCCTCCTGCCCTGAGTGTGG + Intronic
1084112531 11:67023314-67023336 GCTCCCGCCTCCGAGGAGCGCGG - Intronic
1085391264 11:76183507-76183529 GCATCCACCTCCCCGGAGTGGGG + Intergenic
1086455754 11:86956851-86956873 GCTCCAGCAGCCCCGGAATGAGG + Intergenic
1089672381 11:120065404-120065426 GCTCCAGCCTCCAGGCAGTGGGG - Intergenic
1090116164 11:123976844-123976866 GCTCCTGCCTCACTGGAGCGAGG + Exonic
1092239240 12:6827286-6827308 GCGCCCGTCTCCCCAGAGTCTGG - Exonic
1094149213 12:27263768-27263790 GCTCCTGCCTTCAAGGAGTGTGG + Intronic
1096073240 12:48787664-48787686 CCTCCCTCCTCCCCAGAGTCAGG + Intronic
1099973666 12:89525272-89525294 GCTGCCACTTCCCCGGAGTCCGG + Intronic
1101943286 12:109116713-109116735 GCTCGCCCCTCCCCGGGGTCCGG + Intronic
1102678287 12:114673229-114673251 GCTCCCTCCTCCCTGGAGTGGGG + Intronic
1103547507 12:121712697-121712719 GGCCCCGCCTCCCAGGCGTGGGG + Intergenic
1108035376 13:46285336-46285358 CCTCCCGCTTCCCAGGAGTGTGG + Intergenic
1108591244 13:51914696-51914718 GATCCTGGCTCCTCGGAGTGTGG + Intergenic
1110219527 13:73058953-73058975 GGCCCCGCCCCCCCGGAGTTGGG + Exonic
1114557644 14:23571123-23571145 GCTGCAGCCTCCGAGGAGTGGGG + Exonic
1115203137 14:30874689-30874711 GCCCCCGCCTCCCCGCGGTGCGG + Intronic
1117604848 14:57417782-57417804 GCTCTCGCCACCCCAAAGTGAGG - Intergenic
1118351004 14:64972376-64972398 GCCGCCGCCGCCCCGGAGAGAGG + Intronic
1118484022 14:66196896-66196918 GCTCACTCCTCCCCACAGTGAGG - Intergenic
1122775456 14:104114978-104115000 GGACCCGCCTCCCCACAGTGGGG + Exonic
1129356307 15:74994451-74994473 GCTCCATCCTGCCAGGAGTGGGG - Intronic
1130339393 15:82986380-82986402 GCTCCCTCCTCCCGGGCGTCCGG - Intronic
1132846229 16:2002080-2002102 GCTCCAGCCTGGCCGGAGGGTGG + Intronic
1132956335 16:2596067-2596089 GCCCCAGGCTCCCAGGAGTGTGG - Intronic
1135325296 16:21521746-21521768 GCCGCCTCCTCCCCGGGGTGGGG - Intergenic
1136278279 16:29192190-29192212 TCTCCCGCCTCCCTGCTGTGTGG - Intergenic
1136336782 16:29615014-29615036 GCCGCCTCCTCCCCGGGGTGGGG - Intergenic
1136867479 16:33769136-33769158 TCTCCTCCCTCCCCAGAGTGCGG - Intergenic
1139357690 16:66377159-66377181 CCTGCCGCCTCCCCTGAGTCAGG + Intronic
1139465379 16:67151222-67151244 ACTCCCGCGTCTCTGGAGTGGGG + Intergenic
1141481972 16:84312955-84312977 GCGCCCGCCTCCTCGGCCTGCGG - Exonic
1142082657 16:88158224-88158246 TCTCCCGCCTCCCTGCTGTGTGG - Intergenic
1142400899 16:89858322-89858344 GCTCCCGTCTCCCCAGGGTTTGG + Exonic
1142413122 16:89926163-89926185 GCTCCTCCCTCCCCGGGGCGGGG + Intronic
1203104679 16_KI270728v1_random:1347067-1347089 TCTCCTCCCTCCCCAGAGTGCGG + Intergenic
1203128835 16_KI270728v1_random:1615301-1615323 TCTCCTCCCTCCCCAGAGTGCGG - Intergenic
1143483358 17:7239305-7239327 GCGCCCCCCTCCCCGGAGCCGGG + Exonic
1144761824 17:17711414-17711436 CCTCCCAGCTCCCCGGAGTTGGG + Intronic
1145110171 17:20155728-20155750 GCTTCCGCCTCACCGCAGTGGGG + Intronic
1145303507 17:21656722-21656744 GCTCCTGCGTCCCCAGAGTCAGG + Intergenic
1147395657 17:40140631-40140653 GCTCCCGCCTCCCCGCAACGGGG - Exonic
1147705215 17:42421483-42421505 GATCCCGCCTCCCTGGGGTTAGG + Intronic
1148225940 17:45897636-45897658 GCTCCCGCCTGCTGGGAATGGGG - Intronic
1148240708 17:45997955-45997977 GCTCCCGCCACCCAGCACTGGGG + Intronic
1149223296 17:54439888-54439910 GCTCCCGGCTCCCAAGAGTCGGG - Intergenic
1149565242 17:57636493-57636515 GGTCTCGCCTCTCCTGAGTGGGG - Intronic
1151933321 17:77246962-77246984 GCGCCCGCCTCACCTGGGTGCGG - Intergenic
1152548929 17:81019666-81019688 GCTCCCGCCTCCCCGGAGTGGGG - Intergenic
1153565694 18:6415014-6415036 CCACCCGGCTCCCCGGGGTGTGG - Intronic
1155428072 18:25726621-25726643 GCTCCCTGCTCACCAGAGTGGGG - Intergenic
1157688796 18:49664262-49664284 GCTCCCTTCTCCCCTGACTGAGG - Intergenic
1158602580 18:58867487-58867509 GCCCAGGCCTCCCTGGAGTGGGG + Intronic
1158618891 18:59013143-59013165 TCTCCCGCCTCCCTGGGGTTAGG + Intergenic
1160191426 18:76717314-76717336 CCTCCCACCCCCCCGGATTGAGG + Intergenic
1160256014 18:77249720-77249742 GCGCTCGCCTCTGCGGAGTGCGG - Intergenic
1160796712 19:949070-949092 CTTCCCGCCTCTCCGGACTGTGG + Intronic
1161309279 19:3585347-3585369 GCTCAGGCCCCCCCGGACTGCGG + Intergenic
1162144590 19:8605802-8605824 GCTCCCCCCTCCCAGGAGCCCGG - Exonic
1163395569 19:17058572-17058594 GCTCCCGCTTCCTCTGAGAGAGG + Exonic
1163428107 19:17250239-17250261 CCTCCCGCCTCCCCAGCTTGGGG - Exonic
1163541782 19:17915753-17915775 GCTTCTGCCTCCATGGAGTGGGG + Intergenic
1166078010 19:40425366-40425388 GTTCCGGACTCCCCGGACTGCGG - Intronic
1166852932 19:45768978-45769000 GATCTCGCCTTCCCGGCGTGGGG - Exonic
1166934313 19:46321807-46321829 GCACCCGCCTTCCCTGAGCGAGG + Exonic
1167080043 19:47272083-47272105 GCCCCTGCCTTCCCGGAGAGTGG + Intergenic
925624389 2:5827506-5827528 GCTCCCTCTTCCCAGGAGTAAGG - Intergenic
927606688 2:24491932-24491954 GCGGCCGCCTGCCCGGCGTGGGG + Exonic
928149174 2:28810802-28810824 TCTCCCGCCAACCCGGAGCGAGG - Intronic
929570486 2:43019742-43019764 GCTCCCTCCTCCACTGAGTATGG - Intergenic
929787750 2:45004392-45004414 GCCCTCGCTTTCCCGGAGTGAGG - Intergenic
933877941 2:86637438-86637460 TCTCCGGCCTCCCTGGAGTTAGG + Intronic
934756290 2:96827069-96827091 GCACCCGCCTGCTAGGAGTGGGG - Intronic
936011252 2:108926730-108926752 GCTCCGCCCTCCCCACAGTGTGG - Intronic
941993572 2:171579893-171579915 GCCCCTGCCTCTCTGGAGTGGGG + Intergenic
948473785 2:238203617-238203639 GCTGCCGCCCGCCCGGGGTGTGG - Exonic
1174103573 20:48146168-48146190 GCACCTGCCTCCCAGGACTGAGG + Intergenic
1176101231 20:63365457-63365479 CCTCACCCCTCCCTGGAGTGAGG + Intronic
1176546961 21:8206330-8206352 GCCGCCCCTTCCCCGGAGTGGGG + Intergenic
1176554866 21:8250539-8250561 GCCGCCCCTTCCCCGGAGTGGGG + Intergenic
1176565912 21:8389377-8389399 GCCGCCCCTTCCCCGGAGTGGGG + Intergenic
1176573787 21:8433564-8433586 GCCGCCCCTTCCCCGGAGTGGGG + Intergenic
1180972872 22:19824735-19824757 GCCCCTGCCTCCCTTGAGTGGGG - Intronic
1184264960 22:43342048-43342070 GGTCCCGCGTGCCCCGAGTGAGG - Intronic
1185089921 22:48760628-48760650 TCTCCTGCCTGCCCAGAGTGTGG + Intronic
1185222861 22:49637596-49637618 CCTCGCGTCTCCCCTGAGTGTGG - Intronic
1203251836 22_KI270733v1_random:122615-122637 GCCGCCCCTTCCCCGGAGTGGGG + Intergenic
1203259887 22_KI270733v1_random:167698-167720 GCCGCCCCTTCCCCGGAGTGGGG + Intergenic
959398235 3:105868552-105868574 TCTCCCTCCTCCCCGGCCTGCGG + Intronic
960556432 3:119035100-119035122 GCGCCCTCCTCGCCGGAGTTAGG + Intronic
960982979 3:123249326-123249348 TCTCTCCCCTCCCCGGAGGGTGG + Intronic
961446540 3:126983932-126983954 GCTCCCACTGGCCCGGAGTGCGG + Intergenic
962854217 3:139329548-139329570 GCGCCCTCCTCCGCGTAGTGAGG - Intronic
963799107 3:149658884-149658906 GCTCCAGGCTCCCCGGAGGGCGG - Intronic
966355174 3:179071921-179071943 GCTCCCGCATCCCCGGCGGGCGG + Exonic
966732733 3:183163828-183163850 GCTGCCGACTCCCCGGCGTGCGG + Intronic
967837231 3:193974912-193974934 GCTCCTGTCTCCCCTGAGAGGGG + Intergenic
967979760 3:195058776-195058798 GCTCCTGCCTCCCAGGGGTGCGG + Intergenic
968591644 4:1462617-1462639 ACACCCGCCTCCCCTGAGTGTGG - Intergenic
968593285 4:1470370-1470392 GCTGCCCCCTCCTCGGAGAGTGG - Intergenic
969239522 4:5889409-5889431 GCTCCTGCCTCCCAGCACTGTGG + Intronic
969858548 4:10018820-10018842 CCTCCCCTCTCCCCCGAGTGGGG + Intronic
970601877 4:17647201-17647223 CCTCCCCCCTGCCCGAAGTGGGG - Intronic
974069435 4:57110447-57110469 GCTCTCACCGCCCCGGGGTGTGG - Intergenic
975584925 4:75940319-75940341 TCTGCAGCCTCCCGGGAGTGGGG + Intronic
975883569 4:78939267-78939289 GGTCCCGCCTCCCCGGGGAGGGG + Exonic
976402101 4:84619088-84619110 GCTCCCGCCTCCCAAGGGTGAGG + Intronic
983708626 4:170688068-170688090 GCTCTCGCCTCCCAGGTGTCAGG - Intergenic
990955458 5:61333948-61333970 GCTCCCGCGTCCCCGCGGCGCGG + Intronic
990970699 5:61502628-61502650 GTTCCCCCATCCCCGGACTGTGG + Intronic
991618475 5:68520607-68520629 GCTCTCGCCTCCCTGGATGGGGG + Intergenic
992227713 5:74635181-74635203 GCTAACGCCTTCTCGGAGTGGGG + Exonic
994043439 5:95284047-95284069 GCCCCAGCCTCCCCCGAGGGGGG - Exonic
1000071398 5:157743944-157743966 GCGCCCGCCGCCCCGGACTCCGG - Exonic
1001458156 5:171883376-171883398 CCTCCCGCCTCCCCACACTGGGG - Intronic
1002061202 5:176627062-176627084 GCACCCGCCTCCCAGGGCTGGGG - Intronic
1006155976 6:32013011-32013033 GCTGTCGCCTCCCCGAAGGGTGG - Intergenic
1006162309 6:32045865-32045887 GCTGTCGCCTCCCCGAAGGGTGG - Exonic
1017946975 6:159103943-159103965 GCCACCGCCACCCCAGAGTGGGG - Intergenic
1018390080 6:163335485-163335507 GCTCCTGCCTCCCAGGACAGTGG + Intergenic
1018774455 6:166999750-166999772 GGTCCCGCCCCCACGGAATGAGG - Intronic
1022485121 7:30771810-30771832 GCTGCCGCCGCCCCGGAGCGCGG - Intronic
1022721076 7:32942607-32942629 GCTGCCGCCTCCCCGGGCCGAGG + Intergenic
1023354364 7:39352381-39352403 GCTGCCGCCTCCCCTCACTGAGG - Intronic
1026562431 7:71461714-71461736 GCTGTTGCCTCCCAGGAGTGGGG + Intronic
1027592654 7:80135112-80135134 GCTCCCTCCGCGCCCGAGTGCGG - Exonic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1032773850 7:135090041-135090063 GCTCCTTCCTCCCCAGAGTCAGG - Intronic
1035036251 7:155897112-155897134 GTTCCTTCCTCCCTGGAGTGAGG - Intergenic
1035100499 7:156392330-156392352 GCTTCCTCCTCCCTGGAATGAGG - Intergenic
1035172041 7:157022163-157022185 GCTCCCTCCTCCCCTGACCGGGG - Intergenic
1035530184 8:345252-345274 GCCCCCGGCTCTCCGCAGTGTGG - Intergenic
1039828873 8:41197126-41197148 GCTCTCAGCTCCCCTGAGTGGGG + Intergenic
1039875090 8:41578316-41578338 GCTCTCGGCTCCCCGGAGGTCGG - Intronic
1039907638 8:41798200-41798222 GCTCCAGCCTCCCCGGGGGGCGG - Intronic
1043372949 8:79613372-79613394 GCGCTCCCCTCCCCGGAGTTGGG + Intronic
1044599705 8:93991548-93991570 GCTCCCGGCTCCCCGCGGCGGGG + Intergenic
1049154154 8:141056714-141056736 CCTGCCGCCTCCCTGGCGTGAGG - Intergenic
1049225603 8:141449138-141449160 GCTCCTGGCTCCTGGGAGTGTGG + Intergenic
1049435804 8:142585689-142585711 GCCCCCGCCTCCCCCCAGCGAGG - Intergenic
1049452511 8:142669809-142669831 GCGCCCGCCTGCCCAGACTGCGG + Intronic
1049552707 8:143267800-143267822 GGTCCCGCCGCTCCGGAGCGAGG + Intronic
1049597406 8:143491170-143491192 GCTCCGCCCTCCCCGGCCTGAGG + Intronic
1049782568 8:144435604-144435626 ACACCTGCCTGCCCGGAGTGGGG + Intronic
1056443493 9:86642757-86642779 GGTACCGCCTGCCAGGAGTGAGG - Intergenic
1060548951 9:124476281-124476303 GCTCCCCCATCCTGGGAGTGGGG - Intronic
1060751241 9:126170839-126170861 GCTCCCACCTCCACTGAATGTGG - Intergenic
1060943562 9:127557165-127557187 GATCCAGCCTACCAGGAGTGGGG + Intronic
1060968546 9:127724906-127724928 GCTCCCGCCCCCACGGTGGGCGG + Intronic
1061033402 9:128100323-128100345 GCCCCCGCCTCCCAGGAGGTGGG - Intronic
1061362892 9:130155036-130155058 GCTCCCGCCTGCCCTGCCTGGGG - Intergenic
1061490283 9:130940365-130940387 GATCCCGGCTTCCCGGACTGAGG + Intergenic
1062022785 9:134327027-134327049 GCTCCGGCCTCCCTGGCCTGGGG + Intronic
1203468238 Un_GL000220v1:105766-105788 GCCGCCCCTTCCCCGGAGTGGGG + Intergenic
1203476059 Un_GL000220v1:149738-149760 GCCGCCCCTTCCCCGGAGTGGGG + Intergenic
1186839565 X:13471510-13471532 GCTCCCATCTCACTGGAGTGAGG - Intergenic